ID: 1073498029

View in Genome Browser
Species Human (GRCh38)
Location 10:103911853-103911875
Sequence CTGTTTCCCTTGTAGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073498015_1073498029 28 Left 1073498015 10:103911802-103911824 CCTGAATCCCGACGCCCCTTATA 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498017_1073498029 20 Left 1073498017 10:103911810-103911832 CCGACGCCCCTTATAACCCCCAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498024_1073498029 2 Left 1073498024 10:103911828-103911850 CCCAGACTGGCCTCTGCTGATGG 0: 1
1: 1
2: 1
3: 26
4: 234
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498023_1073498029 3 Left 1073498023 10:103911827-103911849 CCCCAGACTGGCCTCTGCTGATG 0: 1
1: 0
2: 1
3: 29
4: 303
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498027_1073498029 -8 Left 1073498027 10:103911838-103911860 CCTCTGCTGATGGCTCTGTTTCC 0: 1
1: 0
2: 4
3: 30
4: 322
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498019_1073498029 14 Left 1073498019 10:103911816-103911838 CCCCTTATAACCCCCAGACTGGC 0: 1
1: 0
2: 0
3: 6
4: 246
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498016_1073498029 21 Left 1073498016 10:103911809-103911831 CCCGACGCCCCTTATAACCCCCA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498022_1073498029 4 Left 1073498022 10:103911826-103911848 CCCCCAGACTGGCCTCTGCTGAT 0: 1
1: 0
2: 10
3: 26
4: 287
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498021_1073498029 12 Left 1073498021 10:103911818-103911840 CCTTATAACCCCCAGACTGGCCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498026_1073498029 1 Left 1073498026 10:103911829-103911851 CCAGACTGGCCTCTGCTGATGGC 0: 1
1: 0
2: 2
3: 27
4: 218
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data
1073498020_1073498029 13 Left 1073498020 10:103911817-103911839 CCCTTATAACCCCCAGACTGGCC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073498029 Original CRISPR CTGTTTCCCTTGTAGACAAA GGG Intronic
No off target data available for this crispr