ID: 1073523282

View in Genome Browser
Species Human (GRCh38)
Location 10:104155195-104155217
Sequence CACCCAGGGCAGCCAGTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073523282_1073523288 -2 Left 1073523282 10:104155195-104155217 CCGGTCACTGGCTGCCCTGGGTG 0: 1
1: 0
2: 1
3: 26
4: 279
Right 1073523288 10:104155216-104155238 TGAGGGTAGTGGTGTAAACTTGG No data
1073523282_1073523291 19 Left 1073523282 10:104155195-104155217 CCGGTCACTGGCTGCCCTGGGTG 0: 1
1: 0
2: 1
3: 26
4: 279
Right 1073523291 10:104155237-104155259 GGCGATGTCTCTGGACATGGAGG No data
1073523282_1073523290 16 Left 1073523282 10:104155195-104155217 CCGGTCACTGGCTGCCCTGGGTG 0: 1
1: 0
2: 1
3: 26
4: 279
Right 1073523290 10:104155234-104155256 CTTGGCGATGTCTCTGGACATGG No data
1073523282_1073523289 10 Left 1073523282 10:104155195-104155217 CCGGTCACTGGCTGCCCTGGGTG 0: 1
1: 0
2: 1
3: 26
4: 279
Right 1073523289 10:104155228-104155250 TGTAAACTTGGCGATGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073523282 Original CRISPR CACCCAGGGCAGCCAGTGAC CGG (reversed) Intronic
900313084 1:2043810-2043832 CACCCAGGGGAGGCAGGGAAGGG - Intergenic
900357989 1:2273905-2273927 CAGCCAGGGCAGTGAGTGAGAGG - Intronic
900390335 1:2431116-2431138 CACGCAGGGCAGCCAGCCACAGG - Intronic
901131754 1:6966087-6966109 CATCTAGGTCAGCCTGTGACAGG - Intronic
901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG + Intronic
901510384 1:9715489-9715511 CACCCAAGGCAGCCACTGGGAGG - Intronic
901653841 1:10757970-10757992 CCCTCAGTGCATCCAGTGACTGG - Intronic
902124081 1:14193965-14193987 CACCCAGGGAAGCCAATAATAGG - Intergenic
902337978 1:15764811-15764833 CACCCAGCCCAGCCAGAGAAGGG - Intronic
902691533 1:18112877-18112899 ATCCCAGGGCAGCGAGAGACTGG + Intronic
903446185 1:23424272-23424294 CACCCTGGGCAGCTAGTGCAGGG - Intronic
905651393 1:39659361-39659383 CACGCAGTGCAGCCAGTTCCGGG - Exonic
905665194 1:39759350-39759372 CAACATGGGCAGCCTGTGACCGG - Exonic
907983639 1:59509042-59509064 CTCCCAGGACAGCCAGTACCTGG - Intronic
910100275 1:83568289-83568311 CACCCAGGACAGCCAGAGTCAGG - Intergenic
913069352 1:115285221-115285243 CAGCCAGGGAAGCCAGAGACGGG - Intergenic
913484839 1:119324714-119324736 CATCCAGGGGAGCTAGTGATCGG - Intergenic
915064663 1:153214976-153214998 CAGGCAGGGCATCCAGTGAGAGG + Intergenic
915339093 1:155166710-155166732 CGCCCAGGGCAGGCAGGGAGGGG - Intergenic
915488890 1:156240808-156240830 CAGCCAGGGCAGCCAAAGGCAGG + Intronic
918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG + Exonic
919231362 1:194779204-194779226 CACCCAGGGGAGGCAATGAGTGG + Intergenic
919765935 1:201127365-201127387 GACTCAGGGCAGCCAATCACAGG - Intergenic
919955195 1:202407574-202407596 CACACAGGGCAGACAGTTGCTGG + Intronic
923857760 1:237863431-237863453 CCCCCAGGACAGCCAATCACAGG + Intergenic
1067165627 10:43864423-43864445 CACCCAAGGCAGGCAGTGGTGGG - Intergenic
1067183884 10:44011003-44011025 CACAGAGGGCAGCCCCTGACTGG - Intergenic
1067229820 10:44398367-44398389 CACCCAGCTCACCCAGTGAGTGG + Intergenic
1067289767 10:44932347-44932369 CACCAGGAGCAGCCAGTCACTGG + Intronic
1067294846 10:44969726-44969748 CTGCCAGGACAGCCAGTGATGGG + Intronic
1067846235 10:49723896-49723918 CACCCTGGGGAACCAGGGACAGG + Intergenic
1069725295 10:70573665-70573687 CACCCAGAGAAGGCAGTGACTGG - Intergenic
1069874508 10:71553384-71553406 GCCCCAGGGCACCAAGTGACAGG + Intronic
1069894578 10:71672582-71672604 CAGCCTGGGCAGGCAGTGAGAGG + Intronic
1070552753 10:77503760-77503782 AACTCAGGGGAGCCAGTGACTGG + Intronic
1072722595 10:97789983-97790005 CACCCAGGACAGCAAGTGGGTGG + Intergenic
1072934656 10:99700602-99700624 CACCGAGGGAGGCCAATGACAGG + Intronic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1074957638 10:118407939-118407961 TACCCACTGCAGCCAGTGAGAGG + Intergenic
1075684339 10:124353420-124353442 CTCCCAGGGCAGCCCATGACAGG + Intergenic
1075961531 10:126571437-126571459 CAGCCAGGGCAGTCAGGGACAGG + Intronic
1076023366 10:127092383-127092405 CACAGAGGGCGGCCAGTGCCAGG - Intronic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1076662040 10:132062143-132062165 AAACCTGGGCAGCCAGTGAGTGG + Intergenic
1076694947 10:132242918-132242940 CACCCAGGGGAACCACAGACCGG + Intronic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1077050533 11:564427-564449 CACTCAGGTCAGCCAGTCCCAGG + Intergenic
1077055158 11:588164-588186 CACCCAGGGTTCCTAGTGACTGG + Intronic
1077155177 11:1087907-1087929 CCCTCAGACCAGCCAGTGACTGG + Intergenic
1077245629 11:1535988-1536010 CATTCTGGGCAGCCAGTGACAGG - Intergenic
1077296129 11:1827054-1827076 CAGCCCGGGCAGCCAGTGGGTGG + Intergenic
1077296942 11:1830819-1830841 CGCCCAGGGCCGCGTGTGACCGG + Intronic
1077315996 11:1919621-1919643 CACCCCGGCCACCCAGTCACTGG + Exonic
1077458210 11:2693664-2693686 CAGACAGAGCAGCCAGAGACTGG + Intronic
1081527174 11:43935053-43935075 CAGCCAGAGCAGCCTGTGCCGGG - Intronic
1081913968 11:46719271-46719293 TACACAGGGCAGCCAGGGCCAGG - Exonic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083096171 11:60253761-60253783 GACCCAGCTCTGCCAGTGACTGG + Intergenic
1083106305 11:60361588-60361610 GACCCAGCTCTGCCAGTGACTGG - Intronic
1083158864 11:60842365-60842387 CCCCAAGGGCAGCCAGAGCCAGG + Exonic
1084273400 11:68040455-68040477 GACCCAGGGGAGGAAGTGACTGG + Intronic
1084496339 11:69505778-69505800 CACCAAGGGCCTCCAGTGGCCGG + Intergenic
1084706036 11:70816497-70816519 CACCCAGGGCCCCCAGAGGCTGG + Intronic
1084785341 11:71438676-71438698 CTCCCAGGGCTGGCAGAGACAGG + Intronic
1085533113 11:77203238-77203260 TGCCCAGGGGAGCCAGGGACCGG + Intronic
1089606418 11:119644053-119644075 CTCCCAGGGAAGCCATTGAGAGG - Intronic
1091006207 11:131956032-131956054 CAGGCAGGGAAGCCAGTGTCTGG + Intronic
1092153756 12:6268817-6268839 CATCCAGGGAAGGCAGTGCCTGG - Intergenic
1092192889 12:6533478-6533500 CCCCCGGCGCAGCCAGTGAAAGG + Intergenic
1093247305 12:16755374-16755396 CAACCAGGGACTCCAGTGACAGG - Intergenic
1100407913 12:94287038-94287060 TAACCATGGCAGCCAGTGCCTGG + Intronic
1101514136 12:105418888-105418910 CACCCAGGGCAGCGTGTTAATGG - Intergenic
1102712693 12:114941941-114941963 CAAGGAGGGCAGTCAGTGACTGG - Intergenic
1103101380 12:118179268-118179290 CTCCCTGGGCATGCAGTGACTGG - Intronic
1103898816 12:124292684-124292706 CACACAGGGCAGCCTGTTTCAGG + Intronic
1103983318 12:124750855-124750877 TGCCCAGGGGAACCAGTGACTGG - Intergenic
1105022712 12:132828214-132828236 CACCCAGGGTCGCCAGCGAGAGG - Intronic
1107347488 13:39477515-39477537 CACCCAGGGGATTCAGTAACAGG - Intronic
1108358992 13:49652470-49652492 CTCCCAGGGCAGCAGGTGGCTGG - Intergenic
1110324558 13:74199085-74199107 CTCACAGGACAGCCAGAGACTGG + Intergenic
1112047398 13:95612330-95612352 CACCTAGAGCAGCCAGGGCCAGG - Intronic
1112253716 13:97808228-97808250 CACTCATGGCAGCCGGGGACAGG - Intergenic
1118327277 14:64790149-64790171 CACCCAGTCTAGCCAGTGATGGG - Intronic
1119898736 14:78242641-78242663 CAGCCAGGGAGGCCAGGGACAGG - Intronic
1120223763 14:81766786-81766808 CACCCCAGGCATCCTGTGACAGG + Intergenic
1121121631 14:91379478-91379500 CACCCGGGGCAGCTAGGAACTGG + Intronic
1121321499 14:92994296-92994318 CTCCCAGAGGAGCCAGTGCCTGG - Intronic
1122052837 14:99071734-99071756 GACCCAGGGCAGCCTGTTCCAGG - Intergenic
1122115102 14:99523600-99523622 CAGCCAGGGCAGCCGGGCACTGG + Intronic
1122125174 14:99574952-99574974 GACCCTGAGAAGCCAGTGACTGG + Intronic
1122155455 14:99747741-99747763 CACTCAGGCCTCCCAGTGACTGG - Intronic
1122823429 14:104358499-104358521 CACCCATGGCTCCCAGTGCCTGG - Intergenic
1122859012 14:104573949-104573971 CACCTTGGGCAGTCAGTGCCTGG - Intronic
1123123880 14:105930567-105930589 AACCCAGGGAAGCCATTGCCAGG - Intronic
1123458539 15:20446934-20446956 CACCCAGGGCACCAATTGTCAGG - Intergenic
1123659524 15:22553475-22553497 CACCCAGGGCACCAATTGTCAGG + Intergenic
1123922930 15:25083270-25083292 TAACCAGGGAAGCCAGAGACAGG + Intergenic
1124264828 15:28223104-28223126 CACCCAGGGCACCAATTGTCAGG - Intronic
1124313385 15:28647970-28647992 CACCCAGGGCACCAATTGTCAGG + Intergenic
1128892761 15:71345370-71345392 CACCCCGGGCTGCCTGTGAGAGG + Intronic
1129200176 15:73993951-73993973 GATCCTGGGAAGCCAGTGACTGG - Intronic
1130313112 15:82771796-82771818 CACACAGGGCAGCCAGAGACTGG + Intronic
1131571477 15:93541685-93541707 CACCCAGGGCACTCAGTGATGGG + Intergenic
1132146498 15:99432759-99432781 CAGCCACTCCAGCCAGTGACTGG - Intergenic
1132347048 15:101114665-101114687 CTCCCAGGGCAGCCAAGGCCAGG + Intergenic
1132497926 16:272646-272668 CACCCAGGGCAGCAGGTGGGAGG + Intronic
1132624214 16:882585-882607 CACCCAGGGGAGCCCATAACAGG + Intronic
1132723172 16:1327048-1327070 AGCCCAGGGGAGCCAGGGACAGG - Intergenic
1133056301 16:3147189-3147211 CACAGAGGGCAGCCAGTGGCTGG + Intronic
1133204680 16:4226255-4226277 CACCTAGGGCAGCCATTGGATGG + Intronic
1134322962 16:13180368-13180390 CACCAAGGTCAGCCATGGACAGG - Intronic
1134516870 16:14894558-14894580 GACCCAGGGCACACAGTGATGGG - Intronic
1134704540 16:16293212-16293234 GACCCAGGGCACACAGTGATGGG - Intronic
1134963002 16:18418902-18418924 GACCCAGGGCACACAGTGATGGG + Intronic
1134967297 16:18501501-18501523 GACCCAGGGCACACAGTGATGGG + Intronic
1135989425 16:27208701-27208723 CACCCAGGGAGGCCAGGGATGGG + Intronic
1136356095 16:29745611-29745633 CACGCAGGGGAGCCAGTGGGAGG - Intronic
1136702982 16:32160220-32160242 CACCCAGGGCACCAATTGTCAGG - Intergenic
1136764718 16:32767376-32767398 CACCCAGGGCACCAATTGTCAGG + Intergenic
1136803381 16:33103008-33103030 CACCCAGGGCACCAATTGTCAGG - Intergenic
1139452597 16:67042547-67042569 CACCCAGTGCAGTCAGTCCCAGG - Intronic
1139655030 16:68382363-68382385 CACCCAGGGCTGGCAGGGGCAGG + Intronic
1139841341 16:69883267-69883289 CACCCTGGTCAACCAGGGACAGG - Intronic
1141645938 16:85367638-85367660 GCCCCGGGGCAGCCAGTGCCTGG + Intergenic
1142156236 16:88533944-88533966 CAGCGAGGGCAGCCAGAGCCCGG + Exonic
1142433582 16:90043537-90043559 CACCCAGGGAAGGGAGCGACAGG - Exonic
1203067074 16_KI270728v1_random:1029501-1029523 CACCCAGGGCACCAATTGTCAGG + Intergenic
1143369516 17:6429651-6429673 AATGCAGGGCAGCCAGTGCCAGG - Intronic
1143457366 17:7076889-7076911 CACCCTGGGAAGTCAGTGCCTGG + Exonic
1144457555 17:15431502-15431524 CACCCAGTGCTGCCTGTGCCAGG - Intergenic
1144949136 17:18984704-18984726 CTCCCAGGCCAACCAGAGACAGG - Intronic
1145936007 17:28715266-28715288 CTCCCATGGCAGGCAGTGGCTGG - Exonic
1146474654 17:33153212-33153234 CACCCAGGGCCCCCAGTGTGGGG + Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1147188679 17:38726428-38726450 GACCCAGGGCAGCCAAGGGCAGG + Exonic
1147759417 17:42787880-42787902 CACCGAGGGCAGGCAGAGATGGG - Exonic
1148496257 17:48054982-48055004 GCCCCAGGGCAGCCGGTGCCGGG - Intronic
1148724353 17:49777775-49777797 CTCTCAGGGCAACCAGTGCCTGG - Intronic
1148777808 17:50105440-50105462 CACCCAGGGCCCCCACTCACTGG - Exonic
1148874010 17:50675850-50675872 CAGCCATGGCAGTCAGGGACAGG - Intronic
1150103925 17:62447928-62447950 TACCCATGGCAGCCAGGCACTGG + Intronic
1150221416 17:63497636-63497658 CTCACAGGGAAGCCAGGGACAGG + Intronic
1150286959 17:63960136-63960158 GACCCAGGGCAGCTGGTGCCTGG - Intronic
1151917327 17:77127929-77127951 CACCCAGGGCAACCAGCAGCCGG + Intronic
1152768583 17:82154092-82154114 CAGCCCTGGCGGCCAGTGACTGG + Intronic
1153496544 18:5705164-5705186 GACCTTGGGCAGGCAGTGACAGG + Intergenic
1153591936 18:6683340-6683362 CACCCTGGGCAGGCAGTGGAAGG + Intergenic
1157294497 18:46433098-46433120 CACCCGGGGCAGCCTGGGGCTGG - Intronic
1157580643 18:48771995-48772017 CTCCCTGGGGAGCCAGGGACAGG - Intronic
1157598611 18:48879006-48879028 CACCCAGGGCAGCCTGAGCAGGG + Intergenic
1157598671 18:48879240-48879262 CTCTCAGGGCAGCCGCTGACAGG - Intergenic
1157682309 18:49616603-49616625 CACCCCAGGTAGGCAGTGACTGG - Intergenic
1157780322 18:50432695-50432717 CCCTCGGGGCAGGCAGTGACGGG - Intergenic
1158524731 18:58202461-58202483 CACCCAGGGAATCCAGTAATTGG - Intronic
1160718027 19:585279-585301 CACGCTGGACACCCAGTGACGGG - Intergenic
1160718103 19:585499-585521 CACCAAGAGCACCCAGGGACGGG - Intergenic
1160871192 19:1278690-1278712 CACCCAGGTCAGGCAGGGGCAGG - Intronic
1161327759 19:3671641-3671663 CTCCCAGGGCAGGCAGGAACGGG + Intronic
1162015811 19:7846041-7846063 CTCCCAGGGCAGGCCGTGGCGGG + Intronic
1162145379 19:8609802-8609824 CACCCCGCGCAACCAGAGACCGG + Intronic
1162462942 19:10824087-10824109 CCCTCACGGAAGCCAGTGACCGG + Intronic
1162808243 19:13150078-13150100 TACCCAAGCCAGCCAGTGCCCGG - Intronic
1163124346 19:15236686-15236708 CGCCCAGGGCAGACAGGGACAGG + Exonic
1163321216 19:16576146-16576168 AATCCAGGCCAGCCAGTGGCCGG - Exonic
1164682735 19:30146319-30146341 CAGCCAGGGCAGCCAGGGCGGGG + Intergenic
1165014438 19:32870461-32870483 CATCCAGGGCTGCCAGGGTCTGG + Intergenic
1165190152 19:34056414-34056436 CACCCAGGGCAGCCTGACCCAGG + Intergenic
1166219339 19:41354646-41354668 CACCCCGGACACCCAGTGATGGG - Exonic
1166747338 19:45147605-45147627 CACCTGGGGCTGCCAGGGACAGG - Intronic
1167056274 19:47113049-47113071 CACCCAGGGCGGGCAGAGAAGGG - Intronic
1167158818 19:47754950-47754972 CACCCAGGGCAGCCCATGGTGGG - Intronic
1167606327 19:50482657-50482679 CACCTAGCCCAGCCAGGGACAGG - Exonic
1168292347 19:55362730-55362752 CACCTGGGGCAGCCAGGGAGAGG + Exonic
925994957 2:9284691-9284713 CACCCATGGCAGCCACTGCAAGG - Intronic
926155761 2:10453181-10453203 GACCCAGGGCCACCAGTGAAGGG - Intergenic
927146666 2:20170743-20170765 CACTTAGGGCAGCCAGTGCGCGG + Intergenic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
928411895 2:31060746-31060768 CTCCAAGGGAAGCCAGTGAGGGG + Intronic
932458856 2:71869186-71869208 CAACCAGGGCAACCAGTGAGTGG + Intergenic
932764951 2:74463573-74463595 CTCCCAGGGCACCCAGTGCAAGG - Intronic
933899819 2:86841396-86841418 CGCCCAGGGCACCCAGAGCCAGG - Intronic
933997071 2:87677838-87677860 CACACAGGGCTGCCATTCACAGG + Intergenic
934732808 2:96670004-96670026 AGCCCCGGGCAGGCAGTGACTGG + Intergenic
935780739 2:106507829-106507851 CGCCCAGGGCACCCAGAGCCAGG + Intergenic
936296777 2:111273072-111273094 CACACAGGGCTGCCATTCACAGG - Intergenic
937678768 2:124621721-124621743 CACCCAGGTCTGCCAGTGTAGGG + Intronic
938746737 2:134286235-134286257 CAGCCAGGCCAGCCTGTCACAGG - Intronic
938810033 2:134844450-134844472 AAAACAGGGCAGCCAGTGAAAGG + Intronic
946054212 2:216886825-216886847 CATCCTGGGCAGCCAGTGTAGGG - Intergenic
946596418 2:221310473-221310495 GACCCAAGGCAGCCATTTACAGG + Intergenic
947708133 2:232292914-232292936 CACCCAGGGAAGCCTGTTCCTGG + Intronic
948814434 2:240502637-240502659 CACTCTGGGCAGCCAGGGCCAGG - Intronic
1168831414 20:847086-847108 CAGCCAAGGCAGCCTGTGAAAGG - Intronic
1169132568 20:3173644-3173666 CCCCCAGGGCAGCCAATGCCCGG + Intergenic
1171190833 20:23158157-23158179 CACCCAGGGCTGCCTGAGAATGG - Intergenic
1173522824 20:43712042-43712064 CAGCCAGGCCAGGCAGTGCCTGG + Intronic
1175479306 20:59300418-59300440 CACCCAGGACAGCGAGGGGCGGG - Exonic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1176058535 20:63161517-63161539 CACCCAGGGCAGGGAATGGCAGG - Intergenic
1177659269 21:24062180-24062202 AACCCAGGGCCTCCACTGACTGG + Intergenic
1179287762 21:39992691-39992713 CATCCAGTGCAGTCAGTGAATGG - Intergenic
1179628162 21:42660125-42660147 CACCCAGGGGAGCAGGTGATTGG - Intronic
1179722950 21:43325708-43325730 CAGCCCGGGGAGCCAGTGCCTGG - Intergenic
1179878928 21:44285512-44285534 CACCCTGGGCAGCCCCTGCCAGG + Intergenic
1179974909 21:44859261-44859283 CCCCCATGGGAGCCACTGACTGG - Intronic
1181029350 22:20142470-20142492 CACTCAGGGCAGCCAGAGGGAGG - Intronic
1181045512 22:20212321-20212343 CACCCAGGGAAGCCTGGGGCCGG - Intergenic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181876290 22:25943358-25943380 CAAATAGGGCAGCCAGTGAGGGG - Intronic
1182316095 22:29448460-29448482 GGCCCAGGTGAGCCAGTGACAGG - Intergenic
1182402330 22:30089199-30089221 CACCAAGGATAGCCTGTGACCGG - Intronic
1183156440 22:36079232-36079254 CACCCAGGGCAGACATTACCAGG - Intergenic
1183193499 22:36336878-36336900 CCGCCAGGGCATCCAGTAACAGG + Intronic
1184206136 22:43004792-43004814 CGCCCAGGGAGGCCTGTGACGGG - Intronic
1184331487 22:43830650-43830672 CAGTCAGGGCACCCCGTGACTGG + Intronic
1184673528 22:46027962-46027984 CACCCACGGCAGCCGGAGAGGGG - Intergenic
1184774796 22:46617763-46617785 CACCCAGGGGGGCCAGGGAGCGG - Intronic
1184858023 22:47157043-47157065 CACCGGGGGCACCCAGTGCCTGG - Intronic
1184991258 22:48171506-48171528 CCCCCAGGGCAGACAGGGAGGGG - Intergenic
1185203234 22:49521322-49521344 CACCCAGGGCTGCCAATGATCGG + Intronic
1185311464 22:50158050-50158072 AACCCAGGGCAGCGAGGCACGGG + Exonic
950790889 3:15470911-15470933 CACCCAGAACAGGCAGTGAGAGG + Intronic
951072930 3:18353200-18353222 CACCCCGGGTGGCCAGTGACTGG + Intronic
951529250 3:23683364-23683386 CCCACAGGGCAGGCAGCGACTGG + Intergenic
954540268 3:51389055-51389077 CCCCCAAGGCAGCCAGTGCACGG + Exonic
954681417 3:52348000-52348022 CAGCCAGGGCAGCAGGTGCCTGG - Intronic
958468096 3:94483277-94483299 GACCCAGGGCAGGGAGTGCCAGG + Intergenic
961739821 3:129026255-129026277 CACCCCAGGCAGCCTGTGCCAGG + Intronic
962848260 3:139289319-139289341 TACCCAGGGAAGCCAGTGATGGG + Intronic
965922356 3:173932848-173932870 CTCCTGGGGCAGCCAGTGTCTGG - Intronic
967155445 3:186687506-186687528 CACTCGGGGCAGCCAATGCCTGG + Intergenic
967956762 3:194883390-194883412 CAGCCAGAGGAGCCATTGACAGG + Intergenic
969724963 4:8913251-8913273 CACCCAGGACAGGCTGTGCCTGG - Intergenic
972484217 4:39527162-39527184 GACCCAGCGCAGCGAGCGACCGG + Intronic
975925433 4:79445420-79445442 CACCCAGTGAAGCCGGAGACTGG - Intergenic
976149977 4:82081877-82081899 AACCCAGGGGAGACAATGACGGG - Intergenic
978878677 4:113673681-113673703 CCCTAAGGGCAGCCAGTGAGTGG + Intronic
979391299 4:120130840-120130862 CTCCGAGGCCAGCCAGTGGCTGG - Intergenic
981505207 4:145492192-145492214 CACCCAGCCCAGCCAGTGTTTGG - Intronic
985423031 4:189803332-189803354 CACCCAGGGAAGTCAGGGGCTGG - Intergenic
985623337 5:968025-968047 CACCCAGGGAAGCCAGCCCCAGG + Intergenic
985846612 5:2354217-2354239 CACCCAGGGAGGCCAGAGCCAGG - Intergenic
986782090 5:11075640-11075662 CACCCGGGGCAGCCAGTGGAGGG + Intronic
988990529 5:36666071-36666093 CACCCAGGAAAGGCAGTGAGGGG - Intronic
990597142 5:57323225-57323247 CTCCCAGGGCAGCCAGTGGGAGG - Intergenic
997417683 5:133741531-133741553 CACCCATAGCAGCCAGGGAATGG + Intergenic
997692231 5:135834683-135834705 CAGCCCGCGCAGCCGGTGACTGG + Intronic
998108311 5:139482220-139482242 CATCCAGAGCAGCCAGTGTCCGG - Exonic
999630999 5:153571296-153571318 CTCACGGGGTAGCCAGTGACAGG + Intronic
1000040964 5:157484919-157484941 CTCCCAGGGCAACCAGCCACAGG + Intronic
1000387139 5:160685475-160685497 CACCCTGGGCAGCCAAGAACAGG + Intronic
1002319922 5:178368935-178368957 CAGCCAGGGCAGCCTGAGATGGG + Intronic
1002705182 5:181155890-181155912 AACCCAGGGCATCCAGTGCCTGG + Exonic
1004348001 6:14866237-14866259 CTCCCAGGACTCCCAGTGACTGG + Intergenic
1005500125 6:26422093-26422115 CACCCAGAGCAGGCAGGGACAGG - Intergenic
1005504603 6:26458611-26458633 CACCCAGAGCAGGCAGGGACAGG - Exonic
1006403291 6:33830055-33830077 CACCCAGGGCAGTGAGGGAGGGG - Intergenic
1007509132 6:42362058-42362080 CACCCAGGGCCAGCAGTGTCAGG - Intronic
1007745470 6:44040576-44040598 TACCCAGGGAAGCTACTGACTGG + Intergenic
1010751094 6:79616775-79616797 CAACAAGGGCAGCATGTGACAGG - Intergenic
1011351220 6:86425986-86426008 CACCTAGGGAAACCAGTGAGAGG - Intergenic
1017751075 6:157491045-157491067 TGCCCATGCCAGCCAGTGACAGG - Intronic
1018872616 6:167795244-167795266 CACCCAGGGCCGCCATTCACGGG + Intronic
1019504349 7:1383397-1383419 CACCCAGAGCAGCCAGAAAGTGG + Intergenic
1019713576 7:2528468-2528490 GCCCCAGGGCAGCCAGGGTCAGG + Intronic
1019746320 7:2702160-2702182 CTCCCAGGGCAGCCCCTGAAGGG - Intronic
1020601775 7:10283966-10283988 AACCCAAAGCAGCCTGTGACAGG - Intergenic
1028217119 7:88147264-88147286 CTCCTAGGGCAGCCAGAGGCAGG + Intronic
1029548314 7:101222878-101222900 CAGCCATGGGAGCCAGTCACTGG - Intronic
1029589694 7:101499152-101499174 TCCCCAGGTCAGCCAGTGCCAGG - Intronic
1032088134 7:128894205-128894227 CACACAGGGCAGCAGGTGCCTGG + Exonic
1035252535 7:157606446-157606468 CAGCCAGGGATGGCAGTGACAGG - Intronic
1035469369 7:159099916-159099938 CACCCAGCTCAGCCAGGGAGAGG - Intronic
1035781736 8:2233256-2233278 CACACAGGCCAGGCAGGGACAGG + Intergenic
1037758584 8:21727309-21727331 CTCCCATGGGAGCCAGGGACAGG + Intronic
1038205384 8:25459565-25459587 CACCCAGAGCAGCTCCTGACAGG - Intronic
1039476405 8:37841460-37841482 CACCCGGGGCAGCCAGCGCTGGG - Exonic
1041371622 8:57166695-57166717 CACCCAGTTCAGCCAGTGAGAGG - Intergenic
1042317027 8:67435681-67435703 GACCCAGGGCAGCCAAGGGCAGG + Intronic
1045131944 8:99163618-99163640 CACCCTCGGCAGCCACTGGCCGG + Intronic
1045483533 8:102612214-102612236 CACCCAAGGCAGAAGGTGACGGG + Intergenic
1047774391 8:128057558-128057580 CTCCCACGTCAGCCAGTGCCAGG - Intergenic
1049360500 8:142210486-142210508 GGCTCAGGGCAGCCAGTCACAGG + Intergenic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1050063621 9:1736048-1736070 CAGCCAGGGCAGCCTCTGGCTGG - Intergenic
1056020194 9:82432177-82432199 CACCCAGAGCTGCCAGCCACAGG - Intergenic
1056572252 9:87825865-87825887 CACCCAGAGCTGCCAGCCACAGG + Intergenic
1056756701 9:89386241-89386263 CACCCAGGGCAGACAGACAGAGG + Intronic
1057496522 9:95565394-95565416 CTCCCAGGGCAGCCAGTGCTGGG + Intergenic
1058564350 9:106265765-106265787 AATCCAGGGCAGCAAGTGAGAGG + Intergenic
1059335445 9:113565810-113565832 TCCCCAGGGCAGCCATTGATAGG + Intronic
1060025511 9:120167595-120167617 CTTCCAGGGCAGCAAGTGAATGG + Intergenic
1060213128 9:121722588-121722610 AACCCAGGGCTCCCACTGACTGG + Intronic
1061265167 9:129500604-129500626 CACCCTGGGCAGCCAGATAGGGG - Intergenic
1061933800 9:133846550-133846572 GGGCCAGGGCAGCCAGGGACAGG - Intronic
1062210410 9:135360538-135360560 CACCCAGGGGAGCGTGAGACTGG + Intergenic
1062342719 9:136100861-136100883 CACCCAGTGCAGCCGGTGGTGGG - Intergenic
1186137514 X:6534628-6534650 CACCCAGGGCTACCATTGGCTGG - Exonic
1187106659 X:16250210-16250232 TCCCAAGGGCAGCCAATGACAGG + Intergenic
1187737776 X:22322186-22322208 GACCCAGGGCATCAAGAGACAGG - Intergenic
1188537068 X:31209143-31209165 CAGCCATGGCCGCCAGTGAGAGG + Intronic
1190152269 X:47958234-47958256 CATCCAGGGCAGCCATGGCCTGG + Intronic
1190160393 X:48027894-48027916 CATCCAGGGCAGCCATGGCCTGG - Intronic
1198271953 X:135063620-135063642 CAACCAGGGAAGGCTGTGACAGG + Intergenic
1201438861 Y:13986571-13986593 CACCCAGGGCTACCATTGGCTGG - Intergenic
1201445712 Y:14056137-14056159 CACCCAGGGCTACCATTGGCTGG + Intergenic
1202579412 Y:26363579-26363601 CACACAGGGCAGACAGTTGCTGG - Intergenic