ID: 1073491462

View in Genome Browser
Species Human (GRCh38)
Location 10:103855667-103855689
Sequence GAGCGGCGAAGGGGAGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073491462_1073491476 3 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491476 10:103855693-103855715 GGCTCGGGCTCCGGGGGGATCGG No data
1073491462_1073491482 22 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491482 10:103855712-103855734 TCGGCGCTGGCGGAGGCTGTGGG No data
1073491462_1073491473 -3 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491473 10:103855687-103855709 CTCTCCGGCTCGGGCTCCGGGGG No data
1073491462_1073491480 15 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491480 10:103855705-103855727 GGGGGGATCGGCGCTGGCGGAGG No data
1073491462_1073491477 9 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491477 10:103855699-103855721 GGCTCCGGGGGGATCGGCGCTGG No data
1073491462_1073491483 28 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491483 10:103855718-103855740 CTGGCGGAGGCTGTGGGCGCAGG No data
1073491462_1073491472 -4 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491472 10:103855686-103855708 GCTCTCCGGCTCGGGCTCCGGGG No data
1073491462_1073491474 -2 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491474 10:103855688-103855710 TCTCCGGCTCGGGCTCCGGGGGG No data
1073491462_1073491478 12 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491462_1073491481 21 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491481 10:103855711-103855733 ATCGGCGCTGGCGGAGGCTGTGG No data
1073491462_1073491470 -6 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491470 10:103855684-103855706 CCGCTCTCCGGCTCGGGCTCCGG No data
1073491462_1073491471 -5 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491471 10:103855685-103855707 CGCTCTCCGGCTCGGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073491462 Original CRISPR GAGCGGCGAAGGGGAGCCGC CGG (reversed) Intergenic
No off target data available for this crispr