ID: 1073515012

View in Genome Browser
Species Human (GRCh38)
Location 10:104068530-104068552
Sequence TTGGCCTTCTAGAAGCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073515012_1073515016 15 Left 1073515012 10:104068530-104068552 CCCTCAAGCTTCTAGAAGGCCAA No data
Right 1073515016 10:104068568-104068590 ACTAATTCCAAATATGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073515012 Original CRISPR TTGGCCTTCTAGAAGCTTGA GGG (reversed) Intronic
No off target data available for this crispr