ID: 1073512557

View in Genome Browser
Species Human (GRCh38)
Location 10:104051884-104051906
Sequence TTATGTGATCCCTAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073512557_1073512563 -1 Left 1073512557 10:104051884-104051906 CCACCCACTTAGGGATCACATAA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1073512563 10:104051906-104051928 ACGGGGCCATTGAAGAGAGATGG No data
1073512557_1073512568 26 Left 1073512557 10:104051884-104051906 CCACCCACTTAGGGATCACATAA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1073512568 10:104051933-104051955 ATGGCCCCAAGCCCATTATGGGG 0: 1
1: 0
2: 0
3: 38
4: 365
1073512557_1073512567 25 Left 1073512557 10:104051884-104051906 CCACCCACTTAGGGATCACATAA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1073512567 10:104051932-104051954 CATGGCCCCAAGCCCATTATGGG No data
1073512557_1073512566 24 Left 1073512557 10:104051884-104051906 CCACCCACTTAGGGATCACATAA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1073512566 10:104051931-104051953 ACATGGCCCCAAGCCCATTATGG No data
1073512557_1073512565 7 Left 1073512557 10:104051884-104051906 CCACCCACTTAGGGATCACATAA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1073512565 10:104051914-104051936 ATTGAAGAGAGATGGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073512557 Original CRISPR TTATGTGATCCCTAAGTGGG TGG (reversed) Intronic
901167770 1:7232058-7232080 TTTTGTTCTCCCTGAGTGGGTGG + Intronic
906527244 1:46501514-46501536 TTAAGTGATCCCAAAGTGCTGGG + Intergenic
909115214 1:71525161-71525183 TTATGTGTTTCCTAAGTGCAAGG + Intronic
912059804 1:105653550-105653572 CTTTGTGAAGCCTAAGTGGGAGG + Intergenic
920001440 1:202802634-202802656 TTTTGGGAGGCCTAAGTGGGCGG - Intronic
923132003 1:231083732-231083754 TTTTGTGATGCCAAAGTGGGAGG + Intergenic
924708499 1:246516746-246516768 TTATGTGATTCCTCAGTGTCCGG + Intergenic
924919029 1:248606623-248606645 TGATGTGGTCCCAAAATGGGAGG + Intergenic
1062958386 10:1554947-1554969 TGTTCTGATCCGTAAGTGGGAGG - Intronic
1063983411 10:11475355-11475377 TCAGGTGATCCCTAAGTGCTGGG - Intronic
1065179174 10:23107696-23107718 GAATTTGCTCCCTAAGTGGGAGG - Intronic
1070185557 10:74059118-74059140 TCAGGTGATCCCTAAGTGCTGGG - Intronic
1070680482 10:78445656-78445678 ATATGTGATGCCCAAGTGTGTGG + Intergenic
1072268721 10:93754961-93754983 TATTGTGATCCACAAGTGGGTGG + Intergenic
1072779741 10:98240060-98240082 TTTTGGGATGCCAAAGTGGGCGG + Intronic
1073401941 10:103264967-103264989 TTTTGGGATGCCAAAGTGGGTGG + Intergenic
1073512557 10:104051884-104051906 TTATGTGATCCCTAAGTGGGTGG - Intronic
1077702495 11:4455130-4455152 GAGTGTGACCCCTAAGTGGGGGG - Intergenic
1081394592 11:42571249-42571271 TTATGTGTTCACAGAGTGGGAGG - Intergenic
1081469087 11:43352987-43353009 TTATGTGCTTCCTCAGTAGGTGG + Intergenic
1085518026 11:77122586-77122608 TTATGTGATCATCAAGTGTGAGG + Exonic
1092052818 12:5484630-5484652 TTATGTGATTCATAACTGAGGGG + Intronic
1094116361 12:26918923-26918945 CTTTGTGAGTCCTAAGTGGGAGG + Intronic
1094651463 12:32381333-32381355 GTATGCAATCCCTTAGTGGGGGG + Intronic
1096208900 12:49747079-49747101 CTTTGGGATGCCTAAGTGGGTGG - Intronic
1097502884 12:60428041-60428063 TTAAGTGCTCCCTATTTGGGAGG + Intergenic
1098865091 12:75753231-75753253 TTATGTAAACCCTAAGATGGAGG - Intergenic
1099562333 12:84193481-84193503 TTAAACGATCCCTACGTGGGTGG + Intergenic
1102622789 12:114210050-114210072 TTATGTGATTCCTCAGCTGGGGG - Intergenic
1103181002 12:118911468-118911490 TTCTGGGATGCCAAAGTGGGAGG + Intergenic
1108140778 13:47418946-47418968 TCATGTGCTGCCTAAGTGAGCGG - Intergenic
1109537420 13:63738759-63738781 GTATGAGATCACAAAGTGGGCGG - Intergenic
1109546822 13:63842816-63842838 GTATGAGATCGCAAAGTGGGCGG + Intergenic
1109722996 13:66300451-66300473 ATATGTGAACCTTAAGTAGGTGG + Intergenic
1111579323 13:90202157-90202179 TGAAGTGATCTCTAAATGGGAGG + Intergenic
1114960458 14:27881702-27881724 TTAAATGTTCCCTCAGTGGGTGG + Intergenic
1115308484 14:31956322-31956344 TTATGTCATCCCTTACTGGGTGG - Intergenic
1116712140 14:48382604-48382626 TTTTGTGAGCCCGAAGTGGGCGG + Intergenic
1117823232 14:59673251-59673273 TTTTGTGTTCCGTGAGTGGGAGG + Intronic
1121029828 14:90648593-90648615 TTTTGGGATGCCAAAGTGGGAGG - Intronic
1123897351 15:24841889-24841911 TTATGTGATCCCTTATTGTCAGG - Intronic
1124017508 15:25889819-25889841 TTATGTGCCCATTAAGTGGGAGG - Intergenic
1125159410 15:36626674-36626696 TCATGAGCTTCCTAAGTGGGAGG + Intronic
1129889210 15:79059750-79059772 TTATGGGATGCCTCTGTGGGGGG - Intronic
1131189086 15:90300005-90300027 TACTGGGATCCCAAAGTGGGTGG - Intronic
1134802476 16:17098369-17098391 TTATCTGACCCTTAAGTTGGGGG + Intergenic
1142231283 16:88901382-88901404 TTCTGTGAGCCCTGAGTGTGAGG - Intronic
1143483996 17:7243036-7243058 TCATGTGATCTCAAAGAGGGCGG + Intronic
1146974507 17:37099387-37099409 TTGTGTCATCCCTTAGTGTGGGG - Intronic
1148478682 17:47945968-47945990 TTCTGTGATCCCTGATCGGGAGG + Exonic
1150010774 17:61501246-61501268 TTTTGAGAGGCCTAAGTGGGAGG + Intergenic
1150430827 17:65115619-65115641 TTTTGGGATGCCAAAGTGGGAGG - Intergenic
1152808420 17:82369729-82369751 TTATGTGATCCATAATTGATGGG - Intergenic
1164254829 19:23518461-23518483 TTCTGGGAGGCCTAAGTGGGCGG + Intergenic
1165859002 19:38897268-38897290 TGATGTGTTCCATAATTGGGTGG - Intronic
1166657632 19:44623776-44623798 TTCTGTGATCCTGCAGTGGGTGG + Exonic
930472909 2:51843157-51843179 TTATGGGAGACTTAAGTGGGTGG - Intergenic
932536689 2:72604936-72604958 TTATGGGATTCCTAAGTGATAGG - Intronic
934623846 2:95832669-95832691 TTAGGAGAACCCTAACTGGGTGG + Intergenic
934624192 2:95834115-95834137 TTAGGAGAACCCTAACTGGGTGG + Intergenic
934809781 2:97268926-97268948 TTAGGAGAACCCTAACTGGGTGG - Intergenic
934827914 2:97439059-97439081 TTAGGAGAACCCTAACTGGGTGG + Intergenic
936960673 2:118070780-118070802 TTATGTGAACCCTAGGGTGGGGG + Intergenic
937363612 2:121245524-121245546 TGATGTGGGCCCCAAGTGGGAGG - Intronic
940190180 2:151032416-151032438 ATATGTGGTCCCTGAGTGGCAGG - Intronic
940750421 2:157621442-157621464 TTACTGGATCCCTAAGTAGGAGG + Intronic
943306093 2:186264492-186264514 TAATAGGATCCCTAAGTGGCAGG + Intergenic
944699623 2:202235102-202235124 TCAAGTGATCCCAAAGTGGTGGG + Intronic
946446340 2:219742737-219742759 TTAAGTGATCCTTAAGTGGCTGG + Intergenic
1170635393 20:18099851-18099873 TCATTTGATCCCAGAGTGGGCGG - Intergenic
1171516454 20:25742030-25742052 TTATGTAATCCTCAAGTGGCAGG - Intergenic
1171865753 20:30486556-30486578 TTATGCGACCCCCAAGTGGTCGG - Intergenic
1173318115 20:41963133-41963155 TTATGGGAGGCCAAAGTGGGTGG - Intergenic
1181872665 22:25912640-25912662 TTATGTGAACCCTGAGTGCTTGG - Intronic
1182638522 22:31748922-31748944 TTCTCTAACCCCTAAGTGGGAGG + Intronic
1182666865 22:31966520-31966542 TTTTGGGAGGCCTAAGTGGGAGG - Intergenic
1184121689 22:42454851-42454873 TTTTGGGAGCCCGAAGTGGGTGG - Intergenic
949542816 3:5047164-5047186 TTTTGGGATGCCAAAGTGGGAGG + Intergenic
950528647 3:13539818-13539840 CTATGTCATCCCTGTGTGGGCGG + Intergenic
953157252 3:40386649-40386671 TTATGTGGTCCCCCGGTGGGTGG - Intergenic
954319359 3:49820958-49820980 CTTTGGGATGCCTAAGTGGGCGG + Intergenic
957914367 3:86668052-86668074 TTCTGTGATCTCCATGTGGGAGG + Intergenic
961142308 3:124565824-124565846 ATCTGTGATCCCGAAGTGGGAGG + Intronic
963997544 3:151727722-151727744 TTTTGTGATCCCTAACAGGTAGG - Intergenic
964577198 3:158185218-158185240 GTCTTTGATACCTAAGTGGGAGG + Intronic
965047362 3:163597026-163597048 TTATATGGTCCCTTTGTGGGTGG - Intergenic
966385412 3:179392310-179392332 TTATGTGACCCCTGAGGGGTGGG + Exonic
966612912 3:181886041-181886063 TTTTGTGAGGCCAAAGTGGGAGG + Intergenic
969826576 4:9762804-9762826 GTATGAGGTCCCAAAGTGGGCGG + Intergenic
969965807 4:10994151-10994173 TTTTGGGATGCCAAAGTGGGTGG + Intergenic
974328881 4:60450824-60450846 TTAAGTGATGCCTAAATGGCTGG + Intergenic
975775225 4:77779208-77779230 TTATGTGCTTCCTATGTGGCGGG - Intronic
980981974 4:139662399-139662421 CTATGTCATCCCAAAGCGGGGGG + Intergenic
981318843 4:143368306-143368328 TTAAGAGATCCCTAAGAGTGTGG - Intronic
982306998 4:153943280-153943302 TCATGTGATCCCAAAGTGCTGGG - Intergenic
987920682 5:24276513-24276535 CTTTGGGATGCCTAAGTGGGTGG + Intergenic
991180708 5:63747482-63747504 TTATATGCTCCCTCTGTGGGTGG + Intergenic
998271780 5:140713071-140713093 TTATGTGAGGCCGAGGTGGGCGG - Intergenic
999438357 5:151581833-151581855 TTATGTGATCCCTGATATGGGGG - Intergenic
999890846 5:155977225-155977247 TGATGTGAACACTAAATGGGCGG - Intronic
1004182893 6:13396256-13396278 TTTTCTGATCCATAAGAGGGAGG - Intronic
1004593851 6:17080088-17080110 TTAGCTGCTACCTAAGTGGGTGG - Intergenic
1005479082 6:26238431-26238453 TAATGAGATCTCTAAGTGGGTGG - Intergenic
1005969213 6:30748315-30748337 TTAAGTGTTTCCTAAGTGGGAGG - Intergenic
1006143686 6:31945840-31945862 ATTTCTGGTCCCTAAGTGGGTGG + Exonic
1006739835 6:36300073-36300095 TAATGTGATCCCTGGGTGGGGGG - Intronic
1008468490 6:51856784-51856806 TTATAAGATCCCTAAGTTAGAGG + Intronic
1010836961 6:80600119-80600141 TTATGTGATCCATAAATAGCAGG + Intergenic
1011630364 6:89317227-89317249 TTGTGAGATCCCTAGGTAGGGGG + Intergenic
1013701141 6:112770799-112770821 TAATGTGTTCCCTAAGTTGAGGG - Intergenic
1013931942 6:115545168-115545190 TTACGAGTTCCCGAAGTGGGGGG + Intergenic
1016393286 6:143596593-143596615 TTATGGGATGCCAAGGTGGGAGG + Intronic
1020683530 7:11266035-11266057 TTATGTGATGCCGAGGTCGGGGG + Intergenic
1029280338 7:99431369-99431391 TTTTGGGAGCCCAAAGTGGGCGG - Intronic
1030138388 7:106281360-106281382 TCATGTGATCCCATTGTGGGAGG - Intronic
1038662025 8:29505841-29505863 TGATCTGACCCCAAAGTGGGAGG - Intergenic
1039447107 8:37641878-37641900 TTCTGTGATCCGTCTGTGGGTGG - Intergenic
1043130455 8:76454598-76454620 TTATGTGAGCCCTACTTGAGAGG + Intergenic
1046577079 8:116043633-116043655 TTAAGTGATACCTAACAGGGTGG + Intergenic
1048334622 8:133493179-133493201 TGCTGTGTTCCCTATGTGGGAGG - Intronic
1053331648 9:37215749-37215771 TTAATTGATACCTAAGTGGAAGG + Intronic
1056015600 9:82383038-82383060 TTATGAGATTCCTAAGGAGGGGG + Intergenic
1057038302 9:91828468-91828490 CTTTGTGATGCCGAAGTGGGTGG + Intronic
1060504141 9:124185693-124185715 CTTTGTGATGCCAAAGTGGGTGG + Intergenic
1185651289 X:1649814-1649836 AAATGTGATCCCCAAGGGGGAGG + Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186818765 X:13264822-13264844 TTACTTGAGCACTAAGTGGGTGG - Intergenic
1187162502 X:16777686-16777708 TTTTGTGATCCCAAAGTGCTGGG - Intergenic
1190113739 X:47612155-47612177 TTATGGGAAGCCTGAGTGGGAGG + Intronic
1195852255 X:109295810-109295832 TTAAATGATCCCTCCGTGGGTGG + Intergenic
1196064354 X:111446430-111446452 TTTTGGGATGCCTAGGTGGGTGG + Intergenic
1197491906 X:127128456-127128478 TTAAGTGCTCCCTCTGTGGGTGG - Intergenic
1199110995 X:143934645-143934667 TTAAGTGTTCCCTCAGTGGGTGG + Intergenic
1200172116 X:154084494-154084516 TTATGTGCTCCCTTAGTGGCTGG + Intronic
1201284619 Y:12368618-12368640 CTATGTGATCCCACTGTGGGAGG - Intergenic