ID: 1073486651

View in Genome Browser
Species Human (GRCh38)
Location 10:103823494-103823516
Sequence CCTAGCACATGGAACTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073486651 Original CRISPR CCTAGCACATGGAACTTGCT AGG (reversed) Intronic
903856450 1:26340421-26340443 CCAAGCACATGGGAGGTGCTGGG - Intronic
904075761 1:27841009-27841031 CCCAGCACACGGCACTTTCTTGG + Exonic
906706728 1:47900359-47900381 CCTGGCAGGTGGCACTTGCTCGG - Intronic
907458587 1:54592046-54592068 CCTAGCACATGGCACAGGGTGGG - Intronic
907717914 1:56944889-56944911 CCTATGACATGGCACTTGTTGGG - Intronic
907871700 1:58449444-58449466 CCAAGCAGATGGAACTTCCCAGG + Intronic
910029514 1:82701255-82701277 CATGGCAAATGGAACTTTCTAGG + Intergenic
913907438 1:124614472-124614494 CATAACACATGGAAGTTACTGGG - Intergenic
915239490 1:154509935-154509957 CCCAGCACCTGGGGCTTGCTTGG + Intronic
916445663 1:164869548-164869570 CCTGGCACATAGAAGGTGCTCGG - Intronic
918111312 1:181457586-181457608 CCTAGCACATGAAATCTGCTAGG - Intronic
919249228 1:195030896-195030918 CCTTGCTCCTGGCACTTGCTCGG - Intergenic
919487142 1:198158859-198158881 TCTCGCACGGGGAACTTGCTGGG + Intronic
922852058 1:228741206-228741228 GCAAGCACATGCAAATTGCTTGG + Intronic
923137976 1:231134968-231134990 CCTGGCACATGGTAGGTGCTCGG - Intergenic
923452036 1:234127039-234127061 CCTACAACATGCAACTTTCTAGG + Intronic
1067358371 10:45552637-45552659 CCTGGCACTTGGAAGATGCTCGG - Intronic
1071172842 10:82887672-82887694 CCTAGCACATTGCAATTGCTGGG - Intronic
1073486651 10:103823494-103823516 CCTAGCACATGGAACTTGCTAGG - Intronic
1075615650 10:123889443-123889465 CCCACCACATGGAACTAGCTGGG - Intronic
1076531470 10:131147927-131147949 CCTGGCCCATGGAACGTGCCTGG - Intronic
1078956295 11:16199331-16199353 CCTAGCACATAGAAAGTGTTTGG - Intronic
1080140223 11:28909089-28909111 CATAGCTAATGGAAGTTGCTTGG + Intergenic
1083406882 11:62463677-62463699 CCTGGGGTATGGAACTTGCTGGG + Intronic
1084475704 11:69387419-69387441 CCTGGCACATGGTAGGTGCTAGG + Intergenic
1084714620 11:70865836-70865858 CCTAGCACAAGGCAGGTGCTTGG - Intronic
1084747434 11:71182085-71182107 CCTAGCCTCTGGAACTTGCTGGG - Intronic
1087743099 11:101912151-101912173 CCTAGCACCTGGAAAGTGCTTGG + Intronic
1087907018 11:103710045-103710067 CCTAGGCCCTGGACCTTGCTAGG + Intergenic
1096279867 12:50243739-50243761 CTTAACACATGGAACTGGTTTGG - Intronic
1101609343 12:106276321-106276343 CCTGGCACATAGTACATGCTCGG - Intronic
1102016274 12:109649962-109649984 CCTGGCTCATGGAAAGTGCTCGG + Intergenic
1102571460 12:113829525-113829547 CCTGGCACATAGAATATGCTGGG - Intronic
1107635575 13:42388986-42389008 CCTGGCACATGGAAGGTGCTTGG + Intergenic
1107805030 13:44145639-44145661 CCTAGCACATGGTAGGTGCTTGG + Intronic
1108581867 13:51834694-51834716 CCTTGAACATGGACTTTGCTGGG + Intergenic
1109149244 13:58823827-58823849 CCCAGCACTTGGCACCTGCTGGG - Intergenic
1110089513 13:71427626-71427648 CCTGTCACATTCAACTTGCTTGG - Intergenic
1113120981 13:106923706-106923728 TCTAGCACATGGAAGCAGCTTGG + Intergenic
1113536181 13:111067716-111067738 CCTTGGACATGGAACTGTCTGGG - Intergenic
1117035826 14:51727521-51727543 CCTGGCACATAGTAATTGCTCGG + Intronic
1117338413 14:54774309-54774331 GGTATCACATGGAACTTCCTGGG - Intronic
1120862623 14:89268624-89268646 CCCTGCACATGGAATCTGCTGGG - Intronic
1121735039 14:96212567-96212589 CATAGCACATAGCACTTCCTGGG - Intronic
1127066694 15:55247494-55247516 CCTAGAACATGAAACATGCATGG + Intronic
1128539101 15:68512554-68512576 CCTACCACAAGGACCTTGCATGG - Intergenic
1128756695 15:70188133-70188155 CCTAGCTCCTGGACCTGGCTTGG + Intergenic
1129313407 15:74727072-74727094 CCTGGCACATAGTAGTTGCTTGG - Intergenic
1130112450 15:80977043-80977065 CGTAGCACATGGAGTTTGGTAGG - Exonic
1132152311 15:99471129-99471151 ACGAGCTCATGGAATTTGCTGGG - Intergenic
1132270200 15:100517476-100517498 CTTACCTCATGAAACTTGCTTGG + Intronic
1134480026 16:14611214-14611236 CCCAGAACATGGAAATGGCTTGG + Intronic
1135040371 16:19113606-19113628 CCTGGCACATGGTAGGTGCTCGG + Intergenic
1135376554 16:21952541-21952563 CCTAGCTCAAGGCACTTTCTGGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136460760 16:30408597-30408619 CCTGGCACATAGAAAATGCTAGG - Intronic
1138031392 16:53562170-53562192 CCTGGCACAGAGAAATTGCTGGG - Intergenic
1138395060 16:56697676-56697698 CCTTGCTGATGGGACTTGCTGGG + Intronic
1139935230 16:70565641-70565663 ACCAGCACATGGAAAATGCTGGG + Intronic
1140232798 16:73131822-73131844 CCCAGAAAATGCAACTTGCTGGG - Intronic
1140787543 16:78357257-78357279 ACTAGCACAAAGAACATGCTAGG + Intronic
1141469026 16:84226047-84226069 CCTAGGACCCGGAACTTTCTGGG - Intronic
1141844176 16:86595869-86595891 CCCAGCACATGTTAATTGCTGGG - Intergenic
1143950731 17:10630462-10630484 AAAAGCACATGGGACTTGCTAGG + Intronic
1149982730 17:61324096-61324118 CTTAGCACATGGGACATACTGGG + Intronic
1152910510 17:83002765-83002787 CCTGGCTCTTGGAACGTGCTGGG + Intronic
1154135475 18:11774009-11774031 CCTAGCACATGAAGCTTTTTGGG + Intronic
1157602740 18:48904114-48904136 CCTAGGACATGGCACTTAATAGG + Intergenic
1158516944 18:58138559-58138581 CACAGCACATGGAACTGACTAGG - Intronic
1168237022 19:55069883-55069905 TCCAGCACATGAAACATGCTTGG + Intronic
941299974 2:163788787-163788809 TTTAGCACATAGAAGTTGCTCGG - Intergenic
947822711 2:233083197-233083219 CCCAGCACAAGGAAGCTGCTGGG + Intronic
1172201133 20:33126749-33126771 CCTGGCACATGGCAAGTGCTCGG - Intergenic
1172386940 20:34540700-34540722 ACTAGCACATGGCAGTCGCTTGG + Exonic
1176587552 21:8603512-8603534 CCTAGTAGCTGGAACCTGCTAGG + Intergenic
1177198620 21:17929697-17929719 TCTAACACAGGGAACTTGCCCGG + Intronic
1177448319 21:21229119-21229141 CAAAACACATTGAACTTGCTTGG + Intronic
1178412600 21:32377861-32377883 CTCAGCACATGGCAGTTGCTCGG - Intronic
1180270382 22:10580510-10580532 CCTAGTAGCTGGAACCTGCTAGG + Intergenic
949139802 3:618239-618261 CCTAGTAGCTGGAACCTGCTAGG - Intergenic
950141859 3:10621142-10621164 CTTAGCACCTGGAGCTTGCTGGG + Intronic
950531672 3:13555945-13555967 CCTACCACAGGGGACTTCCTGGG - Intronic
951732281 3:25823652-25823674 CCTAGAACATGGCACCTGCCTGG - Intergenic
952174316 3:30844829-30844851 CCTGGCACATGGAACAAACTAGG + Intronic
953433140 3:42856059-42856081 CCTAGCACATGGCTGGTGCTGGG - Intronic
953527825 3:43709165-43709187 CTTAGCACATGGCAGATGCTTGG - Intronic
957619345 3:82574662-82574684 CCTAGCACCTGGCACTTTCATGG - Intergenic
961736492 3:129004999-129005021 CCTGGCACATGGTAGATGCTTGG + Intronic
962215641 3:133518749-133518771 CCTAGTAAATGGAACCTGCATGG + Intergenic
962776454 3:138665554-138665576 TCTGGCACATGGCACTTACTGGG - Intronic
966551797 3:181213598-181213620 CCTACCACCTGGGACTTGCAGGG + Intergenic
968008566 3:195259050-195259072 CCTGGCACATGGCAGGTGCTTGG - Intronic
971502182 4:27329333-27329355 ACTAGCACATGGAAGGTACTTGG + Intergenic
971604202 4:28636464-28636486 CCTAGCACATGGCAAATGGTTGG + Intergenic
972702228 4:41505215-41505237 CATAGCATCTGGCACTTGCTTGG + Intronic
979543452 4:121913237-121913259 CGTAGCACATAGAAATTTCTTGG + Intronic
980275716 4:130647248-130647270 CCTTGAACATGGTACTTGCCTGG + Intergenic
981851330 4:149233821-149233843 CCTACCACATGGAATTTATTGGG - Intergenic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
986010760 5:3712928-3712950 CTTGGCCCATGTAACTTGCTAGG + Intergenic
986335742 5:6754099-6754121 CCTGGCACGTGTGACTTGCTTGG + Intronic
990893306 5:60671255-60671277 CCTAGAAGATGGAAATTACTAGG - Intronic
992565308 5:77990280-77990302 CCTTGCACAGGGAACCTGCCAGG + Intergenic
995560877 5:113380538-113380560 CCTGGCACAGGGAAGATGCTTGG - Intronic
996325257 5:122266394-122266416 CTTAGCACAGGGAAATTGCTTGG - Intergenic
996403652 5:123087439-123087461 CCAAGCGCTTGGAACTAGCTGGG + Intergenic
997178402 5:131802516-131802538 CCTAGCACTTGGAACATAGTAGG - Intergenic
997358753 5:133281042-133281064 CCCCACACATGGAACGTGCTGGG + Intronic
997361135 5:133295756-133295778 CCTAGGACATTGCACTTGCCTGG + Intronic
997362309 5:133302944-133302966 CCCACCACATGGAAAGTGCTAGG + Intronic
997588187 5:135056842-135056864 CCTGGCACATGGTACGTGCTTGG - Intronic
999245492 5:150152256-150152278 CTCAGCACTTGGAACATGCTGGG - Intronic
999828743 5:155299125-155299147 CCTGACACACAGAACTTGCTTGG + Intergenic
1003926302 6:10881114-10881136 GCAAGCACAAGGAAATTGCTGGG + Intronic
1004784811 6:18956228-18956250 CCTCACACATGGTACTTCCTAGG - Intergenic
1006688188 6:35855644-35855666 CCTAGCACTTGGAAATTCCAAGG - Intronic
1006834986 6:36992699-36992721 CCTGGCAGGTGGAACTTGCGTGG - Intergenic
1007956395 6:45921671-45921693 CCTTGGACCTGGAACATGCTAGG - Intronic
1008039045 6:46776573-46776595 CCTAGCACGTGGTAGCTGCTTGG - Intergenic
1011467233 6:87670732-87670754 CCTGGCACATGGCACATGCTTGG - Intergenic
1012382693 6:98639416-98639438 CTGATCACATGGAATTTGCTGGG + Intergenic
1015798447 6:137036264-137036286 CCAAGCCCATGGATCCTGCTTGG + Intronic
1016080231 6:139846570-139846592 TCTAGGACTTGTAACTTGCTGGG + Intergenic
1020854158 7:13395963-13395985 CATAGGACATGGAAATAGCTGGG + Intergenic
1023447955 7:40251541-40251563 CCTAGCATAGGGAATTGGCTGGG - Intronic
1023949779 7:44833883-44833905 CCTGGCACATGGTAAGTGCTTGG + Intronic
1025950545 7:66141949-66141971 TGTAGGACAGGGAACTTGCTTGG + Intronic
1026297396 7:69066290-69066312 CCTATCTCATTGAACTGGCTGGG + Intergenic
1028668731 7:93376309-93376331 CTTAGGACGTGGAACTTCCTGGG - Intergenic
1028674502 7:93443052-93443074 CATAGCACATGGCATTGGCTCGG - Intronic
1030183355 7:106733830-106733852 TCTAGCACCTGGCACTTGCTAGG + Intergenic
1033279937 7:139999019-139999041 GCTAGCACAGAGAACTTTCTGGG + Intronic
1036675087 8:10824994-10825016 TCTCTCACATGGAACTTTCTTGG - Intronic
1043730968 8:83681113-83681135 CCTAGCACATAGAAATTGTGTGG + Intergenic
1046972872 8:120242271-120242293 CCTGGCACATAGTAATTGCTAGG + Intronic
1047516640 8:125560654-125560676 CCCAACACCTGGCACTTGCTTGG + Intergenic
1053013055 9:34646346-34646368 CCTAGCACATGCTAGATGCTTGG + Intronic
1057388120 9:94622082-94622104 CCTAGGGCATGGAAGTTGCAGGG + Intronic
1057861341 9:98643228-98643250 CCTAGCAGAGGGAAATTGCCAGG + Intronic
1058041985 9:100312700-100312722 GGTAGCACATGTAACTTTCTTGG - Intronic
1059437777 9:114286951-114286973 CCTGGCACATGGAACACGCTAGG + Intronic
1060407487 9:123379994-123380016 CCTGGCACATGGCTCTTCCTGGG - Exonic
1062026607 9:134343556-134343578 CCTAGGACCTAGAAATTGCTCGG + Intronic
1203617517 Un_KI270749v1:81690-81712 CCTAGTAGCTGGAACCTGCTAGG + Intergenic
1187682233 X:21779004-21779026 CTTGGCAAATGGAACATGCTTGG + Intergenic
1188222922 X:27562227-27562249 TCTAGTACATTGCACTTGCTAGG + Intergenic
1189947445 X:46193721-46193743 CCTTGCACATAAAAGTTGCTCGG + Intergenic
1193568204 X:83106517-83106539 CCTAGCACATAGAACATGTATGG + Intergenic