ID: 1073513637

View in Genome Browser
Species Human (GRCh38)
Location 10:104058212-104058234
Sequence CTCCTCCAGTTTAAAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073513637_1073513638 -4 Left 1073513637 10:104058212-104058234 CCTGAGCTTTTAAACTGGAGGAG 0: 1
1: 0
2: 1
3: 11
4: 138
Right 1073513638 10:104058231-104058253 GGAGCTAGCTGCTCTGCCTATGG 0: 1
1: 0
2: 2
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073513637 Original CRISPR CTCCTCCAGTTTAAAAGCTC AGG (reversed) Intronic
908860317 1:68478819-68478841 CGTCTCCAATTTAAAAGCTCTGG - Intronic
910181970 1:84494318-84494340 TTCCTCCAGATTAGAAGCTATGG - Intronic
916014051 1:160732773-160732795 CTCCTCTAGTGCAAAAGCTTTGG + Intergenic
917061230 1:171042972-171042994 CACCTCAAGTTAAAAAGATCTGG - Intronic
922610755 1:226925310-226925332 CTTCTCTAGTTTAAAAACTTGGG + Intronic
1067346043 10:45439914-45439936 CTCCTCCTGTTTAAAGGCTTGGG - Intronic
1073513637 10:104058212-104058234 CTCCTCCAGTTTAAAAGCTCAGG - Intronic
1073758101 10:106602795-106602817 CTCCCCAAGTTAAAAAGATCTGG + Intronic
1074539129 10:114350541-114350563 CTCCTCCTATTTAAAGGTTCTGG + Intronic
1075919908 10:126201997-126202019 CTCGTCCAGTGGAAAGGCTCTGG + Intronic
1078007424 11:7542720-7542742 GTCAGCCAGTTCAAAAGCTCTGG - Intronic
1080655262 11:34253114-34253136 CTCCTCCAGGTGGAAAGCACAGG + Intronic
1081846050 11:46241258-46241280 TTCTTCCAGTTTAAAGGCACAGG - Intergenic
1086787585 11:90989519-90989541 CTCCACCACCTTAAAAACTCTGG - Intergenic
1087783040 11:102321324-102321346 GTCTTCCAGTTTGAAACCTCTGG + Intronic
1089318452 11:117607930-117607952 ATCTTCCAGTTTAAACGCTCTGG - Intronic
1089836693 11:121376584-121376606 CTCCTCCAGTCAGAAAGCTGGGG - Intergenic
1090634272 11:128680344-128680366 CTGCTCCTGTTTAAAAACTATGG - Intergenic
1091338440 11:134792043-134792065 CTCCTTCAGGTAAACAGCTCTGG - Intergenic
1091925166 12:4341044-4341066 CACATCAAGTTTAAAAGCTTTGG + Intronic
1094232754 12:28126769-28126791 TTCCTCCACTTTAATAGCTCTGG + Intergenic
1094352840 12:29545712-29545734 CCCCTGCAGTTGAACAGCTCGGG - Intronic
1096980579 12:55726248-55726270 CTCCCCCAGTTTAAGTGCTGTGG - Exonic
1099819695 12:87694159-87694181 CTCCTTCAATTTAGAAGCTTTGG - Intergenic
1100694038 12:97071654-97071676 CTGCTCCAGTTGAAAAACACTGG + Intergenic
1104210993 12:126688386-126688408 CTTCTCCAGCTTAAAAGAGCTGG - Intergenic
1105307427 13:19178916-19178938 TTCCTCCAGATTAGAAGCCCAGG - Intronic
1106473603 13:30078814-30078836 CCCTTCCAGGTTAAAAGATCTGG - Intergenic
1107402766 13:40085686-40085708 CTCCCCCAGTTTTATAGCACTGG + Intergenic
1108431693 13:50360070-50360092 CCCCTCCAGTTTAAGATCACAGG + Intronic
1108616285 13:52136125-52136147 CACCTCCAGTTTAACAGCAGAGG - Exonic
1109093692 13:58082849-58082871 ATCCTCCAGTGGAAAAGCACTGG - Intergenic
1110361918 13:74635965-74635987 CTCATCCAATTGAAAAGCTTTGG - Intergenic
1112853008 13:103730048-103730070 TTCATACAGTTTAAAAGCTTAGG + Intergenic
1113729672 13:112631952-112631974 CTCCTCCAGTTAAAAGGCGAGGG - Intergenic
1113750840 13:112775527-112775549 CTCCTTCTTTTTAAAAACTCTGG - Intronic
1118040744 14:61913819-61913841 CTCATTCAGTTTAAAAGCCTGGG + Intergenic
1119570686 14:75668616-75668638 TTCCTCCAGTATAAAACCACAGG - Intronic
1121926208 14:97929685-97929707 CTCTTCTAGTGTATAAGCTCAGG - Intronic
1124451218 15:29793102-29793124 CTTCTCCTGTTTAATTGCTCTGG + Intronic
1129890837 15:79070860-79070882 CTACTCCATTTTAGAAGTTCAGG + Intronic
1130952680 15:88604984-88605006 CTCCTCCAGGTCAAGGGCTCGGG + Intergenic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1135498606 16:22974507-22974529 CTTCCCCAGTTTAAAGACTCTGG - Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1138855767 16:60689472-60689494 ATCCTCCACTTTAAAAGCTGTGG + Intergenic
1141512484 16:84521614-84521636 CTCTTCCAGTAGAAAGGCTCAGG + Intronic
1142937192 17:3344704-3344726 CTCCTTCAGTTTATGAGCTTTGG + Intergenic
1143098595 17:4492042-4492064 CTCCTCAAGATTTAAAGCCCTGG + Intergenic
1143392186 17:6565990-6566012 CTCCTCCAGTTTAAGTGCAGTGG + Intergenic
1144039503 17:11396931-11396953 CCCCTCCATTTTCAATGCTCTGG + Intronic
1147129381 17:38397864-38397886 CTCCTCAAGTTTAGATGGTCAGG + Intronic
1148377396 17:47160533-47160555 ATCCTCCTATTTAAAAGCTAAGG - Intronic
1151595963 17:75078142-75078164 CTCCTCCAGTTTAACCTCTCAGG - Intergenic
1156261038 18:35445243-35445265 CTCCCCCAGTGTAAAAGGACAGG - Intronic
1159480446 18:68984258-68984280 CCCCTACAGTTTCAAAGTTCTGG + Intronic
1159558423 18:69968778-69968800 CTCATCCACTTTAAAGACTCTGG + Intergenic
1159922105 18:74235950-74235972 CTCCTCCTGCTGCAAAGCTCAGG - Intergenic
1160454191 18:78986479-78986501 CTCCTCCTGTTTCACAGCTTGGG + Intronic
1161204978 19:3036217-3036239 CTCCTCCAGCTTCCACGCTCGGG - Intronic
1161266431 19:3366722-3366744 CTCCTCCTGCTTCAAAACTCCGG - Intronic
1161925285 19:7294609-7294631 CTCCTCCAGTTTCAGACCCCCGG + Intergenic
1162891711 19:13738090-13738112 CTCCTCAACTGAAAAAGCTCAGG + Intronic
1163893641 19:20038946-20038968 CTTCTCCTGTTTAAAAACTATGG - Intronic
1164423635 19:28119922-28119944 CTCCTCCAGAAAAAAAGCTGGGG + Intergenic
1164987321 19:32658073-32658095 CTCCTTCAGTTCAAACCCTCAGG + Intronic
928946377 2:36775571-36775593 ATCCTCCAGTTCTATAGCTCTGG + Intronic
932546549 2:72716903-72716925 CTCCTATATTTTAAAAGCTTAGG + Intronic
932696955 2:73964880-73964902 TTCTTCCAGTGTAAAAGCTTGGG - Intergenic
933740302 2:85528445-85528467 CTGCTCCAACTTGAAAGCTCTGG - Intergenic
935536082 2:104296222-104296244 CCCCTAAATTTTAAAAGCTCTGG - Intergenic
937643438 2:124238986-124239008 TCCCTCCATTTTAAAAGCTTTGG + Intronic
941988046 2:171527534-171527556 TTCAGCCAGTTTAAAAGCACTGG + Intronic
943235586 2:185314374-185314396 CTCCTTCATTTGCAAAGCTCTGG - Intergenic
943861399 2:192868552-192868574 CTCCTTCAGAGTAAAAGCTAGGG + Intergenic
945125216 2:206501657-206501679 CTCCTGCTGTTTAATAGCACTGG - Intronic
946958685 2:224959895-224959917 CTCCAGCAGATGAAAAGCTCAGG - Intronic
948051714 2:234983759-234983781 CTCCACCATCTTCAAAGCTCGGG - Intronic
1173415364 20:42850312-42850334 GTCCTCAAGTTGAAAAGCACTGG + Intronic
1174945437 20:54980214-54980236 CTCCTCCAGGTTCAAAGCTCTGG - Intergenic
1178243001 21:30923908-30923930 CTCCACCAGTTTGTAAGCTTGGG + Intergenic
1182000149 22:26913505-26913527 CTTCTCAAGTTTGAACGCTCAGG + Intergenic
952195322 3:31069118-31069140 CTGCTGCAGTTGATAAGCTCTGG + Intergenic
952507024 3:34016530-34016552 CTCCTCCAGATTTAAAGATAAGG - Intergenic
953147545 3:40292343-40292365 ATACTCAATTTTAAAAGCTCTGG - Intergenic
955986783 3:64581949-64581971 CTTCTCCAGTCTCAAAGCTTTGG + Intronic
957731207 3:84139530-84139552 CTCATCCAGATGAAAACCTCTGG + Intergenic
960353473 3:116622084-116622106 CTCCTCCAGTATACTAGCTTGGG - Intronic
960613705 3:119578499-119578521 CACCTCCAGTTCCAAATCTCTGG - Intergenic
964045512 3:152320316-152320338 CTCATCCAGTTAAATTGCTCAGG + Intronic
966790184 3:183660755-183660777 CTCACCAAGTTTAAAAGATCTGG + Intronic
966866086 3:184259911-184259933 CTCATGCACTTTAAAACCTCGGG - Exonic
967519559 3:190414405-190414427 CTTCTCCAGCTTGAAATCTCTGG + Intergenic
967894004 3:194382579-194382601 CACCTGATGTTTAAAAGCTCAGG - Intergenic
969388293 4:6871461-6871483 CCTCACCAGTTTAAAAGTTCTGG + Intronic
969607120 4:8207847-8207869 ATCCTCCAGTTGAAAAGCCAGGG - Intronic
971642367 4:29151835-29151857 ATCCTGCAGCCTAAAAGCTCAGG - Intergenic
972343721 4:38175459-38175481 CTCCTCCATTTAACCAGCTCTGG - Intergenic
972699758 4:41482735-41482757 CTGCTCCATTGTAAGAGCTCAGG - Intronic
973912027 4:55591218-55591240 CTCCTGCAGATTAAAACCACTGG - Intronic
976247890 4:83021793-83021815 CTCCTCCAGTGTAAAAATTCTGG + Intergenic
976491949 4:85681033-85681055 ATTCTACAGTATAAAAGCTCAGG - Intronic
988369430 5:30346789-30346811 CACCTCCAGCATAAAACCTCAGG + Intergenic
996367122 5:122715004-122715026 CTTCTGCAGTTTGAAAGCTAAGG - Intergenic
996550533 5:124725552-124725574 CTCCTACAGTTTAGAAGCTTTGG - Intronic
996778748 5:127160566-127160588 CTCTTCCAGCCTAAGAGCTCTGG - Intergenic
1003893771 6:10587480-10587502 CTCCTCCAGGCTAAAATATCAGG - Intronic
1007620701 6:43212796-43212818 CTCCTCCTGTTTCACAGCTCAGG - Intronic
1012319969 6:97831007-97831029 ATCCTCCAGTTAAAGAGCTGGGG - Intergenic
1013160585 6:107540260-107540282 CTCCTCCATTTCAATACCTCTGG + Intronic
1016476198 6:144432143-144432165 CTCCTATAGTTTACAAGCTGTGG + Intronic
1017032707 6:150238304-150238326 CTCCACCAGTTTCTAAGATCTGG - Intronic
1019784329 7:2965234-2965256 CTGCCCCAGTGCAAAAGCTCTGG + Intronic
1019941170 7:4292403-4292425 CTCCTCCAGTGTGCATGCTCAGG + Intergenic
1020154510 7:5711543-5711565 CCACTCCAGTTACAAAGCTCTGG - Intronic
1021484405 7:21151271-21151293 CTCTTCCAGTTTTAAAGATCTGG + Intergenic
1023106587 7:36768934-36768956 CTCCTGCACTTTAAAAATTCTGG - Intergenic
1023324218 7:39035281-39035303 CCCCTCCAGAATAAAAGTTCTGG + Intronic
1023972570 7:45002115-45002137 CACCTCCAGTTTAATAACTTCGG + Intronic
1024885216 7:54133906-54133928 GTCCTTCAGATTAAATGCTCTGG - Intergenic
1027455360 7:78384663-78384685 ATCCTACTGTTTAAAATCTCTGG + Intronic
1028546409 7:92006895-92006917 CTCCTGTAGTTTCTAAGCTCCGG - Intronic
1031575939 7:123416005-123416027 CTCCTCTTGTGTAAAAGTTCTGG - Intergenic
1034061704 7:148097753-148097775 CTCCACCAGTTTGAGAGCTGTGG - Intronic
1038615490 8:29090071-29090093 CGCCTTCAGTCTAAGAGCTCTGG - Intronic
1041243419 8:55868963-55868985 GTCCTCAACTTTAAAAGCTCAGG + Intergenic
1041384561 8:57286396-57286418 CTCCTCCACTTGAAAACATCCGG - Intergenic
1042345490 8:67722638-67722660 CCCCTACAGTTTGTAAGCTCTGG - Intronic
1043451025 8:80367071-80367093 CTCCTCCAGTGTGAATGCTTGGG - Intergenic
1043687772 8:83109362-83109384 CTCCACCAGATAAAAAGCTGAGG - Intergenic
1045842707 8:106598148-106598170 CTCCACAAGTTTAAAAGGTTTGG - Intronic
1046616056 8:116478489-116478511 CTCCTCTAGTTCAAGGGCTCTGG + Intergenic
1047141235 8:122141925-122141947 CTCTTTCAGTTTAAAGGCCCTGG - Intergenic
1053668014 9:40330290-40330312 CTTCTACAGTTCTAAAGCTCTGG - Intergenic
1053917822 9:42956577-42956599 CTTCTACAGTTCTAAAGCTCTGG - Intergenic
1054379159 9:64470328-64470350 CTTCTACAGTTCTAAAGCTCTGG - Intergenic
1054516597 9:66045995-66046017 CTTCTACAGTTCTAAAGCTCTGG + Intergenic
1054964007 9:71001300-71001322 CTGATCCAGTTTATAAACTCTGG + Intronic
1057488223 9:95502992-95503014 CTCCTGCGGTTTAAAATCACAGG - Intronic
1057506225 9:95635739-95635761 CTCCTCTACTTAAAAATCTCTGG - Intergenic
1058348757 9:103996593-103996615 CTACTCCAGTTTTAATGGTCTGG - Intergenic
1059430344 9:114246200-114246222 CTCCTCCAGTTTTAATGTCCTGG - Intronic
1059704838 9:116812928-116812950 CTGCTCCTGTTTCAAAACTCAGG - Intronic
1189133447 X:38524477-38524499 CGCTGCCAGTTTAAAACCTCTGG + Intronic
1189586522 X:42467677-42467699 CTTCTTTACTTTAAAAGCTCTGG - Intergenic
1192172084 X:68862291-68862313 CTCCTTCATTTCAATAGCTCTGG + Intergenic
1193857313 X:86620223-86620245 CTTCTCCACTTTAAAAGTTATGG - Intronic
1195864590 X:109415599-109415621 CTCCTCCACTTTGAAAGATTGGG - Intronic
1197217784 X:123882700-123882722 ATCCTCCAGATTAAAACCTTGGG - Intronic
1199979403 X:152912712-152912734 CTCCTGCAGGTGAAAAGCTGAGG + Intergenic
1200873309 Y:8126104-8126126 CTCCTCCACTTTCCACGCTCTGG + Intergenic