ID: 1073513879

View in Genome Browser
Species Human (GRCh38)
Location 10:104060315-104060337
Sequence ATGTGCCAGGAGAAGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 619}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073513879 Original CRISPR ATGTGCCAGGAGAAGGGAGA GGG Intronic
900363166 1:2299663-2299685 AGGGGCCTGGGGAAGGGAGATGG + Intronic
900542901 1:3212878-3212900 CTGTGCCAGGAGCAGGGAAGAGG - Intronic
901324104 1:8356732-8356754 TTGTGCCAGCAGAGAGGAGAGGG - Intronic
902216525 1:14937663-14937685 ATGTGCCAGGAAACTGGCGAAGG - Intronic
902612252 1:17604015-17604037 TTGTGGCCGCAGAAGGGAGATGG + Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903380407 1:22892805-22892827 ATGTGGCAGGAGCAGGCAGTGGG + Intronic
903673970 1:25053003-25053025 AGGTGCCAGGAGGGAGGAGAAGG - Intergenic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
904035861 1:27558198-27558220 CTGGGCCAGGAGTAGGGAGGTGG + Intronic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904406305 1:30290717-30290739 ATGTGGCAGGAGTAGGGTGTGGG - Intergenic
904850498 1:33455602-33455624 AAGTCCCAGAAGATGGGAGAAGG - Intergenic
904871601 1:33622508-33622530 ATGTGCCCGCAGGAGGGTGAGGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905356310 1:37387494-37387516 ATGGGCCAGGAGAGGGGACAAGG - Intergenic
905734263 1:40315254-40315276 ATGTGCCAGAGGCAGGGTGAGGG + Intronic
906105470 1:43289378-43289400 ATGTGCCAGGAGTAGGGGTCAGG + Intergenic
906193591 1:43914792-43914814 CTGGGCCTGGAGAAGGGACAGGG + Intronic
906726311 1:48047078-48047100 AAATGCCAGCAGGAGGGAGAGGG - Intergenic
906779942 1:48564365-48564387 ATGGGTCAGGAGAAGGCAGCAGG - Intronic
906827184 1:48993850-48993872 TGATGCCAGGAGAAGGGGGAGGG + Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907837608 1:58125985-58126007 AGGAGCCAGGGGAAGGGAGCAGG + Intronic
909538849 1:76768469-76768491 ATTAGCCAGGTGAAGGGAGGTGG - Intergenic
909796028 1:79736879-79736901 ATGTGGCAGAAGAAATGAGAGGG - Intergenic
910312046 1:85835062-85835084 ATGGGCCAGGAGAAGAGCTAGGG - Intronic
911101944 1:94102253-94102275 ATGTGCCAGGGGATAGAAGAAGG + Intronic
911337315 1:96596357-96596379 ATGTGGCTGGAAAAGGGGGAAGG - Intergenic
911434831 1:97844420-97844442 CTATCCTAGGAGAAGGGAGAGGG + Intronic
911601034 1:99848735-99848757 ATGGGGCAGGAGAAGGGATCAGG - Intergenic
911897644 1:103457974-103457996 ATTTCACAGGTGAAGGGAGAGGG - Intergenic
912177956 1:107183904-107183926 TTGTGGCAGGAAAAGGGAGGGGG - Intronic
912685779 1:111762991-111763013 ATGTACCTGGTAAAGGGAGAAGG - Exonic
912689027 1:111789934-111789956 AAGTGCCAGAAGACTGGAGATGG - Intronic
913027192 1:114855176-114855198 ATGGGACAGGAGAAGGGAACGGG + Intronic
913514399 1:119590868-119590890 ATGTGGCAGAAGAATGGAAAGGG + Intergenic
913566592 1:120078788-120078810 ATGGTCCTGGAGAAGGCAGAAGG - Intergenic
913631539 1:120714756-120714778 ATGGTCCTGGAGAAGGCAGAAGG + Intergenic
914287350 1:146239500-146239522 ATGGTCCTGGAGAAGGCAGAAGG - Intergenic
914548382 1:148690242-148690264 ATGGTCCTGGAGAAGGCAGAAGG - Intergenic
914618298 1:149381465-149381487 ATGGTCCTGGAGAAGGCAGAAGG + Intergenic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
914973119 1:152329507-152329529 ATTTGCCAGGACAATGGTGATGG + Intergenic
915203011 1:154247344-154247366 AGGTGGGAGGAGAAGGGAAATGG + Intronic
915254539 1:154616346-154616368 ATGGTCCAACAGAAGGGAGAAGG - Intronic
915734786 1:158077894-158077916 GTGTCCCAGGAGAGGGCAGAGGG + Intronic
915932851 1:160070523-160070545 GGGTGACAGGGGAAGGGAGAAGG + Intergenic
916326944 1:163572689-163572711 ATGTGACAGGAGAAGAGACTTGG + Intergenic
916826531 1:168447184-168447206 ATGTACCAGAAGGAGGTAGAAGG + Intergenic
917637527 1:176951312-176951334 ATGTGCCACCAGAAGGGAGCTGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918234205 1:182562566-182562588 AGGTCCCAGCAGAAGAGAGATGG + Intergenic
918713681 1:187763261-187763283 GTTTGCCAGGAGAAGTGAGAGGG + Intergenic
918965749 1:191345070-191345092 ATGTGAGAGGAAAAGGGGGAGGG - Intergenic
920021730 1:202961559-202961581 ATAGGCCAAGAGAAGGAAGAAGG + Intergenic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920245647 1:204585663-204585685 AGGGGCCTGGAGGAGGGAGAAGG - Intergenic
920784752 1:209030442-209030464 ATGTGCCAGGAGAGGCATGAGGG - Intergenic
920923201 1:210315527-210315549 GTGTGGCGGCAGAAGGGAGAAGG - Intergenic
921550320 1:216527502-216527524 ATATGGCAGGAAAAGGGAAAAGG - Intronic
921761999 1:218925799-218925821 ATTTGCCAGGAGAGGGGAAAAGG - Intergenic
921800714 1:219399416-219399438 AGTTGCCAGGATAAGGGGGATGG + Intergenic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
922187926 1:223292882-223292904 AAGTTACAGGAGGAGGGAGAAGG + Intronic
922908244 1:229192929-229192951 TTGTGTCAGGAGTAGGGAAAAGG - Intergenic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
924860397 1:247914881-247914903 AATTGCTAGGAGATGGGAGATGG + Intergenic
1063313937 10:4983697-4983719 ATATGCCAGGGAAAAGGAGATGG + Intronic
1063374985 10:5548884-5548906 ATGTGTGTGGATAAGGGAGAGGG - Intergenic
1064388406 10:14920400-14920422 ATCTGCCAGGAGGAGGCAGTTGG - Intronic
1064674564 10:17748266-17748288 ATGTGGCTGAAGAAGGGAGATGG + Intergenic
1065464197 10:26001657-26001679 TTGTGTCAGGAGAAAAGAGAGGG - Intronic
1065679826 10:28217684-28217706 ATGAGGCAGGGGAAGGGAAAAGG + Intronic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1066023395 10:31325648-31325670 ATGGGGGAGGGGAAGGGAGAGGG - Intronic
1066285118 10:33958438-33958460 ATGTGCCTGGCGAGGGCAGAGGG + Intergenic
1066467988 10:35670316-35670338 CTGTGCCAGGAGCAAGGAGGAGG + Intergenic
1067039263 10:42940303-42940325 GAGTCCAAGGAGAAGGGAGATGG - Intergenic
1067346645 10:45442945-45442967 ATGTGCCAGGGGAGGCGAGGAGG - Intronic
1067746580 10:48940812-48940834 AGGTTTCAGGTGAAGGGAGAGGG + Intronic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1067925718 10:50506060-50506082 GTATTCCAGGACAAGGGAGATGG - Intronic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068489592 10:57706351-57706373 ATGTTCAAGGAAAAGGGAGGAGG + Intergenic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1068971079 10:62959135-62959157 AAGTGCCAGGAGAAGGATGATGG - Intergenic
1069187130 10:65438123-65438145 ATATGCCTGGATAAGGGAGAGGG - Intergenic
1069290520 10:66773383-66773405 AGTTGCCAAGAAAAGGGAGACGG - Intronic
1070697751 10:78575271-78575293 AGGTGCCAGGAGGAGGTAGAAGG + Intergenic
1070784184 10:79153671-79153693 ATGGGTCATGAGGAGGGAGAAGG - Intronic
1071074333 10:81732877-81732899 ATGGGGTAGGAGAAGGGAGATGG - Intergenic
1071482045 10:86071969-86071991 AGATGCCAAGAGAGGGGAGAAGG + Intronic
1072051771 10:91711699-91711721 TTCTGCCAGGAAAGGGGAGATGG + Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072100705 10:92226817-92226839 AGGGGCCAGGAGCTGGGAGAAGG + Intronic
1072676588 10:97470856-97470878 AGGTGGCTGGAAAAGGGAGAAGG + Exonic
1072932084 10:99674124-99674146 ATGTCCAAGGAGACAGGAGAGGG + Intronic
1073050448 10:100663612-100663634 ATGTGCCAAAAGCAGGGAGTGGG + Intergenic
1073458170 10:103650222-103650244 AGGTGCCAGGTGAGGGGAGGAGG - Intronic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1074837296 10:117309517-117309539 ATGAGCTATGAGGAGGGAGAAGG - Intronic
1075115811 10:119626497-119626519 AACTGGCAGGAGAAGAGAGAAGG - Intergenic
1075475285 10:122728814-122728836 AGGTGCCAGGTGACAGGAGAGGG + Intergenic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075698793 10:124455071-124455093 ATGGGCAAGGAAAATGGAGACGG + Intergenic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1076939500 10:133592128-133592150 CTGTGCCAGGAACATGGAGAAGG - Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077197337 11:1288064-1288086 AGGTGCCCTGAGAATGGAGATGG + Intronic
1077204475 11:1336079-1336101 ATGTTCCCGGAGAAAGGAGTGGG + Intergenic
1077811911 11:5646732-5646754 CTGTTCCCTGAGAAGGGAGAGGG + Intergenic
1077906480 11:6538624-6538646 ATGGCCCAGGAGAAGACAGAGGG + Exonic
1078143220 11:8706500-8706522 ATGAAGCAGGAGGAGGGAGATGG - Intronic
1078501223 11:11879568-11879590 ATGAGCCAGGAGGAGGGGGAAGG - Intronic
1078673659 11:13389030-13389052 ATGTCCTGGGAGAAGGAAGAAGG - Exonic
1078741574 11:14071568-14071590 ATGTTCTAGGAGAAGGAACAGGG - Intronic
1080763670 11:35276472-35276494 GTGTGTCAGCAGAAGGGAGTTGG - Intronic
1081585403 11:44380526-44380548 CTGTGCAAGGTAAAGGGAGAGGG + Intergenic
1081701746 11:45156842-45156864 GTTTGCCAGGCGGAGGGAGAGGG + Intronic
1081792914 11:45801636-45801658 ATGTGCCAGGTGAAGACAGAAGG + Intergenic
1082241272 11:49873742-49873764 AAGTTCCTGGAGAAGGTAGAAGG + Intergenic
1083603393 11:63962367-63962389 ATGTGCCAGGAGGAGAGACCAGG + Intergenic
1083820947 11:65171109-65171131 GGGTGCCAGGAGGAGGGTGAGGG + Intronic
1085274629 11:75290400-75290422 ATGTGGCTGGAGATGGGTGAGGG - Intronic
1085326849 11:75612853-75612875 ATGGGCCAGGAGCTGAGAGATGG - Intronic
1085462463 11:76702328-76702350 ATGGGCCAGGAGTGGGGAGTTGG - Intergenic
1086045205 11:82524435-82524457 CTGTACCAGGAGAAGAGAAATGG + Intergenic
1086127127 11:83360430-83360452 ATGTGATAGCAGAAAGGAGAAGG - Intergenic
1086452581 11:86931881-86931903 ATAATCCAGGAGAAGGGTGACGG + Intronic
1086695950 11:89845580-89845602 AAGTTCCTGGAGAAGGTAGAAGG - Intergenic
1086710205 11:89998903-89998925 AAGTTCCTGGAGAAGGTAGAAGG + Intergenic
1087199159 11:95328378-95328400 ATGTGGCAGGATGAGGGAGTAGG - Intergenic
1087263743 11:96039390-96039412 AGGAGACAGGAGAGGGGAGAGGG + Intronic
1087304390 11:96472176-96472198 AAGTGACAGGATAAAGGAGAAGG + Intronic
1087350145 11:97020631-97020653 TTTTGCCTGTAGAAGGGAGAGGG + Intergenic
1087685360 11:101256569-101256591 TGTTGCCAGGAGAAGGGAGAAGG + Intergenic
1087917766 11:103830743-103830765 ATGTCACAGCAGAAGGCAGAAGG - Intergenic
1088051238 11:105517851-105517873 GTTTGCCAGGTGAAGGGGGAAGG + Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088398603 11:109397517-109397539 ATGGGCCAGTGGAAGGGAAATGG + Intergenic
1088544516 11:110946146-110946168 ATGTTCCAAGTGAAGAGAGATGG - Intergenic
1088544614 11:110947004-110947026 ATGTGCCAGGCAAAGTGTGAGGG - Intergenic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1089059321 11:115613345-115613367 GTGTGCCAGGAAAAGTGAGAAGG - Intergenic
1089339562 11:117748404-117748426 AAGTGCCATCAGAAGGGAGAGGG - Intronic
1089690293 11:120182902-120182924 ATGTGGCAGGAGGAGGGAGAAGG + Intronic
1089711650 11:120319161-120319183 TGCTGCCAGGAGAAAGGAGAGGG - Exonic
1090490598 11:127157338-127157360 GTCAGCCAGGAGAAGGCAGAAGG + Intergenic
1090672293 11:128957206-128957228 AGGTGCCAAGAGGAGCGAGAGGG + Intergenic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091656679 12:2351390-2351412 AGAGGCCAGGTGAAGGGAGATGG - Intronic
1091718191 12:2794741-2794763 GGGTCCCAGGAGAAGGGGGAGGG + Intergenic
1091736229 12:2924308-2924330 ATGAGCCAGGAGAGGGAAGTGGG + Intronic
1092119749 12:6035582-6035604 ATGGCCAAGGAAAAGGGAGAAGG + Intronic
1092209716 12:6638446-6638468 AGGTGCCAGGAGTGGGGAGGAGG + Intronic
1092347730 12:7729857-7729879 ACGTGGCAGCAGAAGTGAGAAGG - Intronic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1092599603 12:10045094-10045116 ATGGGACAGGAGACAGGAGATGG - Intronic
1093539539 12:20265073-20265095 ATATGCCAGGGCATGGGAGAAGG - Intergenic
1094267324 12:28573948-28573970 ATGGGACAGGAGAAGGAAAATGG + Intronic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1095990328 12:48029925-48029947 AGGGGCCAGGGCAAGGGAGAGGG + Intergenic
1096099580 12:48961523-48961545 ATGTGCTAGGAGCAGGGATAGGG + Intergenic
1096675703 12:53224714-53224736 AAGTGGCAGGAGGAGGGAGGAGG - Intronic
1098388765 12:69946946-69946968 ACTTGCCAGGAGGAGGCAGAAGG - Intronic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1098859824 12:75695758-75695780 ATGAGCAAGGAGAAAGGAGAAGG + Intergenic
1099672462 12:85712113-85712135 GTGTGCCAGGAACAGGGAGAAGG - Intergenic
1099907440 12:88789444-88789466 ATGAGACAGGACTAGGGAGATGG + Intergenic
1100397640 12:94198797-94198819 ATTTTCTAGGAGAAAGGAGAGGG - Intronic
1100731773 12:97479021-97479043 AGGGACCAGGACAAGGGAGAGGG - Intergenic
1101042567 12:100771612-100771634 AGGGGCTAGGAGAAGGGAGAGGG + Intronic
1102180118 12:110906267-110906289 ATGTGAGAGGGGGAGGGAGAGGG + Intronic
1102507868 12:113395243-113395265 ATGCTCCTGGGGAAGGGAGAGGG - Intronic
1104953806 12:132454195-132454217 ATGGGCCAGAAGAAGAGAGATGG + Intergenic
1104955928 12:132465817-132465839 ATGTGCAGGGTGAAGGCAGACGG + Intergenic
1105468631 13:20671380-20671402 AAGTGCCACGAGAAGGAGGATGG + Intronic
1106109631 13:26765661-26765683 AGATGCTAGGAGAAGAGAGAGGG - Intergenic
1106144310 13:27037926-27037948 ATCTCCGAAGAGAAGGGAGAGGG + Intergenic
1106718472 13:32415947-32415969 ATGTGCCAGAGGTAGGGAAATGG - Intronic
1106838897 13:33665533-33665555 AACTGGCAGGAGAAGGGAGCTGG - Intergenic
1107504410 13:41017589-41017611 AGTTTCAAGGAGAAGGGAGAAGG - Intronic
1108314678 13:49225456-49225478 TTCTGCCTGCAGAAGGGAGAGGG - Intergenic
1108570139 13:51741498-51741520 AGCTGCCAGAAGTAGGGAGATGG + Intronic
1109396600 13:61766662-61766684 AGGTGCCAGGAGCCAGGAGAAGG + Intergenic
1109759223 13:66805052-66805074 ATCTGCCAAGATAAGGGAGGTGG - Intronic
1110168070 13:72467946-72467968 CTTTGCCAGGAAAAGAGAGAAGG + Intergenic
1110397641 13:75049973-75049995 ATGTGCCAGTGGAAGGAAAAGGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112886023 13:104172967-104172989 TTTTGCCTGGAGGAGGGAGATGG - Intergenic
1114189543 14:20430064-20430086 ATGTTCCAGGCCAAGAGAGACGG - Exonic
1114330820 14:21635106-21635128 ATTTGCCAGATGAAGGAAGAGGG + Intergenic
1114891192 14:26925857-26925879 AGGTGCCGGGAGAAGTGAGCTGG - Intergenic
1117030201 14:51660927-51660949 GTGTTCCAGGAGCAGGGAGAAGG + Intronic
1117296614 14:54386250-54386272 GTGTACCAGGAGAAAGGCGAGGG - Intergenic
1117982383 14:61354668-61354690 ATTCGTCAGGTGAAGGGAGAGGG - Intronic
1118466333 14:66034508-66034530 ATGTGGGAGGAATAGGGAGATGG + Intergenic
1118727338 14:68638491-68638513 ATGTGCTGGGAGGAGGGAGATGG + Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1118837147 14:69485280-69485302 CTGGGCCGGGAGAATGGAGATGG + Intronic
1119226126 14:72945867-72945889 ATCTGCCTGGAGAAGGGAAGGGG - Exonic
1119641051 14:76315203-76315225 AAGCCCCAGGAAAAGGGAGAAGG - Intronic
1119790165 14:77342906-77342928 ATGGGGCAGGAGCAGAGAGAGGG - Intronic
1119792398 14:77364060-77364082 ATGTGCCAGGTGTGGGGAAACGG - Intronic
1120429926 14:84400944-84400966 ATGTGTCAGGGGTAGGGAGCAGG + Intergenic
1121064238 14:90946385-90946407 ACCTGCCAGGTGAAGGGAGATGG - Intronic
1121468173 14:94129301-94129323 GAGTGCCAGGGGAAGGCAGAGGG + Intronic
1121740125 14:96246064-96246086 ATGAGCCTGGAGCAGAGAGAGGG - Intronic
1121786905 14:96668833-96668855 ATGTGGCAAGTGAAGAGAGATGG + Intergenic
1121863378 14:97339957-97339979 ATGAGCCAAGGGAAAGGAGAAGG - Intergenic
1122234369 14:100323563-100323585 ATCTGCCAGGAGCAGAGAGCAGG + Intronic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122428315 14:101624287-101624309 ATGTGCCTGGGGATGGGAGGGGG - Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1123128612 14:105967974-105967996 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123409145 15:20044139-20044161 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123518476 15:21050847-21050869 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123879844 15:24667163-24667185 ATGATACACGAGAAGGGAGATGG + Intergenic
1124145319 15:27119809-27119831 ATGTGCCAAGGAAATGGAGATGG - Intronic
1124866234 15:33494314-33494336 ATGTGCAAGGAAATTGGAGAAGG - Intronic
1125372727 15:38995719-38995741 AAGAGACAGGAGAAGGGACAGGG - Intergenic
1126104354 15:45137898-45137920 AAATGCAAGGAGCAGGGAGATGG - Intronic
1126110983 15:45174599-45174621 AAGAGCCTGGAGTAGGGAGAGGG - Intronic
1126599263 15:50412728-50412750 ACTTGGGAGGAGAAGGGAGAGGG - Intergenic
1126694937 15:51317853-51317875 AAGTGTCAGGAGAATTGAGATGG - Intronic
1126795672 15:52258908-52258930 ATGTGCAAGGAGTAGTGAGCTGG - Intronic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127703612 15:61526052-61526074 ATGTGCCAGGGGAAAGGAAAGGG - Intergenic
1127793933 15:62422638-62422660 GAGTGCCAGGAGATGGGATAAGG - Intronic
1127961128 15:63891793-63891815 AGGGGCAAGGAGGAGGGAGAGGG - Intergenic
1128865874 15:71115173-71115195 AAGTGAGAGGAAAAGGGAGAGGG - Exonic
1129024753 15:72560277-72560299 AGGTGCCATGAGAACTGAGAGGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129076081 15:72997229-72997251 ATGTCCCAAGGGAGGGGAGATGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130133767 15:81164683-81164705 ATTTGGCAGGATCAGGGAGATGG - Intronic
1130889118 15:88118362-88118384 ATGTTCCATGAGAAGAGAGGAGG + Intronic
1131512587 15:93057422-93057444 ACGTGGCAGAAGGAGGGAGAGGG - Intronic
1131840060 15:96427667-96427689 ATGGGCCATGTGAAGGCAGAGGG + Intergenic
1132209671 15:100010622-100010644 ATCTGCCAGGAGCTGTGAGAGGG - Intronic
1132699689 16:1217021-1217043 GTGTGCCAGGAGGAGGGCGCAGG - Intronic
1132942989 16:2517517-2517539 ATGCTCCAGGAGAGCGGAGAAGG - Intronic
1133312693 16:4860515-4860537 ATATGCCAAGAGGAGGGAGGAGG + Intronic
1133767918 16:8850582-8850604 AGGGGCCAGGAGAAGGCAGTTGG + Intergenic
1133805953 16:9126113-9126135 ATGAGCCAGAATAAGGGGGATGG - Intergenic
1133918472 16:10130719-10130741 AAGTTGCAGGAGAAGCGAGAAGG - Intronic
1134906136 16:17981393-17981415 ATGTTCCATGAGATGGAAGATGG + Intergenic
1135041753 16:19122788-19122810 ATTAGCCAGGTGAAGGGAGTTGG + Intronic
1135125388 16:19805204-19805226 ATGGCCCAGGTGAAGAGAGATGG + Intronic
1135527308 16:23223677-23223699 ATGTTCCTGGAGGAGGGCGAAGG - Intergenic
1135974540 16:27099312-27099334 ATTTGCCAGGTGAAGGAAGTAGG + Intergenic
1136114113 16:28083875-28083897 CTGCGCCAGGAGAATGGAGAAGG + Intergenic
1136871659 16:33812896-33812918 CTGTGCCAGGTGGAGGGAGCAGG + Intergenic
1137027011 16:35486518-35486540 ATGGGCCAGAAGAGGGGAAAGGG - Intergenic
1137474349 16:48794087-48794109 AGGTGCCAGAAGATAGGAGAGGG - Intergenic
1137773803 16:51039657-51039679 GTGTGTCAGGAGAAGGCCGAGGG + Intergenic
1138297968 16:55902832-55902854 ATGTGCCTGGAGAAGGATGTGGG + Intronic
1138957537 16:61989540-61989562 ATGTTCCAGGAGACTTGAGATGG - Intronic
1139339655 16:66259676-66259698 CTGTGCCAGCAGAGGCGAGAGGG + Intergenic
1139430396 16:66908034-66908056 ATGTGGCAGGAGATGGGGAAGGG + Intergenic
1139662500 16:68430625-68430647 ATGGGGCAGGGGGAGGGAGAAGG - Intronic
1140211058 16:72970632-72970654 AAGTGCCAGAAGATGGGTGAAGG - Intronic
1140885136 16:79236329-79236351 ATGAGCCTGGAGGAGGGAGAGGG - Intergenic
1141162481 16:81638605-81638627 TTCTCCAAGGAGAAGGGAGAGGG - Intronic
1141389962 16:83656293-83656315 CTTTGCCAAGAAAAGGGAGAAGG + Intronic
1141590017 16:85062183-85062205 ACGTACCAGGGGCAGGGAGAGGG - Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1203100513 16_KI270728v1_random:1303162-1303184 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1143279260 17:5739065-5739087 ATGTGACACAAGAAGGCAGAGGG + Intergenic
1143391431 17:6561291-6561313 AAGAGGCAGAAGAAGGGAGAAGG - Intergenic
1143622081 17:8086481-8086503 AGGTGCCTGGAGAGGGGAGTGGG - Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1143966190 17:10757929-10757951 ATGGGCCAGGAGATAGGAGGAGG - Intergenic
1143989479 17:10944514-10944536 TTGTGACAGGAGCAGTGAGAGGG + Intergenic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144386960 17:14756887-14756909 ATGTGCTAGGAAGAGAGAGAGGG + Intergenic
1144620695 17:16816673-16816695 GTGAGCCAGGAGAAGGAAAAAGG + Intergenic
1144884947 17:18451474-18451496 GTGAGCCAGGAGAAGGAAAAAGG - Intergenic
1145101563 17:20081600-20081622 ATTAGCCAGGTGGAGGGAGAGGG + Intronic
1145147274 17:20492903-20492925 GTGAGCCAGGAGAAGGAAAAAGG + Intergenic
1145773479 17:27510042-27510064 AAGTGCCAAGAGGAGGGACAAGG - Intronic
1145921710 17:28614662-28614684 CTGTGCCAGGAAACGGGAGGGGG - Exonic
1146317330 17:31818363-31818385 CTGTGCCAGGTGAATGGAGGGGG + Intergenic
1146520457 17:33521900-33521922 AGGTGCCAGGTGATGGGGGAAGG - Intronic
1147194944 17:38760258-38760280 AGCTGGCAGGAGAAGGGAGAGGG + Intronic
1147199442 17:38790329-38790351 ATATGCCAGGAAAAAGGAAATGG - Intronic
1147251096 17:39152688-39152710 ATTTTCCAGGAGGAGGGATATGG + Intronic
1147894897 17:43744119-43744141 AGAGGCCAGGACAAGGGAGACGG + Intergenic
1148096304 17:45054737-45054759 ATGTGTCAGGAGTAGGGAAAAGG - Intronic
1149470071 17:56909208-56909230 AAGGTCCAGGAGAAGGGGGAAGG + Intronic
1149553847 17:57559340-57559362 ATGAGACAGGAGAGGAGAGAGGG - Intronic
1149659986 17:58329243-58329265 ATCTGCCAGGAGGAAGCAGAAGG - Intergenic
1150510813 17:65751051-65751073 AGGGGCAAGGAAAAGGGAGAGGG + Intronic
1150596968 17:66614948-66614970 ATGTGAAAGGAGTAGGGAGGGGG + Intronic
1151231959 17:72691214-72691236 ATGTGCAGGGAGAAGGGACTTGG + Intronic
1151495396 17:74455215-74455237 ATGGGCCTGGTGAAGGGACAGGG - Intergenic
1151647178 17:75441246-75441268 ATGTGGCAGGAAAAGAGAGAAGG + Intronic
1152007864 17:77693871-77693893 AGGTGCCTGGAGAAGGAGGAGGG + Intergenic
1152268846 17:79312000-79312022 AAGGGGGAGGAGAAGGGAGAGGG - Intronic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1153344501 18:4011270-4011292 AAGTGCCACCGGAAGGGAGAGGG + Intronic
1154207048 18:12346314-12346336 GTGTGCCAGGTGGAGTGAGATGG - Intronic
1155009639 18:21764122-21764144 ATGTGACAGGAGACTGCAGAAGG + Intronic
1156013842 18:32525744-32525766 CTGTAACAGGAGAAAGGAGATGG - Intergenic
1156229383 18:35139101-35139123 ATGCTGCAGGAGAAGAGAGAAGG + Intronic
1156310699 18:35919192-35919214 ATGTTAGAGGAGAGGGGAGAGGG + Intergenic
1156315696 18:35966918-35966940 ATGTGGCAAGAGCAGTGAGACGG + Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157079386 18:44506361-44506383 GTGTGTCAGAAGAAGGGAAAAGG - Intergenic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157315171 18:46580874-46580896 ATGTTCCAGGAGCAGAGAGAAGG + Intronic
1158750064 18:60248258-60248280 ATGAGCCAGAAGAAGGAAGAAGG - Intergenic
1159116122 18:64114970-64114992 GGGTGGGAGGAGAAGGGAGAAGG - Intergenic
1159192064 18:65059334-65059356 ATGTGCAAAGAGAGGGGATAGGG + Intergenic
1159613126 18:70548248-70548270 ATGTGCCATGGGCAGGGAGAAGG + Intergenic
1159670429 18:71214634-71214656 AGGTGGCAGGTGAGGGGAGAGGG + Intergenic
1159692226 18:71503578-71503600 ATGTGTTAGGTGGAGGGAGATGG - Intergenic
1160148971 18:76385048-76385070 ACGTGCCAGGAGGAGGCAGCCGG + Intronic
1160267933 18:77356647-77356669 ATGTGCAAGGAAAATGGAGCAGG - Intergenic
1160670960 19:363035-363057 AGGTGCCAGGGGCTGGGAGACGG + Intronic
1162083546 19:8234511-8234533 GGGTGCCAGGGGAAGGGAAATGG - Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1163015397 19:14451298-14451320 CTGGGCCAGGTGAAGAGAGATGG - Intronic
1163102872 19:15108315-15108337 ATGTTCCCAGGGAAGGGAGAAGG + Intronic
1164445261 19:28312092-28312114 ATGTGGCAAGAGAATGGAGTAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1166068567 19:40374655-40374677 GTTGGCCAGGAGACGGGAGAGGG + Intronic
1166365810 19:42277994-42278016 ATGGGCCAGCAGAAGGGACCAGG - Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166544048 19:43623533-43623555 ACATGCCAGGCGAAGGAAGAGGG + Intronic
1166753329 19:45175631-45175653 ATGGGCTGGGAGAAGGGAGCAGG + Intronic
1166881591 19:45933650-45933672 AGGTGCAGGGAGGAGGGAGAGGG + Intergenic
1167729494 19:51243132-51243154 GGGAGCCAGGAGAAGGGAGGAGG - Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
925127899 2:1474768-1474790 ATTTGCCATGAGAAAGGAGCAGG - Intronic
925297089 2:2784489-2784511 ATGGGGCAGGAGCAGGCAGAAGG + Intergenic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
925836681 2:7953251-7953273 ATGAGCCAACAGCAGGGAGAGGG + Intergenic
925864983 2:8219700-8219722 CCGTGCCAGGAGGAGGGACATGG - Intergenic
925969994 2:9099601-9099623 ATGTGACAGGAGAACGGTGTAGG - Intergenic
926175974 2:10592480-10592502 ATGTCTCAGGAGAAGGGAGGGGG + Intronic
926499902 2:13641215-13641237 ATCTGCCAGGGGAGGGCAGAGGG + Intergenic
926689800 2:15725408-15725430 ATGAGCCAGGAGACGGAGGAAGG - Intronic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
927955812 2:27206648-27206670 ATTTGAGAGGAGAAGGAAGAGGG - Intronic
927996932 2:27493472-27493494 ATGTCACCTGAGAAGGGAGAAGG + Exonic
928197247 2:29224802-29224824 ATCTGCCGGTAGAAGGGAGATGG - Intronic
929342045 2:40831747-40831769 ATGGGCCAAGAGAAGAGAGTAGG + Intergenic
929525184 2:42694621-42694643 CTCTGCCAGGGGATGGGAGAGGG + Intronic
929930661 2:46253256-46253278 CTATGCCTGGAGAAGAGAGAGGG + Intergenic
930176852 2:48309861-48309883 ATATGTCAGGAGAAGGTAAATGG - Intergenic
930755333 2:54967372-54967394 ATTGGCCAAGAGACGGGAGATGG - Intronic
930928700 2:56853557-56853579 TGGTGCCTGGGGAAGGGAGAGGG - Intergenic
931014482 2:57960672-57960694 ATGAGCCAGCAGAAAGGAGATGG - Intronic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
933231069 2:79808256-79808278 ATGAAAGAGGAGAAGGGAGAAGG + Intronic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933741194 2:85535559-85535581 ATGTGGCAGGAGAAAAGAGGAGG - Intergenic
933980978 2:87550514-87550536 AAGCTTCAGGAGAAGGGAGAAGG - Intergenic
934104227 2:88681285-88681307 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
935062639 2:99621804-99621826 ATTTGCTAGGAAAAGAGAGAAGG + Intronic
935856802 2:107283251-107283273 AGTTGCCAGGAGAAGGAAGTTGG - Intergenic
936312853 2:111400271-111400293 AAGCTTCAGGAGAAGGGAGAAGG + Intergenic
936560925 2:113539259-113539281 AGGTGCTAGGAGCAGAGAGATGG + Intergenic
937195143 2:120147732-120147754 GTTTGCCAGGAGAAGGGTAATGG + Intronic
937814416 2:126235501-126235523 ATGTGTCAGGGCAAGGGAGTTGG + Intergenic
938539743 2:132276073-132276095 ATGTGACAGGAGAAGTGTCAAGG + Intergenic
938935258 2:136121916-136121938 AGGTGCCAGGAGGAGGTGGATGG + Intergenic
939647245 2:144715810-144715832 ATGTTCCAGGAGAAGAGTGAGGG - Intergenic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
940128448 2:150354364-150354386 TTCTGACACGAGAAGGGAGAGGG + Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
941624432 2:167815130-167815152 ATGTGAGAGGAGAAAGAAGAAGG - Intergenic
942558291 2:177194762-177194784 ATGTGCTAAGAGAAAGGAAAAGG + Intergenic
942899401 2:181096072-181096094 AGGAGAGAGGAGAAGGGAGAGGG - Intergenic
943007922 2:182409144-182409166 ATGTAAAAGGAGAAGGGAGGAGG - Intronic
943707605 2:191051765-191051787 AGGGGCCAGGAGCAGGGACACGG + Intronic
944045861 2:195411214-195411236 ATGTGCCAGGAGGAGAGGAAGGG + Intergenic
944488433 2:200232187-200232209 AGGTGCCAGCATAAGGCAGAGGG - Intergenic
945568078 2:211429288-211429310 ATATGAGAGGAGAAGGGAGGGGG - Intronic
945770473 2:214035607-214035629 GTGCGCCAGGAGCAGGGAGAGGG + Intronic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
946356446 2:219188562-219188584 ATTTGCCAAGTGAAGGGATAGGG - Intergenic
946374474 2:219299781-219299803 AGGGGCCTGGAGATGGGAGAAGG + Exonic
946526322 2:220524609-220524631 ATATGGCAAGAGAAGGGAGGAGG + Intergenic
946688074 2:222291322-222291344 ATAGCCCAGGAGAAAGGAGAGGG - Intronic
947709838 2:232306749-232306771 ATGTGCCAGTGGAAGGGACTGGG + Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947955156 2:234183390-234183412 ATATTCCAGTAGAAAGGAGAAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948189607 2:236047431-236047453 AGGTGGCACGAGAAGGAAGAGGG - Intronic
948394454 2:237633868-237633890 ATGTGCCAGGGATAGGAAGAAGG - Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948928885 2:241117506-241117528 GAGTGTCAGGAGGAGGGAGAAGG + Intronic
948946864 2:241224861-241224883 AGGGGCCAGGAGCTGGGAGAGGG - Exonic
1168797705 20:622538-622560 GTGTGGCTGGAGAAGGGAGAGGG - Intergenic
1169233778 20:3912127-3912149 ATGTACTTGGAGAAGGGAAAGGG + Intronic
1170136106 20:13075288-13075310 ATGTGTCACTAGGAGGGAGAAGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170816353 20:19717704-19717726 AAGAGCCAGGAGATGGGACAAGG - Intronic
1170989211 20:21286838-21286860 AGGGGCCAGGAGAAGGGGCAAGG - Intergenic
1172783594 20:37451602-37451624 ATGGGCCAGGAGAAATGAGGAGG - Intergenic
1173216368 20:41088556-41088578 AAGTCCCAGGATAAGGGAAAGGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173414603 20:42844679-42844701 GTGAGTCAGGAGAGGGGAGAGGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1174416965 20:50373850-50373872 GTGTTCCAGGAGCAGGGAGGAGG + Intergenic
1174431866 20:50476004-50476026 ATGAGTCAGCACAAGGGAGATGG + Intergenic
1174672205 20:52318773-52318795 AGGAGCCAGGAGAAGGGAAAAGG + Intergenic
1174918503 20:54677683-54677705 AAGTGCCAGGATCAGGGACATGG - Intergenic
1175963185 20:62647364-62647386 AGGTGCCAGGAGGAGGGACTCGG + Intronic
1176286874 21:5023053-5023075 ATTTCCTAGAAGAAGGGAGAAGG + Intronic
1176965555 21:15208313-15208335 ACGTGCCATGGGAAGGAAGAAGG - Intergenic
1177117729 21:17105665-17105687 ATGTGCCAGTAGGAGGTAGCTGG - Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1178354714 21:31900973-31900995 AAGTGCCAGAAGCTGGGAGAGGG - Intronic
1178804698 21:35829274-35829296 ACGTGCCAGGACCAGTGAGAGGG + Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179137554 21:38693534-38693556 ATGTGCCAGGCAAAGGTAGCAGG - Intergenic
1179870307 21:44240422-44240444 ATTTCCTAGAAGAAGGGAGAAGG - Intronic
1180635360 22:17259107-17259129 GTGTGCCAGGAGCTGGGTGATGG + Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181474733 22:23161201-23161223 ATGTGTCAGGAGAACAGGGAGGG - Intronic
1181648700 22:24247311-24247333 CTGTGCCTGGAGGAGGGAGCAGG + Intergenic
1181739445 22:24909025-24909047 ATATGACAGGAGGAGGGAGGTGG - Intronic
1182356094 22:29722800-29722822 ATGTGCCAGGAAGAGGGAGCTGG + Intronic
1182757777 22:32694284-32694306 ATGTGGCAGGGGAAGGGATATGG - Intronic
1183101818 22:35588808-35588830 AAGGGCCAGGAGAAGGAATAGGG + Intergenic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183387826 22:37525235-37525257 CTGTGCCAGGAGGTGAGAGATGG + Intergenic
1184579488 22:45404991-45405013 ATGTGCTAGTACAAGGGAGGGGG + Intronic
1184673241 22:46026800-46026822 ATGTGCAAAGAGAAAGGACAGGG - Intergenic
1184776361 22:46625480-46625502 CTGGGCCAGGAGCAAGGAGATGG - Intronic
949365562 3:3276758-3276780 ATGTGTTTGGAGGAGGGAGAGGG - Intergenic
949540012 3:5025595-5025617 GCGTGCCAGGTGAAGAGAGACGG - Intergenic
949673691 3:6428110-6428132 GGGTGACAGGAGATGGGAGAAGG + Intergenic
950120082 3:10475972-10475994 ATCAGCCAGGTGTAGGGAGATGG + Intronic
950280300 3:11701522-11701544 ATGTGCCAGGAGAGAGGGCAAGG + Intronic
950621633 3:14210476-14210498 ACGAGCCTGGAGAAGGGGGAAGG + Intergenic
951017599 3:17747059-17747081 AAGAGCCAGGAGAAGGGATGTGG - Intronic
951072085 3:18341308-18341330 GAGAGCTAGGAGAAGGGAGAGGG - Intronic
951851597 3:27147284-27147306 ATGTTCCATCAGAAGAGAGAGGG + Intronic
952231386 3:31434380-31434402 ATGTTTCAAGAGAAAGGAGAGGG + Intergenic
952283900 3:31949326-31949348 TTGTTCCATGAGAATGGAGAAGG - Intronic
952515987 3:34105122-34105144 ATGGGCCAGGAGAAGGGGGGGGG + Intergenic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
952711989 3:36440695-36440717 AAGTGCCTGGATAAGGGAAAGGG + Intronic
953022868 3:39127088-39127110 CTGGGCCTTGAGAAGGGAGAAGG - Intronic
953345420 3:42171613-42171635 ATGAGCCGGGAGAAGTGGGAAGG - Intronic
953667938 3:44939534-44939556 AGGAGCCAGGAGCAGGGAGGTGG - Intronic
953706792 3:45237328-45237350 GTGTGCCGGGAGAAGGGAAAGGG - Intergenic
953719094 3:45339753-45339775 ATGTGCTAGGAGGGCGGAGAGGG - Intergenic
953918394 3:46935346-46935368 AGGTGGGAGGAGAAGGGAGGAGG - Intronic
954210629 3:49094932-49094954 ACGTGCCAGGCAAAGTGAGATGG - Intergenic
954672199 3:52297158-52297180 ATATGCTAGGGGAAGGGAGGGGG + Intergenic
955570712 3:60302305-60302327 ATATGCCAGGAGGAGAGAAAGGG - Intronic
956839370 3:73123178-73123200 ATCTGCCAGGGGTAGGGAGGAGG + Intergenic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
960706367 3:120485934-120485956 CTGGGGCAGGAGAAGGGATAAGG - Intergenic
961572032 3:127806162-127806184 ATTTGCCTGGAGAAGCTAGAGGG - Intronic
961812366 3:129529185-129529207 ACAGGACAGGAGAAGGGAGAAGG - Intronic
966850440 3:184161542-184161564 ATATGCCAGGAGTACAGAGATGG - Intronic
966850622 3:184162987-184163009 ATATGCCAGGAGTACAGAGATGG + Intronic
967028249 3:185582986-185583008 ATCTGCCAGGAAGAGTGAGAAGG - Intronic
967332817 3:188308953-188308975 AGGAGAAAGGAGAAGGGAGAAGG - Intronic
967778236 3:193406835-193406857 AAGGCCCAGGAGAAGGCAGAAGG + Intronic
968049115 3:195642091-195642113 TTGTGCCATGAGACAGGAGAGGG - Intergenic
968305503 3:197647843-197647865 TTGTGCCATGAGACAGGAGAGGG + Intergenic
968530320 4:1087567-1087589 GTGTGACAGGAGCAGGGAGTGGG + Intronic
968967231 4:3775287-3775309 ATGTGCCGGGAGAGGGCAGGAGG + Intergenic
969073756 4:4560855-4560877 ATGTCCAAAGAGAAGGGAGGAGG - Intergenic
969792282 4:9500055-9500077 ATGTGCCAGGAGCAGCCAGGTGG - Intergenic
969853107 4:9977557-9977579 AGGTGTCAGGAGCAGGGGGAGGG - Intronic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
970034396 4:11716071-11716093 ATTCACCTGGAGAAGGGAGAGGG - Intergenic
970471010 4:16379343-16379365 ATGTGCCAGCAGACAGGGGAAGG + Intergenic
970740958 4:19237101-19237123 TTGTTGCTGGAGAAGGGAGAAGG - Intergenic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971042033 4:22764483-22764505 ATGTCCCAGGAGGAGGGAGGGGG - Intergenic
971677625 4:29654028-29654050 GTGGGCTAGCAGAAGGGAGAGGG + Intergenic
973667460 4:53177399-53177421 GTGGGTTAGGAGAAGGGAGAGGG + Intronic
974154144 4:58048664-58048686 ATGTGACAGGTAAGGGGAGAAGG - Intergenic
975109211 4:70605207-70605229 AAGAGTCAGGAGAAAGGAGAAGG + Intronic
975258123 4:72263380-72263402 AGATGCCAGGAGCAAGGAGAAGG + Intergenic
975387538 4:73774564-73774586 ATGTGCAATGAGAAGGGTGTGGG - Intergenic
975592915 4:76017916-76017938 CACTGCCAGGGGAAGGGAGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976114182 4:81709451-81709473 GTTTGCCAGGGCAAGGGAGAAGG + Intronic
977195861 4:94058336-94058358 ATGTACCAGAAGAAGGCAGGAGG + Intergenic
978136033 4:105261479-105261501 CTGTGCCAGGAGTAGGGTTAGGG - Intronic
978277495 4:106969262-106969284 ATGAGAGAGGAAAAGGGAGAGGG - Intronic
978372045 4:108038873-108038895 ATGTGACAGCAGCAGGGAGTAGG + Intergenic
978663499 4:111154939-111154961 ATGTGCCAGAAACAGGGAGAGGG + Intergenic
979670273 4:123354156-123354178 AAGTGCCATGAGCAGAGAGAAGG + Intergenic
980746339 4:137021936-137021958 ATATACCTAGAGAAGGGAGAGGG - Intergenic
980873636 4:138638574-138638596 CTGTGGCAGGAGTGGGGAGATGG - Intergenic
982046939 4:151457565-151457587 ATGTGACAGGTGGAGGGAAAAGG - Intronic
983125501 4:163946224-163946246 ATGTGCCTGGGGTAGAGAGAGGG + Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983390742 4:167126956-167126978 AGTTGCCAGAAGAAGAGAGAGGG - Intronic
983769132 4:171526349-171526371 ATGAGCCAGGAGAAGGACTAAGG - Intergenic
985688050 5:1292484-1292506 TTGTGCCAGGACAGGGTAGAGGG - Intronic
985742523 5:1626986-1627008 TTGTGCCATGAGACAGGAGAGGG + Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
987068140 5:14309365-14309387 CTGTGCCAGGTTAAGGGAGTGGG - Intronic
989199882 5:38752589-38752611 ATGTGAGAGCAGAAGGGAAAAGG - Intergenic
991936973 5:71811488-71811510 ATCTTGGAGGAGAAGGGAGAAGG + Intergenic
994757188 5:103808982-103809004 AGGTAAAAGGAGAAGGGAGAAGG - Intergenic
994781215 5:104093253-104093275 AGGTGCCTGGAAAGGGGAGAGGG + Intergenic
995697922 5:114900442-114900464 CACTGCCAGGGGAAGGGAGAGGG + Intergenic
996496361 5:124161689-124161711 ATGGTCCAAGAGAAGGGAGATGG - Intergenic
996909085 5:128634942-128634964 TGGAGCCAGGAGATGGGAGATGG + Intronic
996970588 5:129362180-129362202 ATTTGACATTAGAAGGGAGATGG - Intergenic
997251416 5:132391598-132391620 ATGTTTGAGGAGGAGGGAGAAGG + Intronic
997530099 5:134576733-134576755 AAGTGAGAGGAGGAGGGAGATGG - Intronic
997555227 5:134791676-134791698 ATGTGCATGGAAAAGGGATAAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
999126681 5:149251178-149251200 ATGTGCCAGGACAAAGCACAGGG + Intronic
999400307 5:151259097-151259119 ATGTGGCATGAGAAGAGGGATGG + Intronic
999514334 5:152285843-152285865 ATGGGCCAGGAGAAGGAAGGGGG + Intergenic
1000113849 5:158135152-158135174 ATGGGGCAGGAGAAAGGAGATGG + Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000152747 5:158519294-158519316 CTGTTCCAGGAGAAGGAACAGGG + Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001437530 5:171711894-171711916 GTTTGCAAAGAGAAGGGAGACGG + Intergenic
1001655877 5:173349213-173349235 AGGCCCAAGGAGAAGGGAGATGG - Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002397314 5:178968153-178968175 TTGTGGTAGGAAAAGGGAGAGGG - Intergenic
1002666157 5:180826945-180826967 ATGTGTCATGAGAAGAGAAATGG + Intergenic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003171057 6:3722498-3722520 ATGTGACAGGAAGAGGGGGAGGG + Intergenic
1003527514 6:6910379-6910401 ATGTGCTGGGAGGAGAGAGATGG - Intergenic
1003593787 6:7456756-7456778 ATGCGCCAGGTGAAGGCAGCTGG + Intergenic
1004066797 6:12254301-12254323 ATTGGCCAGGCAAAGGGAGACGG - Intergenic
1004403919 6:15313922-15313944 ATGGGCCAGCAGAAGGTATAAGG - Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004638576 6:17492052-17492074 ATGTGCCAGGAGGAAGGAAAGGG + Intronic
1006253741 6:32813009-32813031 ATGTACACGTAGAAGGGAGAAGG + Exonic
1006433481 6:34013307-34013329 ATGTGCCAGGAGAACAGACCTGG - Intergenic
1006934532 6:37708158-37708180 AAATGGAAGGAGAAGGGAGATGG + Intergenic
1006982434 6:38157281-38157303 AAGTGCCTGGAGCAGGAAGATGG + Intergenic
1007309811 6:40936410-40936432 AGGTGGCTGGAGAAAGGAGAGGG - Intergenic
1009366300 6:62860571-62860593 AAGAGCCAGAAGAAGAGAGAGGG + Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009583800 6:65569977-65569999 ATGTGGAAGGACAAGGGAGTTGG + Intronic
1009618316 6:66039083-66039105 TGCTGCCAGGAGATGGGAGAGGG - Intergenic
1011674251 6:89715937-89715959 ATGTGCCTAGGGAAGCGAGAAGG - Intronic
1013420515 6:109962551-109962573 ATGTGCCAGGAGTGGAGGGAGGG + Intergenic
1014703513 6:124718243-124718265 AGTTGCCAGGGGATGGGAGAAGG - Intronic
1015225629 6:130853772-130853794 ATGTGCCTGAAAAAGGGAGACGG + Intronic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018742663 6:166742513-166742535 TTGTGTCAGGAGGAGGCAGAAGG - Intronic
1019122340 6:169813235-169813257 ATTCGAAAGGAGAAGGGAGATGG - Intergenic
1019278349 7:187740-187762 CCCTGCCAGGAGGAGGGAGACGG - Intergenic
1019319547 7:409372-409394 AAGTGCAAAGAAAAGGGAGATGG + Intergenic
1019410728 7:905480-905502 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019410780 7:905733-905755 AAGGGAAAGGAGAAGGGAGAAGG + Intronic
1019410793 7:905803-905825 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019670941 7:2278000-2278022 GTGTGACAGGAGAAGGCTGAAGG - Intronic
1020115404 7:5473365-5473387 ATGTGGCAGGAGGTGGGAGGAGG - Intronic
1020308874 7:6854794-6854816 CTCAGCCAGGAGAAGGGAGCGGG - Intergenic
1020943247 7:14566717-14566739 ATGTGCCTGGAGCATGGAGAGGG - Intronic
1021131386 7:16916585-16916607 CTGAGCCAAGAAAAGGGAGAAGG + Intergenic
1022033280 7:26511878-26511900 TAGAGCCAGGAGAAGGGAAAAGG + Intergenic
1022514465 7:30966468-30966490 ATGTGCAAGGACAAGGGAAGTGG - Intronic
1022577754 7:31514955-31514977 CTGAACCAGGAGAAGTGAGAGGG - Intronic
1023384363 7:39640915-39640937 ATCTGCCAGTAAAATGGAGAAGG - Intronic
1023636643 7:42218153-42218175 ATGTGCCAGGAAATGGGATGTGG + Intronic
1023879908 7:44312449-44312471 AAGTGAAAGGAGAAAGGAGAGGG + Intronic
1024048477 7:45601272-45601294 ATGTGGCAGGAGGCAGGAGAGGG + Intronic
1024048571 7:45601833-45601855 TGGTGCCAGGAGAAGGGAAGGGG + Intronic
1024661738 7:51501863-51501885 AGGAGAGAGGAGAAGGGAGAGGG + Intergenic
1024915721 7:54497381-54497403 AAGGGTCAGGAGAAGAGAGATGG + Intergenic
1024919843 7:54545169-54545191 TGGTGCCCCGAGAAGGGAGAGGG - Intronic
1026378251 7:69773693-69773715 TGGTGTCAGGAGAACGGAGAAGG + Intronic
1027190468 7:75993373-75993395 AGGTGCTAGGGGAAGGGAGTGGG - Intronic
1027805939 7:82822600-82822622 ATGGTCCATGAGAACGGAGATGG + Exonic
1028946863 7:96589569-96589591 ATGTCACTGGAGATGGGAGAGGG - Intronic
1029176012 7:98664897-98664919 ATGTGCTGGGGGCAGGGAGAAGG - Intergenic
1029969996 7:104779547-104779569 CTGTGCCTGGTGCAGGGAGAGGG - Intronic
1030479600 7:110085800-110085822 ATGTAGCAAGAGAAGCGAGATGG - Intergenic
1031150002 7:118042554-118042576 ATGGGCCTTGAGCAGGGAGAGGG - Intergenic
1031157967 7:118133573-118133595 TTGTGGTAGGAGTAGGGAGATGG - Intergenic
1031609671 7:123810081-123810103 ATCTGCCAGGAGAAAAGACAAGG + Intergenic
1031927153 7:127649903-127649925 AGGATCCAGGAGAAGGCAGAGGG + Intergenic
1031967525 7:128037764-128037786 ATGAGCCAAGAGAAGGGGGCAGG + Intronic
1032540352 7:132697707-132697729 ATGTGCAAGGAGAAGGGAAAGGG + Intronic
1032943685 7:136825226-136825248 ATGCGGCGGCAGAAGGGAGATGG + Intergenic
1033117576 7:138639297-138639319 ATATGCCAGGAGAAGTAAGTGGG + Intronic
1033273447 7:139953390-139953412 ATGAGCCAGGAGAAGGTCGCAGG - Exonic
1033594532 7:142847783-142847805 TTGTGGCAGGAGAAGGGAAGGGG + Intergenic
1033665864 7:143439959-143439981 ATATGGCAAGAGAAGAGAGAGGG + Intergenic
1033890427 7:146006388-146006410 ATGGGGGAGGAGGAGGGAGAAGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034841966 7:154406682-154406704 AAGTTCCAGGAGAAGGCTGATGG - Intronic
1035393824 7:158522897-158522919 ACCTGCCGTGAGAAGGGAGAGGG + Intronic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1037294562 8:17386660-17386682 ATGTGGCAGGAGATGGGACAGGG - Intronic
1037374938 8:18217441-18217463 CTGTGCCTGGACAAAGGAGAAGG + Intronic
1037478125 8:19277663-19277685 ATGCTCCAGGAAAAGGGAGGTGG - Intergenic
1037498785 8:19465653-19465675 AAGTGCCTGAAGAAGAGAGACGG - Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037644998 8:20785097-20785119 ATCTGCCAGGGGAAGGGACAGGG + Intergenic
1037712008 8:21362335-21362357 ATGTTCCAAGAGAAGGAAGAGGG - Intergenic
1037719129 8:21427917-21427939 ATGGGAATGGAGAAGGGAGAAGG - Intergenic
1037969796 8:23163927-23163949 AAGTCCCATGAGAAGGGAGGAGG + Exonic
1038437334 8:27545343-27545365 ATGTGACAGGAGGCAGGAGAGGG - Exonic
1038955031 8:32458677-32458699 AACTGCTGGGAGAAGGGAGAGGG - Intronic
1039366521 8:36933690-36933712 TTGTTCCAGGAGAAAGGAGAAGG + Intronic
1039579180 8:38650347-38650369 GAATGCCAGGAGAAGGTAGAGGG + Intergenic
1039594097 8:38775550-38775572 ATTTGGCAGAAGAAGGGAGAGGG + Intronic
1039605642 8:38878067-38878089 AGGAGCCAGGAGCAGGGAGGAGG + Intergenic
1039828542 8:41194953-41194975 ATGTGCCAGCAGATGGGTGGTGG - Intergenic
1040013676 8:42682967-42682989 CTTTGCCAGGGGAAGAGAGAAGG + Intergenic
1040559193 8:48508858-48508880 AGGTGACAGGAGCAGAGAGAAGG + Intergenic
1040576245 8:48654040-48654062 GTGAGTCAGGAGAAGGGAGCTGG + Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042974011 8:74444255-74444277 ATGTGTCAGCAGCAGGGAAAAGG - Intronic
1043327778 8:79073616-79073638 AGGTGATAGGAGCAGGGAGAGGG - Intergenic
1043344985 8:79288037-79288059 ATGTGCCAGGAGACAGGGGGAGG + Intergenic
1043520010 8:81034867-81034889 GGCTGCCAGGAGAAGGGAGCGGG + Intronic
1044651978 8:94505372-94505394 ATTTGCTGGGAGAAGGAAGAGGG - Intronic
1046779160 8:118196598-118196620 ATGTGCCTAGAGAAGGAAAAGGG - Intronic
1047381474 8:124368185-124368207 ATGTGTCAGGACAAAAGAGATGG + Intronic
1047381500 8:124368468-124368490 ATGTGTCAGGACAAAAGAGATGG + Intronic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1047875158 8:129128353-129128375 ATGTGGCAGGGGATGGGAGTTGG + Intergenic
1048136531 8:131751880-131751902 ATGTGCCAGGTGAGGGGTGGAGG - Intergenic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1049390676 8:142368709-142368731 AGGTGCCAGCAGACGGCAGACGG + Intronic
1049891756 9:76067-76089 AGGTGCTAGGAGCAGAGAGATGG - Intergenic
1050077572 9:1881026-1881048 ATGTGCCTGGAAAGGAGAGAAGG + Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051588785 9:18754669-18754691 ATGGGCAAGGAGCAAGGAGAAGG - Intronic
1051829104 9:21256166-21256188 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
1052313687 9:27094734-27094756 ATGTTCCAGGAACAGTGAGAAGG + Intergenic
1052379026 9:27750107-27750129 ATGTACCAGGAGAAGGAAACTGG - Intergenic
1053152552 9:35752158-35752180 CTGTTACTGGAGAAGGGAGAGGG + Intronic
1053606724 9:39667363-39667385 ATGTGCCAGGCAAAGGGTGCTGG - Intergenic
1053733180 9:41077158-41077180 AGGTGCTAGGAGCAGAGAGATGG - Intergenic
1054246812 9:62675041-62675063 ATGTGCCAGGCAAAGGGTGCTGG + Intergenic
1054560933 9:66709575-66709597 ATGTGCCAGGCAAAGGGTGCTGG + Intergenic
1054695241 9:68354405-68354427 AGGTGCTAGGAGCAGAGAGATGG + Intronic
1054793878 9:69280610-69280632 ATCTTCCAGGAGAAGGAAGGGGG + Intergenic
1055662340 9:78517672-78517694 AGGTGCCATCAGAAGGGAGATGG + Intergenic
1056450390 9:86710999-86711021 ATGTGCATGGAGAAGTGACAAGG + Intergenic
1056524920 9:87433981-87434003 GTGTGGCAGGAGAAGGTATATGG + Intergenic
1056551629 9:87657891-87657913 AAGTTTCAGGAGAAGGGAGATGG + Intronic
1056840191 9:89992507-89992529 ATGAGTCATGAGAAGGGAGCTGG + Intergenic
1058699270 9:107587539-107587561 GTCTGCCTGGGGAAGGGAGAAGG - Intergenic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1060183213 9:121547920-121547942 ATGGGAGTGGAGAAGGGAGATGG - Intergenic
1060756549 9:126218452-126218474 ATGTGCCAGGGAAGGGGAGGCGG + Intergenic
1061085074 9:128393666-128393688 CTGGCCCAGGAGAAGGGAGGGGG - Intergenic
1062069554 9:134548188-134548210 AAGAGCCAAGGGAAGGGAGAGGG - Intergenic
1185553640 X:1003344-1003366 GTGTGGCAGGAGGAGAGAGAAGG + Intergenic
1186498572 X:10032267-10032289 ATGGGCCAGGAGGAGGATGATGG + Intronic
1187425650 X:19175327-19175349 ACGGGCAAGGAGAGGGGAGAGGG - Intergenic
1187762546 X:22603561-22603583 CTGTGCCAAGTGAAGGGATAGGG + Intergenic
1188839836 X:35002631-35002653 ATGAGGCAGGAGAAGAGAGGAGG - Intergenic
1188894219 X:35646240-35646262 GTCTTCAAGGAGAAGGGAGAAGG + Intergenic
1189091371 X:38086184-38086206 ATGTTCCATGAGAAGGGCCAGGG + Intronic
1189169750 X:38897716-38897738 ATGTGTGAGGAGGAAGGAGAAGG - Intergenic
1190470272 X:50771534-50771556 ATGGGCTAGAAGAAGGCAGAAGG - Intronic
1191716105 X:64194619-64194641 ATCTGGGAGGAGAGGGGAGAGGG + Intronic
1191885843 X:65887157-65887179 ATTTGCCAAATGAAGGGAGAAGG - Intergenic
1192119395 X:68440547-68440569 AGGTGGCAGGTGGAGGGAGAGGG + Intergenic
1192162052 X:68795862-68795884 AGATGCCAGGGGTAGGGAGAGGG - Intergenic
1192265382 X:69533958-69533980 AGGCGCCAGCAGCAGGGAGAAGG + Intergenic
1192551936 X:72061507-72061529 ATGGGCCAGGATCAGGGTGACGG - Intergenic
1193085741 X:77446939-77446961 AAGTGCCATGAGACGGGAGTTGG - Intergenic
1193732227 X:85115452-85115474 ATGTGCCAGAAGACAGGAGAAGG + Intergenic
1194170526 X:90575189-90575211 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1195145373 X:102009542-102009564 ATGGGCCTGGAGAGGGGAAAGGG - Intergenic
1195995340 X:110725903-110725925 AGGTGGCTGGAGAAGGGACATGG + Intronic
1196458759 X:115908397-115908419 ATGTTCAAAGAGAAGGGACATGG + Intergenic
1197551727 X:127900342-127900364 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1197941788 X:131797817-131797839 CTGTACCAGGAGAAGGGAACTGG - Intergenic
1198581155 X:138066217-138066239 ATTAACCAGGAGAAGAGAGAAGG + Intergenic
1199081597 X:143582890-143582912 ATTTGCCAGTAGAAGTGAAATGG + Intergenic
1199860253 X:151795014-151795036 ATCTGTTAGGAGATGGGAGAAGG - Intergenic
1199882069 X:151981799-151981821 AATTTCCAAGAGAAGGGAGAGGG - Intergenic
1200017445 X:153178186-153178208 AAGTGCCAGGAGCCGGGAGGAGG + Intergenic
1200039736 X:153356224-153356246 AGGTGCCTGGAGAATGGGGATGG + Intronic
1200090295 X:153632850-153632872 AGGTGCCAGGAGAAGGGAGCAGG + Intergenic
1200516769 Y:4152949-4152971 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1200841227 Y:7783638-7783660 ATGGGCCAGGATTAGGGTGAGGG - Intergenic
1202110802 Y:21417196-21417218 ATGTAGTAGGAGAAGAGAGAAGG + Intergenic