ID: 1073499334

View in Genome Browser
Species Human (GRCh38)
Location 10:103921747-103921769
Sequence TTCTGTAGGGGGAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073499324_1073499334 -2 Left 1073499324 10:103921726-103921748 CCAGCCCTTATGGAGCTTCCATT 0: 1
1: 17
2: 136
3: 577
4: 1966
Right 1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG 0: 1
1: 1
2: 2
3: 25
4: 306
1073499326_1073499334 -7 Left 1073499326 10:103921731-103921753 CCTTATGGAGCTTCCATTCTGTA 0: 1
1: 0
2: 5
3: 45
4: 367
Right 1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG 0: 1
1: 1
2: 2
3: 25
4: 306
1073499325_1073499334 -6 Left 1073499325 10:103921730-103921752 CCCTTATGGAGCTTCCATTCTGT 0: 1
1: 2
2: 13
3: 137
4: 794
Right 1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG 0: 1
1: 1
2: 2
3: 25
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073499334 Original CRISPR TTCTGTAGGGGGAAAGTGGA GGG Intergenic
900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG + Intergenic
901809655 1:11760352-11760374 TTTGGGAGGTGGAAAGTGGACGG + Intergenic
902421405 1:16283378-16283400 TTCTGTGGGGAGAATGTGGTGGG + Intronic
903004424 1:20289373-20289395 TTCTGGAGGGGGAATTTGGGGGG - Intergenic
903010298 1:20325071-20325093 TTCTTTACCTGGAAAGTGGAGGG - Intronic
904950075 1:34230325-34230347 TTATGTAGGGGAAGAGTGGTAGG + Intergenic
905580438 1:39080161-39080183 TCATGTAGGGAGAAAGCGGATGG - Intergenic
905658396 1:39701252-39701274 TTCTGCTGGGAGAAAGTGCAAGG - Intronic
905899521 1:41572108-41572130 TGCTGTTGGTGGGAAGTGGAAGG + Intronic
907647601 1:56259788-56259810 TTTTGTAGTGGGGAAATGGAGGG - Intergenic
907868458 1:58421503-58421525 TTCTTTAGAGGAAAAGTGAAGGG + Intronic
910818791 1:91322732-91322754 TTCTGTTGAGGCAAGGTGGACGG - Intronic
911191921 1:94956917-94956939 TTCAGAAGAGGGAAAGTGGCCGG - Intergenic
911193068 1:94966920-94966942 TTCTGCAGGGGGAGAGGGGAAGG + Intergenic
911451404 1:98066501-98066523 TTGGGTAGGGGGATAGTGGAGGG + Intergenic
911487044 1:98515538-98515560 TTCTGCTGGGGGATAGAGGAGGG - Intergenic
911612310 1:99970279-99970301 GTCTGTAGGGGTGAAGGGGACGG + Intronic
912641791 1:111353357-111353379 TTCTGTAGTGGTAAAGCAGATGG - Intergenic
912718474 1:112000023-112000045 TTCTATAGTGGGAAAGGGGGTGG - Intergenic
914826190 1:151139424-151139446 TGCTGTACGGGGAAAGCTGACGG - Exonic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915311494 1:155007838-155007860 AGCTGTTGGGGGAAAGGGGAGGG + Intronic
916291063 1:163166685-163166707 TTCTGGAGGAAGAAAGGGGATGG + Intronic
917071043 1:171151121-171151143 TTCTGGAGGGAGAAAGGGGGAGG + Intronic
919479595 1:198071830-198071852 TTCTGTGGGGGCAAATTGGTAGG - Intergenic
920549582 1:206847152-206847174 TTCTGCTTGGGAAAAGTGGAGGG + Intergenic
921838213 1:219800033-219800055 ATATGTAGAGGGAAAGTGGAAGG - Intronic
922750536 1:228068127-228068149 TAGTGTAGGGGGATAGTGTAAGG + Intergenic
922750551 1:228068191-228068213 TAGTGTAGGGGGATAGTGTAAGG + Intergenic
922750605 1:228068427-228068449 TAGTGTAGGGGGACAGTGTAGGG + Intergenic
922750746 1:228069013-228069035 TTCTGTAGGGGGATAGTGGAGGG + Intergenic
922750983 1:228069970-228069992 TTTTGTAGGGGGATAGTTTAGGG + Intergenic
922751090 1:228070339-228070361 TAGTGTAGGGGGATAGTGTAGGG + Intergenic
922751181 1:228070709-228070731 TTGAGTAGGGGGAGAGTGTAGGG + Intergenic
922751401 1:228071737-228071759 TAGTGTAGGGGGATAGTGTAGGG + Intergenic
922751424 1:228071829-228071851 TAGTGTAGGGGGATAGTGCAGGG + Intergenic
922751473 1:228072067-228072089 TGCTGTAGAGGGATAGTGTAGGG + Intergenic
1064242971 10:13647255-13647277 TTGTGAAGGAGGAAAATGGAAGG + Intronic
1065374904 10:25029058-25029080 TCCAGTAGTGGGTAAGTGGATGG - Intronic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065546130 10:26822730-26822752 TTTGGCAGGGGGAAAGGGGATGG + Intronic
1066451165 10:35531710-35531732 TGCTGTAGATGGAAAGTGGCGGG + Intronic
1066710179 10:38224635-38224657 TGCTGCACGCGGAAAGTGGAAGG + Intergenic
1067195448 10:44114058-44114080 TCCTTATGGGGGAAAGTGGAGGG - Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1067910593 10:50342945-50342967 TTGGGTAGGTGGGAAGTGGATGG - Intronic
1067911129 10:50348019-50348041 TAGGGTAGGGGGAAAGGGGAGGG - Intronic
1070923247 10:80202190-80202212 TTCTGTGGGGGGGAAGCGGGGGG + Intronic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1072417680 10:95262694-95262716 CTCTGTAGGTGTAAAGTGGGTGG - Intronic
1073195439 10:101687182-101687204 TTTTGTAGGGGGGATGAGGATGG - Intronic
1073213978 10:101826554-101826576 TTGTGGTGGGGGAATGTGGATGG - Intronic
1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG + Intergenic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074334190 10:112552264-112552286 TTCTGGATGGTGAAAGTAGATGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1074807758 10:117070828-117070850 TTTAGTAGGGATAAAGTGGAGGG + Intronic
1075995950 10:126876481-126876503 TGCTTTGGGGGGTAAGTGGAAGG - Intergenic
1077790181 11:5430889-5430911 TTCTGGAGAGGGACGGTGGAAGG - Intronic
1077865163 11:6216188-6216210 TTCTGTAGGAGGCAAGAAGAGGG + Intronic
1078137084 11:8660424-8660446 TTCTGTCTGGGGAAATTGGGTGG - Intronic
1078613367 11:12841551-12841573 GCCTGGAGGGGGAATGTGGAGGG - Intronic
1079014562 11:16857525-16857547 TTCTGTCTGGAGAAAGGGGATGG - Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1080785311 11:35470022-35470044 TTTTATAGGTGGCAAGTGGAGGG + Intronic
1082716681 11:56622581-56622603 TTCTGTGTGGGGAAAGTGCGAGG - Intergenic
1084368030 11:68716439-68716461 TTCTGTGAGGGGGAAGTGAATGG + Intronic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1088159802 11:106855262-106855284 ATCTGTGGTGGGAAAGTGGATGG + Intronic
1091943029 12:4507917-4507939 CTCTGAAGAGGGAAACTGGATGG + Intronic
1092125645 12:6073383-6073405 TTGTGTTGAGGGAAATTGGAGGG - Intronic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1093440466 12:19189512-19189534 TTCTTTTGGGGGAAAGGGCAGGG + Intronic
1093689040 12:22088852-22088874 ATCAGTAGGGGAATAGTGGAAGG + Intronic
1093825326 12:23678550-23678572 TTTGGTAGAGGGCAAGTGGATGG - Intronic
1093868242 12:24254910-24254932 TTCTTTAGGAGTAAAGTGGGTGG - Intergenic
1094323676 12:29213095-29213117 TTCTGTAGGGATAAATTTGATGG - Intronic
1095860126 12:46907741-46907763 TGCTGCAGGGGGAGAGGGGAGGG - Intergenic
1097147002 12:56948662-56948684 TTCTGTTTGAGAAAAGTGGAAGG - Intergenic
1098938408 12:76506743-76506765 TCCTGGAAGGGGAAAGTGGCTGG + Intronic
1099826116 12:87779810-87779832 TTCTGTTGGAGAAAAGTGGAAGG - Intergenic
1102983679 12:117262263-117262285 GTCTCTGGGGGGAAAGGGGAGGG - Intronic
1104963361 12:132498471-132498493 GTCTGTAGGATGAGAGTGGAGGG - Intronic
1107285633 13:38787563-38787585 TTTTGATTGGGGAAAGTGGAAGG - Intronic
1108682863 13:52794300-52794322 TTCTGAAACTGGAAAGTGGAGGG - Intergenic
1111782132 13:92741727-92741749 TGGTGTAGGGGGAGAGGGGAGGG - Intronic
1112149029 13:96736063-96736085 ATCAGAAGGTGGAAAGTGGAAGG + Intronic
1112416197 13:99205362-99205384 TGCTGTAGGAGGGAAGAGGAGGG + Intronic
1112508643 13:99990245-99990267 GTCGGGAGGGGGGAAGTGGAGGG - Intergenic
1113513611 13:110874340-110874362 GAATGTAGGGGGAATGTGGAGGG - Intergenic
1114447289 14:22798740-22798762 TTTTGCAGGGTGAAAGAGGAAGG - Intronic
1115166701 14:30456297-30456319 TTCTGTAGGGGCAAAGGTTAAGG + Intergenic
1115754873 14:36520272-36520294 TCCGGTAGGGGGAAAGGGGGCGG - Intronic
1117394985 14:55299940-55299962 TTCAGGAGGGGGAAGTTGGAGGG - Intronic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1119797518 14:77412473-77412495 TTCTACTGTGGGAAAGTGGAGGG + Intronic
1120173590 14:81270903-81270925 TTATTTGGGGAGAAAGTGGAAGG + Intronic
1120224844 14:81779049-81779071 TTCTGAAGGAGGAATGTGGAGGG - Intergenic
1120673052 14:87386599-87386621 TTATCTAGGAGGAAAGAGGAAGG + Intergenic
1120868608 14:89317543-89317565 TTCAGCAGGGGTAAAGTGTAGGG + Intronic
1122469406 14:101956060-101956082 TTCGGCACGGGGAAAATGGAAGG + Intergenic
1124724812 15:32147242-32147264 TACTGTAGGGGGAAAGGAGAAGG + Intronic
1124856937 15:33398398-33398420 TTCTGAGTGGGGAAAGTGAATGG + Intronic
1124862039 15:33451226-33451248 ATCTACTGGGGGAAAGTGGAAGG - Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126653258 15:50948488-50948510 TGCTTTTTGGGGAAAGTGGAGGG + Intronic
1127311926 15:57760075-57760097 TTCTGGAGGCTGAAAGTTGAAGG + Intronic
1128293217 15:66495542-66495564 TGCTCTAGAGGGAAAGTTGAGGG + Intronic
1128674392 15:69597953-69597975 GTCTGAAGGTGTAAAGTGGAGGG + Intergenic
1129330439 15:74824330-74824352 TTCTGAAAGGGGAAAGTCTAAGG - Exonic
1130559083 15:84944735-84944757 CCCTGTAGAGGGAAAGTGGTGGG - Exonic
1132177414 15:99726494-99726516 TGCAGTAGGGGGAGTGTGGAGGG - Intronic
1133702253 16:8319714-8319736 TTCAGCAGAGGGAATGTGGAGGG - Intergenic
1134095363 16:11415171-11415193 TTCTGTAGGGGGTGATGGGAAGG - Intronic
1136284407 16:29232749-29232771 TTCTGTACGTGGAAAATGCAAGG - Intergenic
1138231205 16:55337768-55337790 CACTGAAGGGGGAAAGTGGATGG - Intergenic
1138553503 16:57759523-57759545 TTCTGCAGGTGGGAAATGGAAGG - Intronic
1138933755 16:61694263-61694285 TTTTCTAGAAGGAAAGTGGAAGG + Intronic
1139012157 16:62646882-62646904 TCCTCTAGGAGGAAAGTGGCTGG - Intergenic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1139521297 16:67484016-67484038 TTCTTTGGAGGGAAAGGGGAAGG + Intergenic
1140239690 16:73189786-73189808 GTCTGTATGGTGAAAGTGTAAGG + Intergenic
1140570800 16:76104147-76104169 TTCTGTCGGGGGATTGTGGGCGG + Intergenic
1140663262 16:77207858-77207880 TTCTGTGGGGGTAAAGAGTATGG - Intronic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141369004 16:83470163-83470185 TTCTGGAGGTGGGAAGTAGAGGG - Intronic
1141485141 16:84333928-84333950 TTCTGTTTGAGAAAAGTGGAAGG + Intergenic
1142089441 16:88202261-88202283 TTCTGTATGTGGAAAATGCACGG - Intergenic
1143994645 17:10996216-10996238 TCCAGTAAGGGAAAAGTGGAGGG - Intergenic
1144942999 17:18954255-18954277 ATCTGAAGAGGGAAAGAGGAGGG + Intronic
1146013392 17:29213508-29213530 TTCTGTGGGGCCAAGGTGGAAGG + Intergenic
1146497697 17:33337654-33337676 TTCTGGAGGGGCAAGGAGGATGG + Intronic
1146497750 17:33338030-33338052 TTCTGGAAGGGCAAAGAGGATGG + Intronic
1150347039 17:64412194-64412216 TTCTGCAGCAGGAAAGAGGAAGG + Intronic
1150919405 17:69467437-69467459 ATCAGGAGGGGGAAAGTGGGAGG + Intronic
1152534116 17:80940708-80940730 GTCTGTCGTGGGACAGTGGATGG - Intronic
1155848693 18:30743277-30743299 TTCTCATGGAGGAAAGTGGAAGG + Intergenic
1156553582 18:38043343-38043365 TTCTGTAGGGGGTCACTGTAAGG + Intergenic
1158559993 18:58505567-58505589 TTCTGTAGAGGGAATATTGATGG - Intronic
1159409698 18:68055226-68055248 TGCTGGAGGGGGAAGGAGGAAGG - Intergenic
1159624017 18:70670494-70670516 TTCTGTAGGGGGATGATGGCTGG + Intergenic
1159684728 18:71404097-71404119 ATATATAGGTGGAAAGTGGATGG + Intergenic
1160523086 18:79520125-79520147 GTCTGCAGGGGGAAACTTGACGG + Intronic
1161648539 19:5469663-5469685 CTGTGTAGGGGGAAAGTTGTCGG + Intergenic
1162910386 19:13844709-13844731 TTCTGGAGGGGCAATATGGATGG - Intergenic
1164143105 19:22492152-22492174 AGCTGTAGTGGGAAGGTGGAGGG - Intronic
1165325853 19:35114442-35114464 TTCTGGAGAGGGAAACTGGGAGG - Intergenic
1166133838 19:40763410-40763432 GTCTGTAGGGGCAAAGAGGTGGG + Intronic
1166975817 19:46604443-46604465 TTAGGGAGGGGGAAAGAGGAAGG - Intronic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
1167469033 19:49665251-49665273 TTCTGTAGGGGGACTGTGGAAGG - Exonic
1167598155 19:50438080-50438102 ATCAGTGGGTGGAAAGTGGAGGG - Intronic
1167811957 19:51841140-51841162 TTCTGCTGGGAGAAAGTGCAAGG + Intergenic
925034213 2:673652-673674 TCCTGAAGGGAGGAAGTGGAGGG - Intronic
925363718 2:3296683-3296705 TTCTGTAGGCAGAGAGAGGACGG - Intronic
925495745 2:4447283-4447305 TTCTGCAGGGGGAAAAAAGAAGG - Intergenic
926354941 2:12033217-12033239 TTTTTTAGGGGGAAAGGGAATGG + Intergenic
926354954 2:12033301-12033323 TTTTTTAGGGGGAAAGGGAATGG + Intergenic
926473674 2:13294052-13294074 TTCTGTTGGGGGTGAGTGGTGGG + Intergenic
926893069 2:17655011-17655033 TTCTGTTGGGGGAAATGGTATGG + Intronic
927228707 2:20798093-20798115 TTCTTTAGGAGGAAAATGGAGGG - Intronic
928239088 2:29571072-29571094 TCCTGGAGGGAGATAGTGGAGGG + Intronic
929726736 2:44437407-44437429 TTCTGTTGGGGAATAGGGGATGG + Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929756214 2:44767884-44767906 TGTTCTAGGGGGAAAGTGAATGG - Intronic
930471305 2:51817910-51817932 TTAGTTAGGGGGAAAGTAGAAGG + Intergenic
931525899 2:63152603-63152625 TTCAGTAGGGAGAAAGTAGAAGG - Intronic
932225125 2:70033637-70033659 TTCTGTAGTGGTAAAGGGAATGG + Intergenic
932699250 2:73982198-73982220 TTCTGTGGAGGGAGAGTGGGTGG + Intergenic
933439014 2:82286071-82286093 TTTTGTAGGGGTGATGTGGAGGG - Intergenic
933575215 2:84059438-84059460 TTCTGAAGGGGAAAAGTTTAAGG - Intergenic
935016815 2:99190747-99190769 GCCTGTAGGGGGCGAGTGGAGGG + Intronic
935233314 2:101117917-101117939 TTCTGTATGGAGAAATTAGAAGG - Intronic
935384288 2:102484942-102484964 TTCTCTAGGAGGATAGTGGGAGG + Intronic
935592984 2:104857555-104857577 TTTTGGAGGGAGAAAGTGAAAGG - Exonic
936039403 2:109138350-109138372 ATCTGTAGGGAGAAAGTAGTGGG + Intronic
936502217 2:113075131-113075153 TCCTGTGGGGGCAAGGTGGATGG - Exonic
937103343 2:119288621-119288643 TTTTGAAGGCGGGAAGTGGATGG + Intergenic
937138962 2:119581624-119581646 TTCTGTCAGGAGAGAGTGGAGGG + Intronic
937989026 2:127652073-127652095 TTCTGTAGCGGGAAGGAGGCTGG - Exonic
939617405 2:144376843-144376865 TTTTGTAGGGGGAAGGGAGAAGG + Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
941110798 2:161417233-161417255 TTGGAAAGGGGGAAAGTGGAAGG + Intronic
941260456 2:163290929-163290951 TGATGTAGGAGGAAAGTGAAAGG + Intergenic
941449554 2:165643459-165643481 TTCTACAGGGGCAATGTGGAGGG - Intronic
942379091 2:175369046-175369068 TTTTATAGGTGGAGAGTGGAGGG + Intergenic
942606395 2:177696070-177696092 TCATGTAGGGGAGAAGTGGAAGG + Intronic
945480975 2:210345428-210345450 TGGTGTAGGGGGCAAGGGGAGGG - Intergenic
945645490 2:212486675-212486697 TTCTGGATGGAGAAAGTGGTGGG + Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
1171221392 20:23401107-23401129 TTCTGTTTGGGGAAAGAGTAGGG + Intronic
1171431334 20:25084763-25084785 TCCGGTAGGGGGAAGCTGGAAGG - Intergenic
1174341573 20:49900344-49900366 TTCAGGAGTAGGAAAGTGGATGG + Intergenic
1177905215 21:26965979-26966001 TTCTATCGGGGCACAGTGGACGG - Exonic
1178967020 21:37130310-37130332 TTCTTTAGGGGTACAGGGGAGGG - Intronic
1179573736 21:42294143-42294165 TTCGGTCGGGGCACAGTGGAAGG - Intronic
1179954476 21:44730654-44730676 TTCCGAAGGGGGAAATGGGAAGG + Intergenic
1180982033 22:19883098-19883120 TTCTGTGGTGGGAGTGTGGATGG - Intronic
1181762073 22:25065542-25065564 TTTTTTGGGGGGAAAGAGGAAGG - Intronic
1183069778 22:35387896-35387918 TTCTGAAGGGGGAGGGTGGAAGG - Intronic
1183546633 22:38457668-38457690 TTCTGTGGATGGAAAGTGGGAGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949807457 3:7971317-7971339 TTCTTCAAGGGGAAAGTAGAGGG + Intergenic
951177848 3:19622844-19622866 TTCTGTTTGAGGAGAGTGGAAGG - Intergenic
951218939 3:20049385-20049407 TTCTACCCGGGGAAAGTGGAAGG + Intronic
951616386 3:24550554-24550576 TTCTGGAGAGGGCAAATGGAAGG - Intergenic
952640410 3:35587591-35587613 TTGAGTGGGGGGAAAGGGGAGGG - Intergenic
953158644 3:40397957-40397979 TTCTTTTGGGGGAGAGGGGATGG - Intronic
953837379 3:46358530-46358552 TTCTACAGGGAGACAGTGGATGG + Intronic
954084926 3:48236732-48236754 TTCAGTAGGGGAAGAGGGGAAGG + Intergenic
955607363 3:60720173-60720195 TTCTGTATCGGGAAGGAGGATGG - Intronic
955657261 3:61258045-61258067 TTTTGTTGGGGGAGAGTGGTAGG - Intergenic
956411608 3:68985462-68985484 TTCAGTAAGAGGAAAGTTGAGGG - Intronic
956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
958095275 3:88936120-88936142 ATCCGTTGGGGGAAATTGGATGG + Intergenic
958665972 3:97138687-97138709 TTCTGTATTTGGACAGTGGAGGG - Intronic
959705849 3:109338098-109338120 TTTTGTAGAGGGCAAGTGGGGGG + Intergenic
960793814 3:121462566-121462588 TTGTGCAGGGGGAAAGTGCAGGG + Intronic
961583121 3:127899535-127899557 TGCTGAAGGGGGAATGTGGGTGG + Intergenic
962148284 3:132864929-132864951 TTTTGTCGAGGGAAAGTTGAAGG - Intergenic
962371789 3:134826797-134826819 TTTTGTAGGGGGAAAGGCCAGGG + Intronic
965239933 3:166182761-166182783 TCCTGTAGGGGAAGAGTGGAAGG - Intergenic
965309537 3:167112302-167112324 TTCTGAAGTGGGAAAGAGGATGG + Intergenic
966159773 3:176955548-176955570 TGCTGTAGGGGAAAACAGGAAGG + Intergenic
966409218 3:179631446-179631468 TGCAGTAAGGGGAAACTGGAAGG - Intergenic
966690340 3:182734906-182734928 TTTTGGAGGGGGACAGGGGATGG + Intergenic
967096085 3:186178467-186178489 TTCTGTATGTGAAAAGTGAAAGG + Intronic
967636028 3:191804325-191804347 CTCTGTATGGGGAAAGAAGAGGG + Intergenic
967706528 3:192657480-192657502 TAGTGTAGGGGGAGAGGGGAGGG + Intronic
967858624 3:194135600-194135622 TTCAGGAGGGTGAAAGTAGATGG - Intergenic
970349480 4:15187152-15187174 TTCTGTAGAGGGAAAGAGAAAGG + Intergenic
972093929 4:35324826-35324848 TGGGGTAGGGGGAAAGGGGAGGG - Intergenic
972512489 4:39782573-39782595 TCCTGTAAGGGGAAAATGGGTGG + Exonic
972818432 4:42670955-42670977 TTCTGGAGTGGGAAAGGGGTTGG + Intergenic
973233649 4:47871681-47871703 TTTTGTAGGGGGAATTTAGAGGG - Intronic
975761315 4:77623277-77623299 TTATGGAGGGGGAAAGTTCACGG + Intergenic
975894999 4:79078521-79078543 TTCTGCTGGGAGAAAGTGCAAGG - Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981047622 4:140279967-140279989 TTGTGAAGGGAGAAAATGGAAGG + Intronic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
981661365 4:147170723-147170745 TTGCGTGGGGGGAAAGGGGAGGG + Intergenic
982330559 4:154177630-154177652 TTCTCAAGGGGAGAAGTGGATGG - Intergenic
983118009 4:163843689-163843711 TCCTGTCGGGGGCAAGTGGCAGG - Intronic
987038566 5:14040887-14040909 ATCTGTAGGAGCAGAGTGGAGGG + Intergenic
987500702 5:18705958-18705980 TTATGTAGGGGGAAAAATGAAGG - Intergenic
989351074 5:40487362-40487384 TGATGTAGAGGGAAATTGGAAGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990649788 5:57885354-57885376 TTGAATATGGGGAAAGTGGAAGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991270261 5:64770624-64770646 TTCTATAGGGGGAAGGTAGGAGG - Intronic
992387493 5:76299555-76299577 TTTGGGAGTGGGAAAGTGGAAGG - Intronic
992761024 5:79950959-79950981 GTCTGTTGGGGGACAGTGGTGGG - Intergenic
996225146 5:120983752-120983774 GGCAGTAGGGGGAAAGGGGAGGG + Intergenic
1000110044 5:158099521-158099543 TGCTGTCTGTGGAAAGTGGAGGG - Intergenic
1000162534 5:158613630-158613652 CTCTTTGGGGGGAAAGTGTAGGG + Intergenic
1000198846 5:158987873-158987895 TTCTGAAGGAGGAAAGTCAAAGG + Intronic
1001063521 5:168515747-168515769 TTCTGCAGCGGCAAAATGGAAGG - Intronic
1001539560 5:172527841-172527863 TTCTGAAGAGGGGAAGTGGTTGG + Intergenic
1002818317 6:698758-698780 TTCAGTTGGGGGAATCTGGATGG - Intergenic
1003215904 6:4111542-4111564 ATGAGTAGGGTGAAAGTGGAAGG - Intronic
1003511175 6:6781915-6781937 TTCTGCAGGAGGGAATTGGAAGG - Intergenic
1003516391 6:6822337-6822359 GTCTTTTGGGGGAAAGGGGATGG - Intergenic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1003785007 6:9475716-9475738 TTATGCAGAGTGAAAGTGGAGGG - Intergenic
1004498383 6:16186244-16186266 TTCTGTGGTGGGAAGGTGAAAGG - Intergenic
1004750253 6:18555102-18555124 TTTAGGATGGGGAAAGTGGAAGG + Intergenic
1006307885 6:33235587-33235609 TTAGGGAGGGGGAAAGTGGAGGG + Intergenic
1006456560 6:34135195-34135217 TTCTGTAGGGGGAATGACGGGGG - Intronic
1006829803 6:36961878-36961900 TCCTGTAGGGGGAACGTGAAGGG + Exonic
1008042545 6:46817058-46817080 TTTTCTAGGGGAAAAATGGAAGG + Intronic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1016935300 6:149445379-149445401 TCCTGTGGGAGGAAGGTGGAAGG - Intergenic
1018447375 6:163870051-163870073 TTCTGTAGTGGATAAGAGGATGG - Intergenic
1019212677 6:170419071-170419093 TTCTGAAGGAGGAAATTGAAGGG + Intergenic
1019982649 7:4632786-4632808 TTTTGTGGGGGGAAGGTGGCAGG + Intergenic
1020452976 7:8340884-8340906 TTTTGTAGGGAGAATGAGGATGG + Intergenic
1020785831 7:12571129-12571151 TTCGGTAGGGAGAAAGTGGCCGG - Intronic
1025935187 7:66030129-66030151 TTCTTTTGGGGGGATGTGGAAGG + Intergenic
1026120432 7:67532126-67532148 TTCCAAAGGGAGAAAGTGGAAGG + Intergenic
1026461016 7:70615175-70615197 TTCTGTAGTTGGAAAGGAGATGG + Intronic
1027839070 7:83284193-83284215 TTCTGCTGGGGGAAAGTGCAAGG + Intergenic
1028078044 7:86538951-86538973 GTCTTTAGGGGGAACATGGATGG + Intergenic
1028513928 7:91655870-91655892 TTCTGTGGAGGGAGAGAGGATGG + Intergenic
1028778952 7:94714006-94714028 GTCGGTGGGGGGAAAGAGGACGG - Intergenic
1029116803 7:98241800-98241822 TGCTGTAGGGGGATGGTGGCAGG - Intronic
1029363603 7:100103520-100103542 GTCAGTAGAGGGAAAGAGGAGGG + Intronic
1030668577 7:112309077-112309099 TACTTTAGGGGGAAAGGGGAAGG + Intronic
1031097434 7:117437232-117437254 TTTCGTTGGGGGAAAGTGGGTGG + Intergenic
1034945652 7:155260206-155260228 GGCTGGAGGGGGAGAGTGGAAGG - Intergenic
1035233679 7:157483283-157483305 TTCTGTGGGGGGAGCGGGGAGGG - Intergenic
1036436991 8:8743663-8743685 TTCTGTAGGGGAGAGGAGGAAGG - Intergenic
1039972750 8:42334301-42334323 TTCTGAAAGGGAAAATTGGAAGG + Intergenic
1042572813 8:70185055-70185077 GTCTGTAGAGAGAAACTGGAAGG - Intronic
1042711470 8:71722204-71722226 TTATGTTGGAGGAAAGTGAAAGG + Intergenic
1042980158 8:74518120-74518142 TTCTGTATGAGGAAAGGAGAGGG - Intergenic
1044627899 8:94252209-94252231 TTCATTAGGGGGAAAATGAATGG - Exonic
1044784389 8:95779159-95779181 ACCAGTAGGGGGATAGTGGAAGG + Intergenic
1046054831 8:109067052-109067074 TGGGGTAGGGGGAAAGGGGAGGG - Intergenic
1051646965 9:19278859-19278881 TTCTGGGGGGGCAGAGTGGAGGG - Intronic
1052102279 9:24463222-24463244 ATCTGTGGGGGGAAAGGGGAAGG - Intergenic
1055339843 9:75269531-75269553 ATCTGAAGGGGGAAAGTGCTGGG + Intergenic
1059208966 9:112493430-112493452 TTCTGGACTGGGAAAATGGATGG - Intronic
1059692990 9:116703759-116703781 CTCTGTAGGAGGGAAGTGGAAGG + Intronic
1059876528 9:118641435-118641457 TTCTGCTGGGAGAAAGTGCAAGG + Intergenic
1060370693 9:123067877-123067899 TTCTATAGGTAGAAAATGGAGGG - Intronic
1062030077 9:134358287-134358309 TGCTGCCGGAGGAAAGTGGATGG - Intronic
1062407241 9:136402945-136402967 TTCTGGGGGGAGAAAGGGGAGGG + Intronic
1185615737 X:1420656-1420678 TTCTGGGCGGGGAAAGGGGAAGG + Intronic
1190131329 X:47751485-47751507 TTATGTTGGGGGAAAATTGAAGG - Intergenic
1191704377 X:64079001-64079023 TGCCGTAGGGGGAGGGTGGAGGG - Intergenic
1191901403 X:66044231-66044253 TTCTGTAGCAGGGAAGAGGAAGG + Intergenic
1193221757 X:78934951-78934973 AGCTGGAGGGGGACAGTGGATGG + Intergenic
1193560425 X:83010913-83010935 TTCTTGAGGAGGAAAGTGGCTGG + Intergenic
1193711148 X:84881849-84881871 TCCTGTAAGGGGAAAATGGGTGG - Intergenic
1194586159 X:95736613-95736635 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1195315487 X:103673431-103673453 TTCTGTAGTGGGAGAGTGGCAGG - Intergenic
1195338694 X:103882865-103882887 TTCTATTATGGGAAAGTGGATGG - Intergenic
1195447951 X:104975359-104975381 TGCTGTAGGAAAAAAGTGGAAGG - Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1196552568 X:117046078-117046100 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1197587924 X:128372625-128372647 ATCCCTAGGGGGAAAATGGAGGG - Intergenic
1198433074 X:136587457-136587479 TGCTGTAGGGGCACAGAGGAGGG + Intergenic
1198664124 X:139002980-139003002 TTCTGTTTGGGAAAAGTGGAGGG + Intronic
1199029574 X:142980982-142981004 ATCTTTAAAGGGAAAGTGGATGG - Intergenic
1199449166 X:147960009-147960031 TTATGTGGGGAGAAAGGGGAAGG + Intergenic
1199666161 X:150098174-150098196 TCCTCTAGGTGGAAAGTGGGTGG + Intergenic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic
1200389378 X:155928572-155928594 CTCTATAGGAGGAAAGTAGATGG - Intronic
1201648705 Y:16262932-16262954 TTCTCTGGGGGAAAAGTGGCAGG + Intergenic
1201654104 Y:16322368-16322390 TTCTCTGGGGGAAAAGTGGCAGG - Intergenic
1201690482 Y:16759320-16759342 TTCTGTAGGTGGAGAGGAGAAGG - Intergenic