ID: 1073510606

View in Genome Browser
Species Human (GRCh38)
Location 10:104040306-104040328
Sequence GAGGACACATACTGGCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 201}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073510600_1073510606 2 Left 1073510600 10:104040281-104040303 CCTCCTGGCAACCAGCAGGTAAA 0: 1
1: 0
2: 2
3: 18
4: 169
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510595_1073510606 27 Left 1073510595 10:104040256-104040278 CCAGCTCATTCAGCTTCATCCAA 0: 1
1: 0
2: 2
3: 17
4: 190
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510594_1073510606 28 Left 1073510594 10:104040255-104040277 CCCAGCTCATTCAGCTTCATCCA 0: 1
1: 0
2: 1
3: 38
4: 381
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510603_1073510606 -9 Left 1073510603 10:104040292-104040314 CCAGCAGGTAAACAGAGGACACA 0: 1
1: 0
2: 2
3: 12
4: 246
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510599_1073510606 3 Left 1073510599 10:104040280-104040302 CCCTCCTGGCAACCAGCAGGTAA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510597_1073510606 8 Left 1073510597 10:104040275-104040297 CCAAACCCTCCTGGCAACCAGCA 0: 1
1: 0
2: 1
3: 32
4: 309
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510593_1073510606 29 Left 1073510593 10:104040254-104040276 CCCCAGCTCATTCAGCTTCATCC 0: 1
1: 0
2: 3
3: 23
4: 298
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201
1073510601_1073510606 -1 Left 1073510601 10:104040284-104040306 CCTGGCAACCAGCAGGTAAACAG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073510606 Original CRISPR GAGGACACATACTGGCTTCT GGG Intronic
900854281 1:5168251-5168273 GGGGGCAAATACTGGCTTCAAGG + Intergenic
901193975 1:7429781-7429803 CAGGAAGCATAGTGGCTTCTGGG + Intronic
901638385 1:10680826-10680848 GGGGACACACACTGACTTCCCGG + Intronic
901906359 1:12415365-12415387 CATGACACATACGGGCTTCTTGG - Intronic
902239325 1:15077811-15077833 GGGGACAAAGACTGGCTTCATGG + Intronic
902557479 1:17255465-17255487 GCTGTCACATGCTGGCTTCTGGG - Intronic
903406998 1:23106172-23106194 GTGAACACAAGCTGGCTTCTAGG + Intronic
905507591 1:38492439-38492461 GAGGAAAGTTAGTGGCTTCTTGG - Intergenic
905544812 1:38789185-38789207 GAGGACACATAGAGGCTTGCTGG - Intergenic
905887489 1:41499294-41499316 GAGGAAACATACAAGCTCCTGGG + Intergenic
906036462 1:42753513-42753535 GAGAACAGGTACTGTCTTCTAGG - Intronic
906960210 1:50415581-50415603 GAGTACAGATACTGGCTCCCTGG + Intergenic
908464617 1:64380003-64380025 GAGGATACAATCTGGCTTTTAGG + Intergenic
909369629 1:74869149-74869171 CAGGAAGCATAGTGGCTTCTAGG - Intergenic
916378976 1:164187870-164187892 AAAGGCAAATACTGGCTTCTGGG - Intergenic
917281871 1:173385296-173385318 AAGGGCAAATACTGCCTTCTAGG + Intergenic
917699001 1:177561261-177561283 GAGGAAACAGTCTTGCTTCTGGG - Intergenic
921066990 1:211630461-211630483 TTGGTCACATGCTGGCTTCTTGG - Intergenic
1067565838 10:47336136-47336158 CAGGTCACATACTGGCTGCATGG + Intergenic
1069757038 10:70779714-70779736 GACGACACAGACAGGCTTCCCGG + Exonic
1072170322 10:92853262-92853284 GTGGACACATACTGTTTTCATGG + Intronic
1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG + Intronic
1073551519 10:104406291-104406313 GAGAAGACATACTGTCTCCTAGG + Intronic
1074059715 10:109953917-109953939 GAGAGGACACACTGGCTTCTTGG + Intergenic
1075599603 10:123757825-123757847 TAGGACAGATCCTGGCTTATAGG - Intronic
1075685338 10:124361035-124361057 CAGGAAGCATAGTGGCTTCTGGG - Intergenic
1075698421 10:124452268-124452290 GAGGCCACATACTTCCATCTGGG - Intergenic
1076079416 10:127565304-127565326 GAGGACACAGAGTGACTGCTTGG - Intergenic
1077059675 11:612539-612561 CAGAACACGTACTGGCATCTTGG - Exonic
1077161840 11:1117071-1117093 GAGGACACAGTCCTGCTTCTGGG + Intergenic
1078516983 11:12030892-12030914 TAGGAAGCATACTGGCTTCTAGG - Intergenic
1078530720 11:12134911-12134933 GAGGTCACATGCTGTCTTCCTGG - Intronic
1079120281 11:17678462-17678484 GGGGACACTTTCAGGCTTCTGGG + Intergenic
1079776681 11:24540492-24540514 GAGGGCACTTTCTGGCTTGTAGG - Intronic
1080131251 11:28797667-28797689 CAGGAAGCATACTGGCTTTTGGG + Intergenic
1080812176 11:35715751-35715773 CAGGAAGCATAGTGGCTTCTGGG + Intronic
1084496228 11:69505243-69505265 CAGGAAGCATAGTGGCTTCTGGG + Intergenic
1084523898 11:69684199-69684221 GAGGACGCATAGTGGCTACCGGG + Intergenic
1086246734 11:84761755-84761777 TGGGACACAGACTGGCTTCCTGG + Intronic
1088989630 11:114941021-114941043 GAGGACACATACTGGTTACCTGG - Intergenic
1090650712 11:128803548-128803570 GAGGACACATAAAGGGTTCCTGG - Intronic
1092324374 12:7513952-7513974 GAGCACACATTCTGTCTTGTTGG - Intergenic
1096060292 12:48692768-48692790 AAGGACACATTCTGAATTCTTGG - Exonic
1097179759 12:57165082-57165104 GAGGACACATACCAGCCTCCAGG + Intronic
1099626431 12:85081159-85081181 GAGGTCACAATTTGGCTTCTAGG - Intronic
1100293459 12:93238345-93238367 GAGAGCAGAAACTGGCTTCTTGG + Intergenic
1101258710 12:103006936-103006958 TGGGACTCAGACTGGCTTCTTGG - Intergenic
1101685923 12:107020665-107020687 CAGGAAGCATAGTGGCTTCTGGG - Intronic
1102800280 12:115726438-115726460 CAGGAAACATAGTGGCTTCTGGG - Intergenic
1105545007 13:21344820-21344842 GAGGAAACTGACTGCCTTCTTGG - Intergenic
1107957987 13:45535258-45535280 GAGAACACATTCTGCCTTCCTGG + Exonic
1109189375 13:59307079-59307101 GCGGACTAATACTGACTTCTAGG - Intergenic
1109348446 13:61145446-61145468 CAGGAGACATACAGGCTCCTGGG + Intergenic
1111548211 13:89772342-89772364 GAAGTCAAATACTGGCTTCAGGG - Intergenic
1112621148 13:101055458-101055480 GAGGACACTGAATGGCTTATTGG + Exonic
1113096194 13:106666657-106666679 TAGGACTCGGACTGGCTTCTGGG - Intergenic
1116452182 14:45079257-45079279 CAGAAAACATGCTGGCTTCTTGG - Intergenic
1117584658 14:57188143-57188165 CAGGAGACATTCTGGCTGCTAGG - Intergenic
1118424923 14:65650390-65650412 CAGGAAGCATAGTGGCTTCTGGG + Intronic
1120791063 14:88582572-88582594 GAGCACACAGAGAGGCTTCTGGG + Intronic
1122623334 14:103071915-103071937 GAGGACCCAGGCAGGCTTCTGGG - Intergenic
1126088360 15:45029836-45029858 GAGGAGACAACCTGACTTCTGGG - Intronic
1126318472 15:47396399-47396421 TGGGACACGTACTGGCTTCCTGG - Intronic
1126318929 15:47400765-47400787 AAGCACACATACTGGCTTACTGG + Intronic
1128066926 15:64770902-64770924 GAGGACACATGATGGGCTCTAGG + Intronic
1128458785 15:67850437-67850459 GGCGACACATAAAGGCTTCTGGG + Intergenic
1129503273 15:76060006-76060028 GAGGACACATACCTGCTGCCCGG - Exonic
1129760241 15:78125037-78125059 AAGGATCCATGCTGGCTTCTTGG + Intronic
1130896237 15:88172488-88172510 GAGTAAACATTCTGGCCTCTGGG - Intronic
1131081523 15:89540369-89540391 GGGGACACACAGTGGCTTCTAGG + Intergenic
1131089271 15:89608880-89608902 GCTGACACAGAATGGCTTCTAGG - Exonic
1131687236 15:94781363-94781385 GAGGACAAATATTGACATCTAGG + Intergenic
1132104999 15:99057064-99057086 AAGGACTCTTACTGGCTCCTGGG + Intergenic
1135057108 16:19240702-19240724 CAGGAGACAGACAGGCTTCTGGG - Intronic
1137257781 16:46791144-46791166 GATAAAACATACTGGGTTCTGGG - Intergenic
1137532395 16:49287671-49287693 GAGGGCAGAGACTGGCTTCAGGG - Intergenic
1138250431 16:55497956-55497978 GAGGACAACTGCTGGCTCCTAGG + Intronic
1139488383 16:67271973-67271995 GAGGGGACATAGTGGCCTCTGGG + Exonic
1143610752 17:8016217-8016239 GAGGACACTTTCTGGCTAGTGGG + Exonic
1144303313 17:13944101-13944123 GATGAGAGAAACTGGCTTCTAGG + Intergenic
1148564953 17:48627170-48627192 CAGGACAGATAGTGGATTCTTGG - Intronic
1148660964 17:49332446-49332468 GAGGGAACATACAGGCTTATGGG - Intronic
1150978193 17:70112138-70112160 CAGGACTCATACTTGGTTCTCGG - Intronic
1151659931 17:75513795-75513817 CACGACCCATACTGGCTCCTGGG + Exonic
1151681007 17:75622780-75622802 GAGGACAACTACTGTCTTCAAGG + Intergenic
1152133029 17:78488662-78488684 CAGGGCACATTCTGGGTTCTGGG - Intronic
1156777529 18:40810825-40810847 GAAGACAGATACTGTCATCTGGG + Intergenic
1157069399 18:44388258-44388280 GAGGGGAAATACTGACTTCTAGG + Intergenic
1159978621 18:74748910-74748932 CACAACACAAACTGGCTTCTGGG - Intronic
1160349839 18:78167766-78167788 GAGGAAACATAATGGATTCATGG - Intergenic
1160477829 18:79208550-79208572 GAGGACACATGTTAGCTTTTTGG + Intronic
1166114312 19:40643708-40643730 GGGAACACAAACTGGCTTTTAGG + Intergenic
926942645 2:18154508-18154530 TGGGACTCATACTGGCTTCCTGG - Intronic
929568885 2:43007218-43007240 GAGGACCCACACTGCTTTCTAGG + Intergenic
929569963 2:43016396-43016418 GGGGACACATGCCAGCTTCTGGG + Intergenic
930604162 2:53475359-53475381 CAGGAGGCCTACTGGCTTCTGGG - Intergenic
930941057 2:57014606-57014628 CAGGAAGCATAGTGGCTTCTGGG - Intergenic
932366525 2:71156674-71156696 GAGGCTACAGACTGGCTTCCAGG - Intergenic
934928749 2:98402705-98402727 GAAGACACATTCTGCATTCTGGG + Intergenic
935096775 2:99952338-99952360 CAGGAAGCATAATGGCTTCTGGG - Intronic
935485114 2:103643806-103643828 AAGGACACAGACAGGCTTATAGG - Intergenic
938173232 2:129101473-129101495 TAGCACACATATTAGCTTCTTGG + Intergenic
938890389 2:135698675-135698697 TAGGAAGCATAGTGGCTTCTAGG + Intronic
941105758 2:161350967-161350989 GAGGACACAGACAGGATTATAGG - Intronic
941149024 2:161890742-161890764 AAGGACACAGACTGGCAACTTGG - Intronic
943385552 2:187200486-187200508 TAGGACTCAGACTGGCTTCTTGG - Intergenic
948825897 2:240573354-240573376 GAGGACCCCCACTGGCCTCTGGG + Intronic
1170937135 20:20820266-20820288 GAGGATCCATACTGAGTTCTGGG + Intergenic
1171523698 20:25794130-25794152 CAGGACACCTGCTGGGTTCTCGG + Intronic
1171553129 20:26061753-26061775 CAGGACACCTGCTGGGTTCTCGG - Intergenic
1172106578 20:32520673-32520695 ACGGACCCATACTGGCCTCTGGG + Intronic
1172208701 20:33182431-33182453 GAGGTGACATCCTGGCTTCCAGG + Intergenic
1173145166 20:40518602-40518624 GAGGAGAAAGAATGGCTTCTGGG + Intergenic
1173245910 20:41337363-41337385 GAGCAGCAATACTGGCTTCTGGG - Intergenic
1174194558 20:48763823-48763845 GAGTACAGACACTGGCTGCTTGG + Intronic
1175696199 20:61105121-61105143 AAGGACACTTGCTGGCTTCTGGG - Intergenic
1175839314 20:62016630-62016652 GGGGACTCAGACTGGCTTCCGGG + Intronic
1181584220 22:23844410-23844432 GATGACACATAGTGCCTTTTGGG + Intergenic
1181601300 22:23953373-23953395 GAGGCCACATAGTGCCTCCTTGG + Intergenic
1181607210 22:23987964-23987986 GAGGCCACATAGTGCCTCCTTGG - Intergenic
1181700084 22:24615764-24615786 GAGGACAGACAGTGGCTTCCTGG - Intronic
1181971588 22:26694786-26694808 GAGGACACAGCCTAGGTTCTTGG - Intergenic
1183346571 22:37311517-37311539 CTGAACACCTACTGGCTTCTTGG - Exonic
1183768000 22:39897214-39897236 AATGACACATCCTTGCTTCTAGG + Intergenic
950629143 3:14270208-14270230 GAGTCCTCATACTTGCTTCTGGG - Intergenic
952184529 3:30954286-30954308 GAAGACACAATCTGGCTTCGTGG - Intergenic
952911311 3:38189937-38189959 GAGGAGACATACAGGGTGCTTGG + Intronic
954647597 3:52141004-52141026 GATGACACATACTGCCACCTGGG + Intronic
957117936 3:76050411-76050433 GGGGACTCAGACTGGCTTCCTGG + Intronic
958141279 3:89565175-89565197 GGGGACTCAGACTGGCTTCCTGG + Intergenic
958594450 3:96202779-96202801 AAGGACACACTCTGGCTTTTAGG - Intergenic
960374870 3:116887878-116887900 CAGGACACATACGAGCTTCTGGG - Intronic
961608675 3:128118624-128118646 GAGGACACCGTGTGGCTTCTTGG - Intronic
962240492 3:133747298-133747320 GAGGACACATTCTCGCCTATGGG + Intronic
962342364 3:134596341-134596363 GAGGACACATACTGACTACTTGG - Intergenic
965715610 3:171599309-171599331 GAGGACTCTTCCTGGCTTGTCGG - Intergenic
969337034 4:6517108-6517130 GAGGCCACATATTGGCATCAGGG - Intronic
970737312 4:19188281-19188303 AAGGACACATAATGGCTTTCGGG + Intergenic
970773700 4:19647499-19647521 GGGGACTCGTACTGGCTTCCTGG - Intergenic
972450826 4:39196674-39196696 GAGGGCTCATTCTGGCCTCTGGG - Intronic
972861603 4:43175364-43175386 TAAGACACATACTGGCTTTGAGG + Intergenic
972912796 4:43838896-43838918 GAGGAAACATAATAGATTCTGGG + Intergenic
976860354 4:89658301-89658323 GAAGAAGCATACTTGCTTCTGGG + Intergenic
979969419 4:127115310-127115332 CAGGAAGCATAGTGGCTTCTGGG - Intergenic
981977666 4:150750128-150750150 GAGTAAACATACTGGCTTTTAGG - Intronic
984903185 4:184602856-184602878 AAGGACACAGACTGGCATATTGG + Intergenic
986181072 5:5393418-5393440 TGGGACTCAGACTGGCTTCTTGG - Intergenic
987041677 5:14068752-14068774 GAGGCCACATATTGGCTTTGTGG - Intergenic
987707057 5:21471102-21471124 TGGGACTCAGACTGGCTTCTTGG + Intergenic
987952576 5:24694526-24694548 CAGGAAGCATAGTGGCTTCTGGG + Intergenic
990738318 5:58887984-58888006 GAGGTCACATGCTGGCTCCCAGG + Intergenic
991610361 5:68443341-68443363 AAGGAGACAGAGTGGCTTCTCGG - Intergenic
994718122 5:103348058-103348080 GAGGACATATAGTGGCATATAGG + Intergenic
995367619 5:111381330-111381352 GAGAACTCAGACTGGCTTCCTGG - Intronic
996013921 5:118509989-118510011 GTGGTCACATACTGACCTCTGGG - Intergenic
996608318 5:125349968-125349990 GAGGACACCTACTGCCTGTTTGG - Intergenic
996876995 5:128250953-128250975 TAGGAAGCATAGTGGCTTCTGGG - Intergenic
997143017 5:131403170-131403192 GAAAACACATACTGTGTTCTTGG + Intergenic
999052892 5:148542980-148543002 GATGACACATCCTGGTTACTGGG - Intronic
1001125771 5:169018037-169018059 TAGGATACATGCAGGCTTCTGGG - Intronic
1003406612 6:5831680-5831702 GAGGAAACTGACTGCCTTCTTGG + Intergenic
1006564386 6:34942409-34942431 GATGTGACTTACTGGCTTCTAGG + Intronic
1009021167 6:57949406-57949428 TGGGACTCAGACTGGCTTCTTGG - Intergenic
1011433367 6:87312050-87312072 GAGGAGACATAAGGGATTCTAGG + Intronic
1017379858 6:153815406-153815428 TAGGACCCAGACTGGCTTCCTGG - Intergenic
1017727692 6:157287061-157287083 GAGGACAAAGCCTGACTTCTAGG + Intergenic
1019001946 6:168761352-168761374 GAGAAAACATACTGGCATCCAGG + Intergenic
1019490582 7:1311417-1311439 GAGGACACACGCGGGCTTCTGGG + Intergenic
1020711519 7:11612087-11612109 GAGTCCAGATTCTGGCTTCTGGG + Intronic
1023201985 7:37708062-37708084 GAGGTCACATACTAGCTTAGAGG - Intronic
1024481386 7:49866943-49866965 GAGGACACAGGTGGGCTTCTGGG - Intronic
1024733496 7:52277695-52277717 GAGGACCCATCCTGGCTTCCAGG - Intergenic
1026287547 7:68976568-68976590 TAGGAAGCATAGTGGCTTCTGGG + Intergenic
1026611715 7:71865671-71865693 GAGGACACATGGTGGCTTCTGGG + Intronic
1029956800 7:104648960-104648982 ATGGACACATCCTGGCCTCTAGG + Intronic
1030784871 7:113646686-113646708 TAGGACTCAGACTGGCTTCCTGG - Intergenic
1031075496 7:117208511-117208533 GAGAACACATGCAGGCATCTTGG - Intronic
1033741176 7:144276920-144276942 GAGAACACAGCCTGGCTCCTCGG - Intergenic
1033752729 7:144372694-144372716 GAGAACACAGCCTGGCTCCTCGG + Exonic
1034121644 7:148633314-148633336 CAGGAAGCATAGTGGCTTCTGGG - Intergenic
1034788715 7:153948475-153948497 CAGGAATCACACTGGCTTCTGGG + Intronic
1035010293 7:155709786-155709808 GGGGAAACATACTGCATTCTGGG + Intronic
1035667796 8:1391849-1391871 GAAGACACATACTCGGGTCTTGG - Intergenic
1035679604 8:1478307-1478329 GAGGACACATACAGGCATGAAGG + Intergenic
1037840257 8:22239929-22239951 GAGGACAAATACAGTTTTCTGGG - Intergenic
1039003223 8:33005058-33005080 GAGGACAGATGTTGGCATCTAGG - Intergenic
1039820621 8:41130857-41130879 GAAGAGACATTCTGGCTTTTTGG - Intergenic
1040879488 8:52189875-52189897 GCAGATACATATTGGCTTCTTGG + Intronic
1041567387 8:59294725-59294747 GATGACACATACTGCCTTTCTGG - Intergenic
1042340126 8:67670222-67670244 CAGGAAACATAATGGCTTCTGGG + Intronic
1043480157 8:80644679-80644701 CAGAACACATCGTGGCTTCTGGG + Intronic
1043545584 8:81312137-81312159 GATGACGCATACTTTCTTCTTGG - Intergenic
1045513374 8:102833124-102833146 GAAGACACATAGTAGCTTCCGGG + Exonic
1047160353 8:122371117-122371139 TAGGACTCAGACTGGCTTCCTGG + Intergenic
1047691573 8:127360287-127360309 CAGGAAGCATAGTGGCTTCTGGG + Intergenic
1047919157 8:129615741-129615763 GAGGAATCATTCTGGGTTCTAGG - Intergenic
1048372526 8:133791998-133792020 GAGGACAAGTTCTGCCTTCTAGG + Intergenic
1048769919 8:137884324-137884346 GAGGACACCAACTAGCCTCTTGG - Intergenic
1053364434 9:37512526-37512548 GAGGACACAGACCTGCTTCAGGG - Exonic
1056994459 9:91443379-91443401 CAGGAGGCATACAGGCTTCTGGG - Intergenic
1058868924 9:109185930-109185952 CAGGACAGGTAGTGGCTTCTTGG + Intronic
1058869168 9:109187759-109187781 CAGGACACATTTTGGCTTCTAGG - Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1187007024 X:15242031-15242053 CAGTACACATGCTGGCTACTTGG - Intronic
1189498557 X:41531884-41531906 GAGGTGACAAACTGGCTTATGGG + Intronic
1193034688 X:76936415-76936437 GAAGACACATACTGGCAAATTGG + Intergenic
1193835935 X:86343827-86343849 GAGGACACATAGTGGAAACTTGG + Intronic
1195120017 X:101740003-101740025 GAGCAAACATTCTGGGTTCTTGG - Intergenic
1196016239 X:110943691-110943713 GAGGACCAAGACTGGTTTCTTGG - Intergenic
1197596632 X:128471548-128471570 CAGGACTCAGACTGGCTTCCTGG + Intergenic
1198309573 X:135417379-135417401 GAAGAAACATACTGTGTTCTTGG + Intergenic
1198756342 X:139986500-139986522 GAAGAGACATACTGGCCACTTGG + Intergenic
1201343329 Y:12956860-12956882 CAGGAAGCATAATGGCTTCTGGG + Intergenic
1201720352 Y:17089876-17089898 CAAGACACAAACAGGCTTCTGGG + Intergenic