ID: 1073491467

View in Genome Browser
Species Human (GRCh38)
Location 10:103855678-103855700
Sequence CCCGAGCCGGAGAGCGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073491467_1073491485 23 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491485 10:103855724-103855746 GAGGCTGTGGGCGCAGGAGGCGG No data
1073491467_1073491483 17 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491483 10:103855718-103855740 CTGGCGGAGGCTGTGGGCGCAGG No data
1073491467_1073491481 10 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491481 10:103855711-103855733 ATCGGCGCTGGCGGAGGCTGTGG No data
1073491467_1073491476 -8 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491476 10:103855693-103855715 GGCTCGGGCTCCGGGGGGATCGG No data
1073491467_1073491482 11 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491482 10:103855712-103855734 TCGGCGCTGGCGGAGGCTGTGGG No data
1073491467_1073491478 1 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491467_1073491480 4 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491480 10:103855705-103855727 GGGGGGATCGGCGCTGGCGGAGG No data
1073491467_1073491484 20 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491484 10:103855721-103855743 GCGGAGGCTGTGGGCGCAGGAGG No data
1073491467_1073491487 30 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491487 10:103855731-103855753 TGGGCGCAGGAGGCGGAGGCAGG No data
1073491467_1073491486 26 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491486 10:103855727-103855749 GCTGTGGGCGCAGGAGGCGGAGG No data
1073491467_1073491477 -2 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491477 10:103855699-103855721 GGCTCCGGGGGGATCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073491467 Original CRISPR CCCGAGCCGGAGAGCGGCGA AGG (reversed) Intergenic
No off target data available for this crispr