ID: 1073488306

View in Genome Browser
Species Human (GRCh38)
Location 10:103835782-103835804
Sequence ACTCTATAGTTCATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073488301_1073488306 10 Left 1073488301 10:103835749-103835771 CCCTGAAGCAGGTCCTCACAGCA No data
Right 1073488306 10:103835782-103835804 ACTCTATAGTTCATGCAGCCAGG No data
1073488302_1073488306 9 Left 1073488302 10:103835750-103835772 CCTGAAGCAGGTCCTCACAGCAC No data
Right 1073488306 10:103835782-103835804 ACTCTATAGTTCATGCAGCCAGG No data
1073488303_1073488306 -3 Left 1073488303 10:103835762-103835784 CCTCACAGCACACCTGCACCACT No data
Right 1073488306 10:103835782-103835804 ACTCTATAGTTCATGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073488306 Original CRISPR ACTCTATAGTTCATGCAGCC AGG Intronic