ID: 1073482734

View in Genome Browser
Species Human (GRCh38)
Location 10:103797276-103797298
Sequence CTGTGAGAGAAGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073482730_1073482734 -3 Left 1073482730 10:103797256-103797278 CCTCACAGGTAGCAGGTAAGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG No data
1073482729_1073482734 3 Left 1073482729 10:103797250-103797272 CCAAGACCTCACAGGTAGCAGGT 0: 1
1: 0
2: 4
3: 37
4: 329
Right 1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG No data
1073482726_1073482734 10 Left 1073482726 10:103797243-103797265 CCCTAATCCAAGACCTCACAGGT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG No data
1073482727_1073482734 9 Left 1073482727 10:103797244-103797266 CCTAATCCAAGACCTCACAGGTA 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073482734 Original CRISPR CTGTGAGAGAAGAAGGTGGG TGG Intronic
No off target data available for this crispr