ID: 1073491461

View in Genome Browser
Species Human (GRCh38)
Location 10:103855655-103855677
Sequence GGAGCCGCCGGCCCCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073491461_1073491472 8 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491472 10:103855686-103855708 GCTCTCCGGCTCGGGCTCCGGGG No data
1073491461_1073491466 -1 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491466 10:103855677-103855699 CCCTTCGCCGCTCTCCGGCTCGG No data
1073491461_1073491476 15 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491476 10:103855693-103855715 GGCTCGGGCTCCGGGGGGATCGG No data
1073491461_1073491471 7 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491471 10:103855685-103855707 CGCTCTCCGGCTCGGGCTCCGGG No data
1073491461_1073491480 27 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491480 10:103855705-103855727 GGGGGGATCGGCGCTGGCGGAGG No data
1073491461_1073491474 10 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491474 10:103855688-103855710 TCTCCGGCTCGGGCTCCGGGGGG No data
1073491461_1073491473 9 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491473 10:103855687-103855709 CTCTCCGGCTCGGGCTCCGGGGG No data
1073491461_1073491468 0 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491468 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
1073491461_1073491470 6 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491470 10:103855684-103855706 CCGCTCTCCGGCTCGGGCTCCGG No data
1073491461_1073491478 24 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491461_1073491477 21 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491477 10:103855699-103855721 GGCTCCGGGGGGATCGGCGCTGG No data
1073491461_1073491463 -6 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491463 10:103855672-103855694 GGCTCCCCTTCGCCGCTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073491461 Original CRISPR GGAGCCGCCGGCCCCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr