ID: 1073504262

View in Genome Browser
Species Human (GRCh38)
Location 10:103969911-103969933
Sequence TCTTGTAGTTAGAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073504257_1073504262 15 Left 1073504257 10:103969873-103969895 CCTGGAAAGGCAAAAATAAATGC 0: 1
1: 0
2: 1
3: 38
4: 453
Right 1073504262 10:103969911-103969933 TCTTGTAGTTAGAAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073504262 Original CRISPR TCTTGTAGTTAGAAGGTGGT AGG Intronic
No off target data available for this crispr