ID: 1073521216

View in Genome Browser
Species Human (GRCh38)
Location 10:104131377-104131399
Sequence TTCTCGTAGATTGCAGCTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073521212_1073521216 24 Left 1073521212 10:104131330-104131352 CCCATTGCATTACAGATGTCTTT 0: 1
1: 0
2: 1
3: 27
4: 267
Right 1073521216 10:104131377-104131399 TTCTCGTAGATTGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1073521213_1073521216 23 Left 1073521213 10:104131331-104131353 CCATTGCATTACAGATGTCTTTT 0: 1
1: 1
2: 0
3: 48
4: 470
Right 1073521216 10:104131377-104131399 TTCTCGTAGATTGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073521216 Original CRISPR TTCTCGTAGATTGCAGCTTA GGG Exonic
922085652 1:222344509-222344531 TGCTATTAGATTGCAGCATAGGG - Intergenic
923627345 1:235624885-235624907 TGCTGGTAAATTGCAGCTTGTGG + Intronic
924564055 1:245181223-245181245 TTCTAGTAGTTTCCAGCTAATGG + Intronic
1063825218 10:9889607-9889629 TTCGCGTAGAGTGCATCTTTAGG + Intergenic
1064501402 10:15977368-15977390 TTCTCGTGGATTTTAGCTTCTGG + Intergenic
1065052353 10:21808524-21808546 TTCTCTCAGATTTCAGATTATGG - Intronic
1069618018 10:69818559-69818581 TTCTTGCAGATGGCAGATTAAGG - Intronic
1073521216 10:104131377-104131399 TTCTCGTAGATTGCAGCTTAGGG + Exonic
1073727026 10:106244680-106244702 TTCTCTTATATTGCCTCTTACGG + Intergenic
1080903114 11:36514245-36514267 TTTTTGTAGGTTCCAGCTTAGGG - Intronic
1084879591 11:72160867-72160889 TTCTCGTAGATTTCTGTTTCTGG + Intergenic
1089024564 11:115255812-115255834 TGCTCGTTGTTTGCAACTTAAGG - Intronic
1106798090 13:33228221-33228243 TTCTGGTGGATTGCAGCCTCTGG + Intronic
1118380600 14:65214656-65214678 TCCTCTGAGATGGCAGCTTATGG + Intergenic
1120185610 14:81390884-81390906 TTCTTGTATCTTGCAGCTTCTGG + Intronic
1128166252 15:65467834-65467856 CTCTGCTATATTGCAGCTTAGGG + Intronic
1131482747 15:92795767-92795789 TGTCCGTAGATTGCAGCTTCAGG - Intronic
1137732938 16:50702569-50702591 TTGTCATTGATTGCAGGTTAGGG + Intronic
1141592126 16:85076435-85076457 TTCTCGTATGTTGGAGCTCAAGG + Intronic
1149598518 17:57878132-57878154 GTCTCTGTGATTGCAGCTTACGG - Intronic
1156818494 18:41341598-41341620 TACTCATAAAGTGCAGCTTAGGG - Intergenic
1159789572 18:72761599-72761621 TTCTTTTAGATTGCAGCCCAAGG - Intronic
929524626 2:42689975-42689997 TTCTTATTGATTGAAGCTTAGGG + Intronic
931458055 2:62427414-62427436 TTCTCCTAGAATGCACGTTAAGG + Intergenic
1182606670 22:31511013-31511035 TTCCTGTAGCTTGCAACTTAGGG + Intronic
1182911013 22:33984676-33984698 TTCCCCTAGATTGCAGCCTTTGG + Intergenic
960172337 3:114476847-114476869 TTTTCTTAGGTTGCAGTTTAGGG + Intronic
971701693 4:29985202-29985224 TACTCTTAGATGGCAGATTATGG - Intergenic
971701853 4:29987112-29987134 TGCTCATAGATGGCAGATTATGG + Intergenic
976073640 4:81271986-81272008 TCCTAGTAGATTGCAGGTTGTGG - Intergenic
980401036 4:132286240-132286262 TTCAGGTAAATTGCTGCTTATGG - Intergenic
984660722 4:182372025-182372047 TTATTGTAGTTTGCAGCTTAAGG + Intronic
990464679 5:56060884-56060906 TTGTCGTAGATGGAAGCTTATGG + Intergenic
998967227 5:147553692-147553714 TTCTCCTTGAATGAAGCTTAAGG + Intergenic
1002662149 5:180798486-180798508 TTCATGTAGCTTGCAGCTGAGGG - Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007464883 6:42044690-42044712 TTCTGGAAGATTGCAGCAAAGGG - Intronic
1008347602 6:50447617-50447639 TTCTTGTAGATTCAAGCTTTTGG - Intergenic
1011468832 6:87687544-87687566 TTCTCCTTGATTGAATCTTAAGG + Intronic
1013388131 6:109653297-109653319 TTCTCATACATTGCGGGTTAGGG - Intronic
1016978347 6:149830959-149830981 TTTTCCTAGATTTCAGCATAAGG + Intronic
1031636673 7:124109276-124109298 TTCTTGTAGATAGCAGCCTCTGG + Intergenic
1037124435 8:15329027-15329049 TTCTAGGAGATTGCAGCTGAGGG - Intergenic
1059963001 9:119585594-119585616 TTGTCCTAGAATGGAGCTTAGGG + Intergenic
1198523174 X:137473270-137473292 TTCTCCAAGATTGCAGCATGTGG + Intergenic