ID: 1073513887

View in Genome Browser
Species Human (GRCh38)
Location 10:104060360-104060382
Sequence GAGAAGAAAGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8193
Summary {0: 1, 1: 15, 2: 168, 3: 1271, 4: 6738}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073513881_1073513887 17 Left 1073513881 10:104060320-104060342 CCAGGAGAAGGGAGAGGGGAGAA 0: 1
1: 1
2: 8
3: 127
4: 926
Right 1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG 0: 1
1: 15
2: 168
3: 1271
4: 6738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073513887 Original CRISPR GAGAAGAAAGAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr