ID: 1073510065

View in Genome Browser
Species Human (GRCh38)
Location 10:104037350-104037372
Sequence GCATGAAGGTTGGCAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073510065_1073510074 28 Left 1073510065 10:104037350-104037372 CCAGATGCTGCCAACCTTCATGC 0: 1
1: 0
2: 2
3: 29
4: 145
Right 1073510074 10:104037401-104037423 CACATTAGTCAATTGCCGGAAGG No data
1073510065_1073510073 24 Left 1073510065 10:104037350-104037372 CCAGATGCTGCCAACCTTCATGC 0: 1
1: 0
2: 2
3: 29
4: 145
Right 1073510073 10:104037397-104037419 GGAACACATTAGTCAATTGCCGG No data
1073510065_1073510071 3 Left 1073510065 10:104037350-104037372 CCAGATGCTGCCAACCTTCATGC 0: 1
1: 0
2: 2
3: 29
4: 145
Right 1073510071 10:104037376-104037398 GGTGGGAAGAACCTATAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073510065 Original CRISPR GCATGAAGGTTGGCAGCATC TGG (reversed) Intronic
900890160 1:5443840-5443862 GCATGAAGGTGTGCAGAGTCAGG + Intergenic
901076041 1:6555274-6555296 GCCTGAAGTTAGGAAGCATCCGG + Exonic
903086859 1:20868910-20868932 ATATGAATGTTGTCAGCATCAGG + Intronic
903445930 1:23423153-23423175 GCATGGAGGTTGGGAGTGTCAGG + Intronic
904039909 1:27577694-27577716 CCAGGAAGGCTGGCAGCAGCTGG + Intronic
908663632 1:66465180-66465202 GCATGAAGGATGCCAGCCTGAGG + Intergenic
917660232 1:177170871-177170893 GCATGTAGGTTGGCAGCCAATGG - Intergenic
921395673 1:214666685-214666707 GCAGGTAGGATGGCAGCTTCAGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1064154267 10:12890584-12890606 ACATGATGGTTGGCAGGATTTGG - Intergenic
1064333780 10:14419103-14419125 GTATGAGGGTTGGAAGAATCTGG + Intronic
1072514952 10:96171390-96171412 GGATGAATGTTGGAAGCATTAGG + Intronic
1072747904 10:97954518-97954540 GCATGTAGGTAAGCAGGATCTGG - Intronic
1073510065 10:104037350-104037372 GCATGAAGGTTGGCAGCATCTGG - Intronic
1074361104 10:112824668-112824690 GCATGAAAGGTGCCAGCCTCTGG - Intergenic
1074820585 10:117175356-117175378 GCAAGCAGATTGGCAGCTTCCGG + Intergenic
1075442937 10:122493969-122493991 ACAGGAAGGTTGGCTGCATGAGG - Intronic
1076167582 10:128294739-128294761 GCCTTTTGGTTGGCAGCATCTGG + Intergenic
1076591820 10:131588752-131588774 GCAGGAGGGTTGGCTGCAGCAGG - Intergenic
1081496911 11:43621057-43621079 GGATGAAGGTTGGCTGCATCAGG + Intronic
1081655991 11:44857875-44857897 ACATGACTGTTGGCAGCATGTGG - Intronic
1084214878 11:67641785-67641807 CCCTGAAGGGTGCCAGCATCAGG + Intergenic
1086596918 11:88583586-88583608 ATTGGAAGGTTGGCAGCATCTGG + Intronic
1087882955 11:103440473-103440495 GAATGAAGGGTGGCAGGATTTGG - Intronic
1088417123 11:109601475-109601497 GCATGAAGGTGGGCAGTCTAGGG + Intergenic
1088739154 11:112752626-112752648 GGATGAAGGTTTGCATCTTCAGG + Intergenic
1090266920 11:125359137-125359159 GCAGGAAGGTGGACACCATCAGG + Intronic
1091083380 11:132694606-132694628 GCATGAAGATAGGAAGCAACTGG - Intronic
1094077692 12:26496313-26496335 GCATGAAGGTTGGGTGCAGCGGG - Intronic
1095271770 12:40226872-40226894 GAATGAAGGTGGCCAGAATCAGG - Intronic
1096573900 12:52540765-52540787 ACATGGAGGTTGGCACCCTCAGG - Intergenic
1098401119 12:70077205-70077227 TCCTGAAGTTTGGCATCATCTGG - Intergenic
1103182170 12:118922760-118922782 CCATGCTGGTTGGCAGCCTCTGG - Intergenic
1103321313 12:120094122-120094144 GCAGGCAGGCAGGCAGCATCTGG - Exonic
1106334002 13:28766128-28766150 GCCTGAAGGTTGGAATCAACTGG + Intergenic
1107174682 13:37386433-37386455 GCTGGAAGGATGTCAGCATCAGG - Intergenic
1115033695 14:28830849-28830871 GCTTGAAGTTTGGAAGCCTCAGG + Intergenic
1115103875 14:29736727-29736749 GCATAAAGGTTTCCAGCATAGGG - Intronic
1119382632 14:74239061-74239083 CTATGCAGGTTGGCAGCATCAGG - Intergenic
1119568710 14:75650968-75650990 GCATGAGGGTTGGAAGAGTCTGG - Exonic
1121264212 14:92588699-92588721 GCATGAAAGGAGGCAACATCTGG + Intronic
1121484915 14:94307036-94307058 GCAGGATGGTTGCCAGCCTCCGG - Intronic
1129336686 15:74856202-74856224 GCCTGAAGTTTGGGAGCATCTGG - Intronic
1129867074 15:78917178-78917200 GGATGAACGTTGGAAACATCAGG - Intergenic
1131183314 15:90255236-90255258 GCTGGATGGGTGGCAGCATCCGG - Intronic
1131541982 15:93282088-93282110 GCATGAAGGTTGCCAGGAGGAGG + Intergenic
1133510109 16:6449913-6449935 GCATGAAGTTTTACAGCATCTGG - Intronic
1133695554 16:8259279-8259301 GAATGAAGGTTGCCAGGAGCTGG - Intergenic
1138251566 16:55505739-55505761 GCCTGAAGTGTGGCAGCACCAGG - Exonic
1138919139 16:61505323-61505345 GCATGAAGGTAGGCAGGGTTGGG - Intergenic
1141450977 16:84101763-84101785 CCATGAAGCTTGTCAACATCTGG - Exonic
1144373865 17:14619649-14619671 ACATGAAGATTTGCAGCATTTGG - Intergenic
1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG + Intronic
1145312314 17:21707455-21707477 GCCAGCAGGGTGGCAGCATCTGG - Intergenic
1145409278 17:22642726-22642748 GCTTGAAAATTGGTAGCATCTGG - Intergenic
1147518886 17:41149363-41149385 GCAAGAGGGGTGGCAGCAGCTGG + Exonic
1147519798 17:41160107-41160129 GCAGGAAGGCTGGCAGCAGCTGG + Exonic
1147522731 17:41190020-41190042 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147522745 17:41190104-41190126 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147522789 17:41190353-41190375 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147522830 17:41190611-41190633 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147526268 17:41226788-41226810 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147526282 17:41226872-41226894 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147526331 17:41227151-41227173 GCAAGAAGGCTGGCAGCAGCTGG - Exonic
1147526802 17:41232620-41232642 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147526815 17:41232704-41232726 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147527307 17:41238170-41238192 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147527317 17:41238239-41238261 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147527362 17:41238503-41238525 GCAAGAAGGCTGGCAGCAGCTGG - Exonic
1147528431 17:41249854-41249876 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147528442 17:41249923-41249945 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147528964 17:41255588-41255610 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147529011 17:41255867-41255889 GCAAGAAGGCTGGCAGCAGCTGG - Exonic
1147529857 17:41265511-41265533 GCAGTAAGGCTGGCAGCAGCTGG - Exonic
1147529871 17:41265595-41265617 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1147530439 17:41271444-41271466 GCAGCAAGGCTGGCAGCAGCTGG - Intergenic
1147530453 17:41271528-41271550 GCAGGAAGGCTGGCAGCAGCTGG - Intergenic
1147530852 17:41275816-41275838 GCAGCAAGGCTGGCAGCAGCTGG - Exonic
1147530866 17:41275900-41275922 GCAGGAAGGCTGGCAGCAGCTGG - Exonic
1150308698 17:64109387-64109409 GCCTAAAGTTTGGCAACATCTGG - Intronic
1152878314 17:82800989-82801011 GCATGGAGGTAGGCACCATGAGG + Exonic
1156645539 18:39157276-39157298 ACATGTATGTAGGCAGCATCTGG - Intergenic
1157564476 18:48670551-48670573 GCTTGAGGGTGGGCAGCACCAGG + Intronic
1158815332 18:61088421-61088443 GCATGAGGGTTGGCAGGAAGGGG + Intergenic
1159449825 18:68585752-68585774 GCATGAAAGTTACCGGCATCAGG - Intergenic
1160314949 18:77834262-77834284 GAATGAAAGTTGCTAGCATCAGG + Intergenic
1161392087 19:4026575-4026597 GGATGAAGGGTGGCAGCTGCTGG - Intronic
1162198620 19:9005222-9005244 GCTTGGAGGTTGGCAGCTTGGGG - Intergenic
1162790867 19:13062244-13062266 GCAGGAAGATTAGCAGCATCAGG + Intronic
1163117071 19:15195438-15195460 GGGTGAGGGTTGGCAGCGTCGGG - Intronic
1165072002 19:33261135-33261157 GCATGAAGGCTGGCAGCACATGG - Intergenic
1165552560 19:36601049-36601071 GCATGAGGTTTGGCAGCATGAGG - Intronic
926143972 2:10385604-10385626 GCATGGACGATGGCAGAATCCGG + Intronic
926675935 2:15619538-15619560 GCATTAATGATGGCAGCAACAGG - Intronic
927243220 2:20936589-20936611 ACATCAAGATGGGCAGCATCTGG + Intergenic
933357548 2:81231414-81231436 GTATTAATGTTGGCAGCATTGGG - Intergenic
934231379 2:90184945-90184967 GAATGAAGGTTGCCAGGAACTGG + Intergenic
938722553 2:134079432-134079454 GCCTGAAGGTTGGAAGCATCTGG - Intergenic
940520483 2:154739573-154739595 GGATGAAGGTTGGGAGTCTCTGG - Intronic
942967608 2:181915931-181915953 GAAGGAAGGTGGGCTGCATCTGG - Exonic
944215067 2:197246563-197246585 GCGAGATGGTTGGCAGCATCAGG - Intronic
947859492 2:233348590-233348612 ACATGAAGGTTCCCAGCATCTGG + Intergenic
948070359 2:235116414-235116436 GCCTGCAGGATGGGAGCATCGGG - Intergenic
1168767046 20:388722-388744 AGATGAAGGTTGGCAGCAGCTGG + Intronic
1169274399 20:4223953-4223975 GCATGTAGGGTGGCAGCCACAGG + Intronic
1169757036 20:9053533-9053555 GCATGTAGTTGGGCAGCATCTGG - Intergenic
1170581991 20:17706116-17706138 GCTTGAAGGTTGGCCAAATCCGG + Intronic
1172701042 20:36853922-36853944 ACAGGAAGGAAGGCAGCATCTGG + Intronic
1172779395 20:37426839-37426861 CCATGAAATTTGGCAGCATGGGG - Intergenic
1173720452 20:45253427-45253449 GCAGGAAGGTAGCCAGCAGCTGG - Intronic
1175162745 20:57021153-57021175 GAATGAATGATGGCAGCATCTGG - Intergenic
1175572986 20:60038163-60038185 GTACGGAGGTTGGCAGGATCAGG + Intergenic
1175640834 20:60628988-60629010 GCATGAATGATGTCAGCATGTGG + Intergenic
1177799591 21:25815009-25815031 GCATGATGGTTGCCAGGAGCTGG + Intergenic
1178214567 21:30579606-30579628 AGATGAAGGTTTGCAGCATAGGG + Intergenic
1179132106 21:38646973-38646995 GCATGGAGGCTGGCAGCCACCGG - Intronic
1179569312 21:42268818-42268840 GCATGGAGGCTGGGAGCATTCGG - Intronic
1181857020 22:25789149-25789171 TCATCAAGGATGGCAGCATTGGG + Intronic
1183056740 22:35311382-35311404 GCCTGAAGGTTGGCAGTTTCAGG + Intronic
1183520084 22:38291734-38291756 GCCTGAAGGTTGGGGGCAGCGGG + Exonic
1183724164 22:39579157-39579179 GCCTGAAGCTTGGCAGCGCCAGG - Intronic
949905622 3:8856130-8856152 GCATGAGAGATGGCAGCAGCTGG + Intronic
953735559 3:45491440-45491462 GCAGGACTGGTGGCAGCATCAGG + Intronic
960951220 3:122999718-122999740 CCATGAAGACTGCCAGCATCTGG + Intronic
961841625 3:129719075-129719097 GGCTGATGGTTGGCAGCTTCAGG + Intronic
962585759 3:136841164-136841186 GCAAGATGGTTGGCAGGGTCAGG + Intronic
962789356 3:138796943-138796965 GCCTGAAGGTGGGTAGCATGCGG - Intronic
967273436 3:187750064-187750086 GCATGAAGGAAAGCAGCAGCTGG + Intergenic
974118747 4:57612463-57612485 GCAGGATGTTTGGCAGCATCTGG - Intergenic
975042708 4:69763424-69763446 GCATGAAGGTTGGTAGGAAGTGG - Intronic
977551759 4:98450214-98450236 GCATGAGGGTTCTCAGCATAGGG - Intergenic
978325896 4:107553889-107553911 TCATGAAAGCAGGCAGCATCTGG + Intergenic
980880038 4:138700743-138700765 GAATGAAGGTTGGAAGCAAATGG - Intergenic
983679450 4:170335440-170335462 TCATGAAGGTGAGCAGCTTCTGG - Intergenic
985425254 4:189823860-189823882 TCATGAATGTTGGCAGGATTGGG - Intergenic
986966920 5:13284632-13284654 TCATGAGTGGTGGCAGCATCAGG + Intergenic
990596770 5:57319954-57319976 TCATAAAAGTGGGCAGCATCGGG - Intergenic
990864750 5:60368406-60368428 GCAGGGAGGTTGGCAGGATGTGG + Intronic
994579512 5:101621885-101621907 TCATGAAGGAAGGAAGCATCAGG - Intergenic
998163708 5:139828384-139828406 GCCTGAAGGGTGGCAACAGCGGG + Intronic
999263986 5:150254702-150254724 GCATAGAGGTGGGCAGCATCGGG - Intronic
999450021 5:151670970-151670992 GCATGATGGTAGGCAGGAGCAGG + Intronic
1000146191 5:158455372-158455394 GTAGGATGTTTGGCAGCATCTGG + Intergenic
1000219816 5:159203554-159203576 GCATGATGCTTGGCACCCTCAGG + Exonic
1005699895 6:28389977-28389999 GCATGTGGTTTGGAAGCATCAGG - Intronic
1005791358 6:29304998-29305020 GCATTAAGATTGGCAGCACTGGG + Intergenic
1013556041 6:111258385-111258407 GGATGAAAGTTGGAAGAATCAGG + Intergenic
1015434402 6:133169195-133169217 GCATGAAGGTGGGCCTCCTCAGG - Intergenic
1015546126 6:134363039-134363061 ACAGGAAGCATGGCAGCATCTGG - Intergenic
1016195038 6:141325026-141325048 GCATGATGGTGGACAGCATTTGG - Intergenic
1017939141 6:159036151-159036173 GCATGACGGTGGGGAGCATGAGG - Exonic
1023882390 7:44327742-44327764 GCAGGAAGGTTGGCATGATTGGG + Intronic
1024145926 7:46516232-46516254 GCTTTAAGGTTTGGAGCATCAGG + Intergenic
1027254633 7:76423373-76423395 GTATGCAGGTTGGCATTATCTGG + Intronic
1027823326 7:83077515-83077537 GCATGAAGTCTGGCAGAAGCTGG - Intronic
1031672762 7:124570250-124570272 GCATGAAAGTTGTTAGCATGGGG - Intergenic
1034931466 7:155167087-155167109 GCATGAAGACTGTCAGCACCTGG + Intergenic
1035367585 7:158359091-158359113 ACAGGAAGGCAGGCAGCATCTGG + Intronic
1035748678 8:1979798-1979820 GGGTGCAGGTTGGCAGCCTCGGG + Intronic
1038243494 8:25832063-25832085 GCATGGAGGTTGGCACAAACAGG + Intergenic
1039110479 8:34036010-34036032 GCAGGAAAGTTGTCATCATCAGG - Intergenic
1040705599 8:50122639-50122661 GGAAGATGGTTGGCAGCATAAGG + Intronic
1043328668 8:79085580-79085602 GAATGAAGTTTGGCAGTATTTGG - Intergenic
1046917844 8:119696092-119696114 GAATGAATGTTGGCACCATTTGG - Intergenic
1050133646 9:2439449-2439471 GCCAGAAGGTTGGCAGCCTGGGG - Intergenic
1050136353 9:2469630-2469652 GCATGCAGGTTGCCCGCATAAGG + Intergenic
1052693406 9:31845689-31845711 GCATGAAGAAAGACAGCATCAGG - Intergenic
1056052064 9:82779271-82779293 GCAAGAAGTATAGCAGCATCTGG + Intergenic
1059083309 9:111273366-111273388 ATATGAAAGTTGGAAGCATCAGG + Intergenic
1059987333 9:119833485-119833507 AAATGAAGATAGGCAGCATCAGG - Intergenic
1060910422 9:127345439-127345461 CCATCAAGCTTGGCAGCTTCAGG + Exonic
1062206358 9:135339676-135339698 GGACAAAGGTTGGCAGCTTCAGG - Intergenic
1187251778 X:17605508-17605530 GCATCAAGATTGGCACCACCAGG - Intronic
1191140631 X:57113101-57113123 GCAGGAAGGATGGGAGCATTGGG + Intergenic
1193277887 X:79611815-79611837 ACAGGAAGCATGGCAGCATCTGG + Intergenic
1199341161 X:146679020-146679042 GCTTGAAGGCAGGAAGCATCTGG - Intergenic
1199734372 X:150670674-150670696 GCAGGCAATTTGGCAGCATCTGG + Intronic