ID: 1073527187

View in Genome Browser
Species Human (GRCh38)
Location 10:104195023-104195045
Sequence TCTCCTTCATTCCAGGGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073527183_1073527187 4 Left 1073527183 10:104194996-104195018 CCCAAAATAAAAATAATCAGCTG 0: 1
1: 2
2: 46
3: 1075
4: 2554
Right 1073527187 10:104195023-104195045 TCTCCTTCATTCCAGGGCGATGG No data
1073527184_1073527187 3 Left 1073527184 10:104194997-104195019 CCAAAATAAAAATAATCAGCTGA No data
Right 1073527187 10:104195023-104195045 TCTCCTTCATTCCAGGGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073527187 Original CRISPR TCTCCTTCATTCCAGGGCGA TGG Intronic
No off target data available for this crispr