ID: 1073491478

View in Genome Browser
Species Human (GRCh38)
Location 10:103855702-103855724
Sequence TCCGGGGGGATCGGCGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073491464_1073491478 3 Left 1073491464 10:103855676-103855698 CCCCTTCGCCGCTCTCCGGCTCG No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491469_1073491478 -5 Left 1073491469 10:103855684-103855706 CCGCTCTCCGGCTCGGGCTCCGG No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491465_1073491478 2 Left 1073491465 10:103855677-103855699 CCCTTCGCCGCTCTCCGGCTCGG No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491462_1073491478 12 Left 1073491462 10:103855667-103855689 CCGGCGGCTCCCCTTCGCCGCTC No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491467_1073491478 1 Left 1073491467 10:103855678-103855700 CCTTCGCCGCTCTCCGGCTCGGG No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data
1073491461_1073491478 24 Left 1073491461 10:103855655-103855677 CCTGGGGAGGGGCCGGCGGCTCC No data
Right 1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073491478 Original CRISPR TCCGGGGGGATCGGCGCTGG CGG Intergenic
No off target data available for this crispr