ID: 1073517738

View in Genome Browser
Species Human (GRCh38)
Location 10:104092560-104092582
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073517735_1073517738 -9 Left 1073517735 10:104092546-104092568 CCACCCTGGTAGAGTTAAGCCTC No data
Right 1073517738 10:104092560-104092582 TTAAGCCTCTCCAAGAACTGAGG No data
1073517734_1073517738 -8 Left 1073517734 10:104092545-104092567 CCCACCCTGGTAGAGTTAAGCCT No data
Right 1073517738 10:104092560-104092582 TTAAGCCTCTCCAAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073517738 Original CRISPR TTAAGCCTCTCCAAGAACTG AGG Intergenic
No off target data available for this crispr