ID: 1073517735

View in Genome Browser
Species Human (GRCh38)
Location 10:104092546-104092568
Sequence GAGGCTTAACTCTACCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073517735_1073517738 -9 Left 1073517735 10:104092546-104092568 CCACCCTGGTAGAGTTAAGCCTC No data
Right 1073517738 10:104092560-104092582 TTAAGCCTCTCCAAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073517735 Original CRISPR GAGGCTTAACTCTACCAGGG TGG (reversed) Intergenic
No off target data available for this crispr