ID: 1073516428

View in Genome Browser
Species Human (GRCh38)
Location 10:104079520-104079542
Sequence CAGTGTGAATGAGAGTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073516428_1073516430 12 Left 1073516428 10:104079520-104079542 CCACATGACTCTCATTCACACTG 0: 1
1: 0
2: 0
3: 26
4: 212
Right 1073516430 10:104079555-104079577 CTGCATTTTGCTAATTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073516428 Original CRISPR CAGTGTGAATGAGAGTCATG TGG (reversed) Intronic
900772502 1:4556388-4556410 CAGAGAGAATGAGAGTGAAGAGG - Intergenic
900880064 1:5374456-5374478 CTGTGTCAAGGAGATTCATGCGG + Intergenic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
904622709 1:31784925-31784947 GAGTGTGAATGAGAGACCTTGGG + Intergenic
905022820 1:34829494-34829516 GAGAGAGAATGAGAGACATGCGG + Intronic
906743188 1:48202551-48202573 CTGTCTCAATGAAAGTCATGAGG + Intergenic
907244727 1:53101382-53101404 CAGTGTGTGTGAGTGTAATGGGG - Intronic
907325066 1:53632400-53632422 GAGTGTGACTGAGGGGCATGTGG + Intronic
907359826 1:53905538-53905560 CAGTATGAATTAGAATCATCTGG + Intronic
909001896 1:70227491-70227513 TAATGTGTATTAGAGTCATGGGG - Intronic
912630906 1:111245952-111245974 CAGTATGGGTGAGAGTCAGGAGG + Intergenic
913190871 1:116411932-116411954 CAGTATGCATCAGAGTCATCTGG - Intergenic
919367818 1:196686671-196686693 CAGTGTGCATAAGAATTATGAGG + Intronic
920978786 1:210811920-210811942 CAGTGTGTATCAGAATCATGTGG + Intronic
921134118 1:212244960-212244982 CAGAGTGAGTGAGAGAGATGGGG + Intergenic
921863292 1:220062004-220062026 CAATGTTAATGAAAGTCATCAGG - Intronic
923154188 1:231262130-231262152 CAGGGTGAATGGGTGTCATGTGG - Intronic
923495773 1:234522925-234522947 CAATGTGCAGGAGAGTCATTTGG - Intergenic
1063891251 10:10630879-10630901 CATGGGGAATGAGAGTCAAGGGG - Intergenic
1064571881 10:16702252-16702274 CAGTGTGAAGGAGAAATATGGGG + Intronic
1065022894 10:21515644-21515666 CAGTGTGACTGAGAGTAAAGAGG - Exonic
1067053254 10:43037267-43037289 CAATGGGAAGGAGAGTCAGGTGG + Intergenic
1068943547 10:62705262-62705284 CATTGTGCATGAGAGTCACCTGG - Intergenic
1070655671 10:78269548-78269570 AAGTTTGGATGGGAGTCATGGGG + Intergenic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1072434306 10:95401422-95401444 CAGTGAGAATGAGGCCCATGAGG + Intronic
1073026211 10:100489048-100489070 CAGTGTGACTGTGAGTCACTGGG - Intronic
1073107016 10:101038039-101038061 TAGTGTAATTGAGATTCATGGGG + Intronic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1075863258 10:125696050-125696072 CAGTGGGAAAGAGAGAGATGGGG + Intergenic
1076026169 10:127115314-127115336 CAGTGTGTGTGAGAGTCAATAGG + Intronic
1076249171 10:128971641-128971663 AACTTTGAATGAGAGGCATGTGG + Intergenic
1076463455 10:130661987-130662009 CAGTGACTATGTGAGTCATGTGG + Intergenic
1080638380 11:34143130-34143152 GGATGTTAATGAGAGTCATGTGG + Intronic
1083700630 11:64475488-64475510 GAGGGTGAATGAGTGTCCTGTGG + Intergenic
1089046256 11:115504050-115504072 AAGTGTGAATGAGAGTCCCCAGG - Intronic
1090411980 11:126515616-126515638 CAGTGTGAATGAGGGCCCAGAGG + Intronic
1091838326 12:3601657-3601679 CCGTGTGGATGAGAGCCACGCGG - Intergenic
1092071705 12:5636760-5636782 CAGTGTGAATGACACTCCAGTGG + Intronic
1095737962 12:45578185-45578207 CACTCTGAATATGAGTCATGGGG - Intergenic
1097313226 12:58144049-58144071 CAGTGTGTATGAGAGACATTCGG - Intergenic
1098829621 12:75345151-75345173 GAGTCTGATTGAGAGTCTTGGGG - Intronic
1100658205 12:96669544-96669566 CAGTGTGGATCACAGTCCTGTGG - Intronic
1100810387 12:98331431-98331453 CAGGGAGAATGAGAGATATGTGG + Intergenic
1101475494 12:105043095-105043117 CAGTCTGAATGAAGGTCATATGG + Intronic
1101843835 12:108346201-108346223 CAGTGAGGATGGGAGTCAGGAGG + Intergenic
1103257165 12:119551625-119551647 CACAATGAATGAGAGTCAGGAGG - Intergenic
1103487957 12:121295956-121295978 CAGTGTCCCTGAGAGTCAGGCGG + Intronic
1103978046 12:124716600-124716622 CAGAGTGGATGAGAGATATGTGG - Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1107031824 13:35861389-35861411 CAGGGTGGATGAGGGTCCTGGGG + Intronic
1107419419 13:40232923-40232945 CAGTGTGAATGAAAGTGTTGGGG - Intergenic
1113156385 13:107327416-107327438 CAGTATGAATGAGGTTCCTGTGG + Intronic
1113238416 13:108309170-108309192 AAGAGTGAATGAGAGCCAAGTGG + Intergenic
1115597604 14:34924257-34924279 AAGTCTGAAGGAGAGTTATGTGG - Intergenic
1115986860 14:39111097-39111119 TAGTGTGTATAAGAGTCATCCGG - Intergenic
1116472047 14:45296580-45296602 CAGTGTAATAGAGAATCATGAGG - Intergenic
1116536836 14:46041866-46041888 AAGTGTCCATGGGAGTCATGGGG + Intergenic
1117610623 14:57479521-57479543 CAGTGTGCATGAGAATCATCTGG + Intronic
1117847323 14:59924957-59924979 GAGTGTGAGTGTGAGCCATGCGG - Intronic
1118049032 14:62005801-62005823 CAGTCTGAAGGAGAGGCCTGTGG - Intronic
1121821194 14:96967852-96967874 CAGTGTGAAGAAGACACATGGGG - Intergenic
1121923298 14:97903654-97903676 GAGAGTGAAGGAGAGTAATGAGG - Intergenic
1122250492 14:100435897-100435919 AAGTGTGTATGAGAGTCCTCTGG + Intronic
1123095768 14:105766364-105766386 CAGTGTGGAGGAGAGTGTTGGGG + Intergenic
1125337548 15:38642094-38642116 CTGTGTGAAGAAGACTCATGTGG - Intergenic
1125713562 15:41805968-41805990 GAGTGTGAATGAGGGCCCTGGGG - Intronic
1130758735 15:86795233-86795255 CATTGTGAAAGGGAGACATGGGG + Intronic
1131720414 15:95162345-95162367 CAGTCTGGATTACAGTCATGAGG - Intergenic
1135204877 16:20475189-20475211 CAGGGTGCATGAGAGTTGTGGGG + Intronic
1135214014 16:20548624-20548646 CAGGGTGCATGAGAGTTGTGGGG - Intronic
1136747733 16:32606754-32606776 CAGTGTGTGTGTGTGTCATGGGG - Intergenic
1140350071 16:74253722-74253744 CAGTGAGAATGAGAGCCACGTGG + Intergenic
1141857631 16:86694662-86694684 CAGTGGGAGTGACTGTCATGGGG - Intergenic
1203049868 16_KI270728v1_random:865963-865985 CAGTGTGTGTGTGTGTCATGGGG - Intergenic
1142845691 17:2674014-2674036 CACTGTGAATGACAATCATCAGG - Intronic
1142898463 17:2997256-2997278 AGGTGTGAATGAGAGTGATGAGG - Intronic
1143121371 17:4609301-4609323 CATTCTGAATGTGAGACATGAGG - Intergenic
1143268797 17:5660256-5660278 CAGTCTGAAGTGGAGTCATGTGG - Intergenic
1143286794 17:5795993-5796015 CAGTGTAAAGGAGAGTGATGTGG + Intronic
1143868509 17:9941228-9941250 CAGTTGGAATGAGACTCAGGAGG - Intronic
1146925513 17:36742353-36742375 CGGTGTGGATGGGAGTCATAGGG + Intergenic
1152063841 17:78098891-78098913 CTGTGCGAAGGGGAGTCATGGGG - Intronic
1152248546 17:79199307-79199329 CAGGATGAATGAGAGCCAGGAGG - Intronic
1155241245 18:23865659-23865681 TAGGGGGAATGGGAGTCATGTGG + Intronic
1156560274 18:38116992-38117014 GAGTGTGCATCAGAGTCCTGTGG - Intergenic
1156917352 18:42477336-42477358 CAGTGTGAATGAACTTCAGGGGG + Intergenic
1157277725 18:46323699-46323721 CAGTGTGCATAAGAATCCTGTGG - Intergenic
1157881767 18:51327611-51327633 CAGTGTGTATAAGACTCATTAGG + Intergenic
1158935062 18:62356877-62356899 CAGTGTTACTAAGAGTCATATGG + Intronic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1162184523 19:8894574-8894596 GAGTGTGGATAAGAGTCAAGGGG + Intronic
1164532426 19:29058568-29058590 CAGGGTTAAGGAGAGCCATGAGG + Intergenic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1168531076 19:57129498-57129520 TGCTGTGAATGAGAGTCAAGAGG - Exonic
926938024 2:18105529-18105551 CAGTATGTATGAGAGTCACCTGG + Intronic
930351787 2:50265758-50265780 AAGTGTGAATGAGTGTGGTGAGG - Intronic
933006510 2:77002332-77002354 ATGTGTTAATGAGAGTCATGTGG + Intronic
935395579 2:102605272-102605294 CAGTGTAAATGAGATTTAGGAGG - Intergenic
938144898 2:128825213-128825235 CAGTGTACATGAAAGTGATGGGG + Intergenic
938890436 2:135698930-135698952 CATTGTGAATGAGATTTAGGTGG + Intronic
939952700 2:148494454-148494476 ACGTGTGAAAGAGAGTTATGTGG - Intronic
940124328 2:150307822-150307844 GACAGTGAATGGGAGTCATGTGG - Intergenic
941642564 2:168004785-168004807 CAGTGTGTATGAGAATCACTTGG + Intronic
942381749 2:175398973-175398995 CAGTGGGCAGGGGAGTCATGAGG - Intergenic
945844735 2:214930584-214930606 CTGTGTGACTGAGTGTCTTGTGG - Intergenic
945966049 2:216187999-216188021 AAGTGTGTGTGAGAGTCCTGAGG - Intronic
947002151 2:225468934-225468956 CAATTGGAATGAGAGTCTTGAGG - Intronic
947100260 2:226613223-226613245 CAGTGGGCATGAGGGGCATGTGG - Intergenic
947447381 2:230174450-230174472 CACAGTGAATGAGACTCAGGAGG - Intronic
948021422 2:234736691-234736713 GAGTGTGGATGAGAGTCTGGGGG + Intergenic
1170157550 20:13282372-13282394 CAGTGTGCAAGAGAATCATCTGG - Intronic
1170391374 20:15878370-15878392 CAGTGTGCATGAGTGTCACCTGG + Intronic
1171387492 20:24780079-24780101 CAGTGTGGCTGTGTGTCATGAGG + Intergenic
1173001424 20:39108631-39108653 CAGGGTGGCAGAGAGTCATGGGG + Intergenic
1173294768 20:41747221-41747243 CAGTGTGGTTGAGAGCCTTGGGG + Intergenic
1173362709 20:42359164-42359186 CAGTGTGCATGAGAATCACCTGG - Intronic
1173445804 20:43117024-43117046 CAAGGAGGATGAGAGTCATGTGG - Intronic
1174135896 20:48378996-48379018 CACAGTGAAAGAGAGGCATGGGG - Intergenic
1175623582 20:60471795-60471817 CAGGGTGAATGTGAGGCTTGTGG + Intergenic
1175791550 20:61743448-61743470 CAGTGGGCATGAGGGGCATGAGG - Intronic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1177325127 21:19576204-19576226 GTGTGTGGATGAGAGACATGCGG - Intergenic
1179677975 21:42997704-42997726 CAGTGTGGGTGAGATTCATCAGG + Intronic
1181616797 22:24060484-24060506 GTGAGGGAATGAGAGTCATGGGG + Intronic
1182867284 22:33614688-33614710 CAGTGGGATGGAGAGTGATGGGG - Intronic
1182943730 22:34302717-34302739 CAGTGGGAAGGACAGACATGGGG - Intergenic
1184308917 22:43628528-43628550 GAGTGAGAAGGAGAGTCAAGGGG - Intronic
1184477249 22:44728499-44728521 CATTGTGAAGGAGTGTCCTGGGG + Intronic
949473609 3:4421407-4421429 CCTTGTGACTGAGTGTCATGGGG - Intronic
951624221 3:24642532-24642554 CAATGTGCATGAGAGTCACCTGG + Intergenic
952013562 3:28930838-28930860 CCCTGAGAAGGAGAGTCATGAGG + Intergenic
952020733 3:29016287-29016309 CAGTCTGAACATGAGTCATGGGG - Intergenic
953364032 3:42326354-42326376 GAGTAGGAATGAGAGACATGGGG + Intergenic
953578432 3:44131734-44131756 TAGTATAGATGAGAGTCATGGGG + Intergenic
954473056 3:50715596-50715618 GAGTGAGAATGAGGGTGATGAGG + Intronic
955525588 3:59816529-59816551 TAGTGGGAATGAGAGCCATCTGG + Intronic
957876507 3:86153954-86153976 TAGTGTGAATGAGTGTGATTTGG - Intergenic
957898268 3:86451977-86451999 CAGTGTCACTGAAAGCCATGTGG + Intergenic
959739184 3:109695954-109695976 CACTGTAAAGGTGAGTCATGAGG + Intergenic
960943118 3:122947391-122947413 CAGTATGAATGAGAGTCTGGGGG - Intronic
961052572 3:123759431-123759453 AAGTATTAATGAGAGGCATGTGG + Intronic
961975569 3:131021418-131021440 CAATGTGAATGAATCTCATGTGG + Intronic
962041101 3:131708192-131708214 GAGAGTGAATGAGAGCCATGAGG + Intronic
962285453 3:134082297-134082319 CAGTGGTAATGTGAGTGATGGGG - Intronic
962897951 3:139732868-139732890 CCATGTGACTGAGTGTCATGTGG - Intergenic
963682758 3:148400665-148400687 CAGTGTAACTGAGAGTCGCGTGG - Intergenic
965925419 3:173972921-173972943 CAGTGTGCAGGAGAATCATCAGG - Intronic
966034222 3:175391059-175391081 CAGTGTGTAGTAGAGTCATAAGG + Intronic
966923188 3:184627827-184627849 CAGTGTGAAAGTGAGTCTGGGGG + Intronic
969156552 4:5216105-5216127 CAGTGTGCATGAGAATCACCTGG + Intronic
970505360 4:16723764-16723786 AAGTGTGAAAATGAGTCATGTGG - Intronic
971937731 4:33174002-33174024 CAGCTTGAATGAGAGTGCTGTGG - Intergenic
972798469 4:42446972-42446994 CAATATGGATGAGAGTCATAGGG + Intronic
973206777 4:47569869-47569891 CAGTGAAAATGAAAGCCATGAGG + Intronic
974453654 4:62098039-62098061 CAGTGTGGCTGAGAGGAATGTGG - Intergenic
974947165 4:68542505-68542527 CAGTGTGAATGACACAGATGAGG + Intronic
978437559 4:108701854-108701876 CTGTGTGCATGAGAATCACGAGG - Intergenic
981832618 4:149019823-149019845 CAGTGTGAATGAAAACAATGGGG + Intergenic
984648953 4:182249172-182249194 CTGTGGAAATGGGAGTCATGTGG + Intronic
984661778 4:182382460-182382482 CAGTGTGAATGAGAGAGGCGGGG - Intronic
988664595 5:33311516-33311538 CAGAGAGAAAGAGAGTGATGGGG - Intergenic
989000199 5:36751989-36752011 GAGTGTGGATGAGACTCAAGAGG - Intergenic
992154434 5:73940876-73940898 CGGTGTGAATTTGAGTCATGGGG - Exonic
993152431 5:84178201-84178223 CAGTGTATATGAGAGTCAACTGG + Intronic
994143842 5:96370947-96370969 AAGTGTGAATGAGTGTATTGTGG - Intergenic
994504236 5:100620290-100620312 CAGTGTGACTGAGAGTCCCCAGG + Intergenic
995423831 5:111996931-111996953 CAGTCTGAAAGAGTGTTATGAGG + Intronic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
999025633 5:148228677-148228699 CAAGGTGAATGTGAATCATGGGG - Intergenic
1000017894 5:157294563-157294585 CATTGTGTATGTGAGTCATCTGG + Intronic
1000169309 5:158686386-158686408 CACTGTGAATGGAAGCCATGTGG - Intergenic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1002671956 5:180874731-180874753 CAGCGAGCATGAGAGTAATGTGG + Intergenic
1004009475 6:11668540-11668562 TAGTGTGAACAAGAGCCATGTGG + Intergenic
1005520039 6:26592725-26592747 CCGTGTCACTGAGAGTCAGGAGG + Intergenic
1005853150 6:29838074-29838096 CAGTGGGCATGAGAGTCAGCAGG - Intergenic
1007321355 6:41030837-41030859 CAGACTGAAGGAGAGACATGAGG - Intronic
1013777365 6:113693349-113693371 CAGTGGGCTTGGGAGTCATGGGG - Intergenic
1015249876 6:131115825-131115847 CAGTTTGAATGGGATTCCTGAGG + Intergenic
1016257221 6:142122012-142122034 AACTGGGAATGAGAGGCATGTGG - Intergenic
1017344255 6:153361616-153361638 CAGTGTGAGTGAGAGTGGTGTGG + Intergenic
1017505784 6:155067543-155067565 GAGTGGAAATGAGAGTCAGGAGG - Intronic
1018235312 6:161717916-161717938 CATTGTGCATGAGAGTGAAGAGG + Intronic
1019067469 6:169314312-169314334 GTGTGTGAATGAGTGTCTTGTGG - Intergenic
1019067563 6:169315090-169315112 GTGTGTGAATGAGTGTCTTGTGG - Intergenic
1019769459 7:2874515-2874537 CACTGTGAATGAAAGTGTTGTGG - Intergenic
1020478243 7:8624712-8624734 CAGAGTGAATGAAAGGCATTTGG + Intronic
1021148499 7:17119833-17119855 CACTGTGGATGAGAGTGATCTGG + Intergenic
1021496151 7:21276608-21276630 CAGTGTGAATCTGAGACATTAGG + Intergenic
1021883594 7:25116683-25116705 CAGTGGGGATAAGAATCATGAGG + Intergenic
1022417368 7:30189785-30189807 GAGTGTGACTGAGAGACAGGAGG - Intergenic
1024062752 7:45710930-45710952 CAGAGTGAATGAGAGCCACCAGG - Intronic
1024841782 7:53595341-53595363 GAGTCTGAATGAGAAACATGGGG - Intergenic
1027261105 7:76465220-76465242 CAGGGTGAAGCAGAGTCATGGGG + Intronic
1027312488 7:76963328-76963350 CAGGGTGGAGCAGAGTCATGGGG + Intergenic
1027553767 7:79636070-79636092 CAGTGTAACTGAAAGTCATGAGG - Intergenic
1030975725 7:116120509-116120531 TAGTGTGCATGAGAGTCATCTGG - Intronic
1033437488 7:141346673-141346695 CTGTGTGGAAGAGAATCATGAGG - Intronic
1034451801 7:151141175-151141197 CATTGGGAATGAGATTCATGCGG + Intronic
1034921030 7:155082219-155082241 CAGTGTGAATGGCATCCATGGGG + Intronic
1037175801 8:15944827-15944849 CTGGGTGAATTAGAGTCATCTGG - Intergenic
1037639616 8:20730792-20730814 AAGTGTGATTGAGAGGCTTGGGG - Intergenic
1039287611 8:36059611-36059633 CATTGAGAATGAGGGTGATGGGG + Intergenic
1039944702 8:42119378-42119400 TAGCCTGAAGGAGAGTCATGTGG + Intergenic
1041821095 8:62033634-62033656 CAGTGTGAGTGAGTGGGATGTGG + Intergenic
1042031842 8:64484614-64484636 CAGTGTGAGTCATAGTCTTGTGG + Intergenic
1042170368 8:65985380-65985402 CAGTGTGGATGAGAACGATGGGG + Intergenic
1044058792 8:87606339-87606361 CAATATCAATGAAAGTCATGGGG - Intronic
1045942178 8:107751853-107751875 GAGTGTGAATGAGACTTATGGGG + Intergenic
1046340043 8:112841992-112842014 CAATGTGAAGGAGAGTCATTTGG - Intronic
1046358216 8:113116057-113116079 CAGTGAGAATGAAATTTATGTGG + Intronic
1048554643 8:135462818-135462840 CAGTGTTACTGAGAGTCAGTAGG - Intronic
1048623019 8:136155410-136155432 CAGTGTGAAACAGAGTCCTCAGG + Intergenic
1051592425 9:18789960-18789982 CAGTCAGAATGAGAGGCCTGAGG + Intronic
1051620858 9:19048503-19048525 CAGAATGAATGAGAGTCATCAGG - Intronic
1052848595 9:33360845-33360867 CAGTGTGAACCAGATTCTTGTGG + Intronic
1055761531 9:79614051-79614073 CTTGGTGAATGAGAGTCAAGGGG + Intronic
1057666077 9:97046412-97046434 CAGTGTGAATGAGGCTCAGCTGG + Intergenic
1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG + Intronic
1190630428 X:52380745-52380767 CAGTGTGAGTGAGTGTGAGGAGG + Intergenic
1190634505 X:52420596-52420618 AAGTGTGAATGAGTGTGAGGAGG + Intergenic
1190642738 X:52495942-52495964 AAGTGTGAGTGAGAGTGAAGAGG + Intronic
1190644935 X:52516925-52516947 AAGTGTGAGTGAGAGTGAAGAGG - Intronic
1190648323 X:52543996-52544018 AAGTGTGAGTGAGAGTGAGGAGG + Intergenic
1190652790 X:52583125-52583147 AAGTGTGAATGAGGGTGAGGAGG + Intergenic
1192763414 X:74119414-74119436 CAGTGTGGCTGAGAGCCTTGGGG - Intergenic
1194217391 X:91147929-91147951 CAGTGTGAACCAGAGTGAAGAGG + Intergenic
1194424717 X:93722203-93722225 CAGTGTGAATCAGAATCACCTGG + Intergenic
1194807326 X:98345229-98345251 CAGTGTGAATGTGAATCTTCTGG + Intergenic
1197089934 X:122524044-122524066 TAATGTGCCTGAGAGTCATGTGG - Intergenic
1199188418 X:144942116-144942138 CAGTGTGATGGAGTGTCCTGGGG - Intergenic
1199268558 X:145856292-145856314 CAGTGTGACTCTGAGTCATCTGG + Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1200553905 Y:4611721-4611743 CAGTGTGAACCAGAGTGAAGAGG + Intergenic
1201689417 Y:16746301-16746323 CAGTTTCAATCAGAGTCATTGGG - Intergenic