ID: 1073533044

View in Genome Browser
Species Human (GRCh38)
Location 10:104250576-104250598
Sequence TGCCCATAGCCACAGTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073533044_1073533045 -5 Left 1073533044 10:104250576-104250598 CCTTTTAACTGTGGCTATGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1073533045 10:104250594-104250616 GGGCAGCATGTCAACATAAAAGG No data
1073533044_1073533046 1 Left 1073533044 10:104250576-104250598 CCTTTTAACTGTGGCTATGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1073533046 10:104250600-104250622 CATGTCAACATAAAAGGAAGAGG No data
1073533044_1073533047 2 Left 1073533044 10:104250576-104250598 CCTTTTAACTGTGGCTATGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG No data
1073533044_1073533048 26 Left 1073533044 10:104250576-104250598 CCTTTTAACTGTGGCTATGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1073533048 10:104250625-104250647 GAACCAAAATTAATGCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073533044 Original CRISPR TGCCCATAGCCACAGTTAAA AGG (reversed) Intronic
901868120 1:12121047-12121069 TGGGAATAGCCACAGTTAATGGG + Intronic
902733643 1:18385831-18385853 TTCCCAGAGCCACAGACAAAAGG + Intergenic
907070998 1:51534799-51534821 TGCCCAAAGACACAGTGACATGG - Intergenic
907666628 1:56438744-56438766 TGCCCAAAGTCACAGTTAATAGG - Intergenic
914384788 1:147158017-147158039 TGACCCTAGCCACACTGAAAGGG - Exonic
917274291 1:173314917-173314939 TAGCTATGGCCACAGTTAAATGG + Intergenic
917627247 1:176858919-176858941 TGCCCAAGTTCACAGTTAAATGG - Intronic
919782230 1:201228492-201228514 TGCCCAGAGCCCCAGGAAAATGG + Exonic
920393667 1:205628145-205628167 TCCCCATAGCCTCACTTAAGCGG + Intronic
922852132 1:228741766-228741788 TGCCTATAGTCACAGTTACTTGG - Intronic
923541181 1:234889282-234889304 TGCCCCTACCCACAGGCAAAGGG - Intergenic
1069397501 10:68005825-68005847 TGCCCATAGTCCCAGTTATTTGG - Intronic
1069863620 10:71486649-71486671 AGGCCATAGCCACAGTTGCATGG + Intronic
1070200057 10:74195800-74195822 TGCCTATAGCCCCAGTTACTAGG - Intronic
1073533044 10:104250576-104250598 TGCCCATAGCCACAGTTAAAAGG - Intronic
1073623103 10:105069347-105069369 TGCTCTTGGCCACAGTGAAAAGG - Intronic
1073679607 10:105688088-105688110 TGCCCTTATCCAGAGTAAAATGG - Intergenic
1077348965 11:2081712-2081734 TGCCCATAGTCACAGCTACTCGG - Intergenic
1077650841 11:3970975-3970997 TGCCCTTATCCAGAGTAAAATGG + Intronic
1078966685 11:16352870-16352892 TGCCCAGAATGACAGTTAAAAGG - Intronic
1080747100 11:35117850-35117872 TGCCCAGAGTCACAGGTAAGTGG - Intergenic
1084829242 11:71756060-71756082 TGCCTATAGCCCCAGCTAATTGG - Intergenic
1088429995 11:109748507-109748529 TGCCTGTAGACACAGCTAAAAGG + Intergenic
1090643389 11:128747969-128747991 TGACCATAACCACATTTAAAGGG - Intronic
1092977258 12:13757377-13757399 TGGCCATAGCCACAAATAAAAGG + Intronic
1096714134 12:53480956-53480978 TGCCCTTAGCCACAGCTCTACGG + Intronic
1097177300 12:57150811-57150833 TGCTCATAGCCTCAGTTGGAAGG + Intronic
1098301595 12:69059943-69059965 TGCCTATAGCCCCAGTTACTTGG + Intergenic
1098599253 12:72310349-72310371 TGCCCATAGGCACAGGCCAAAGG - Intronic
1101302927 12:103500083-103500105 TAGCCATAGTAACAGTTAAAAGG - Intergenic
1101440193 12:104698157-104698179 AGGCCATAGCAACAGTTACAGGG - Intronic
1103929732 12:124443626-124443648 TGCCTATAGCCCCAGTTACTTGG - Intronic
1110018466 13:70438971-70438993 TGCCCACAGTCACAGCTAAGTGG - Intergenic
1110679085 13:78286304-78286326 TTCCCATATCAACAGATAAATGG + Intergenic
1111556798 13:89891554-89891576 TGCCCATTGACACAGTTGAATGG + Intergenic
1113328343 13:109305332-109305354 TGTGCATGGCCACAGTGAAAAGG + Intergenic
1115057792 14:29151967-29151989 TGCCCATAGTCCCAGTTACTTGG + Intergenic
1115857787 14:37649640-37649662 GGCCCATGGCCTCAGGTAAAAGG - Intronic
1116735006 14:48678057-48678079 TGCAAATAGCCACAGTAAAAAGG + Intergenic
1116924947 14:50624942-50624964 TGCCCATAGTCCCAGTTACTTGG + Intronic
1120281878 14:82449570-82449592 TGCTATTAGCCAAAGTTAAAAGG - Intergenic
1121406699 14:93723347-93723369 TCCCCAGAGCCACAGTCAGAAGG + Intronic
1121410312 14:93744797-93744819 TGCCCATAACCACAGGTGAGAGG + Intronic
1121435913 14:93919271-93919293 TGCCCTTAGCTACACTTCAAGGG + Intronic
1121908137 14:97766152-97766174 TGCCGGTAGCCACAGTTACATGG - Intergenic
1122730570 14:103794206-103794228 TGCACAGATCCACAGTGAAACGG + Intronic
1124174939 15:27415840-27415862 AGCAAATAGCCACAGATAAAAGG + Intronic
1126091532 15:45057037-45057059 TGCCCTTATCCAGAGTAAAATGG - Intronic
1126669514 15:51103313-51103335 TGCCCACAGGCACAGTCAAGAGG - Intronic
1127294535 15:57597905-57597927 TCCCCCTAGCCACACTTACAAGG + Intronic
1127675947 15:61239195-61239217 TGGCCAAATCCACAGTCAAAAGG + Intergenic
1128235130 15:66061759-66061781 TGCCCATAGTCCCAGTTACTTGG - Intronic
1129059538 15:72849719-72849741 TGCCCATAGTCCCAGTTACTCGG + Intergenic
1131853899 15:96571635-96571657 TGGCCAAACCCACAGTCAAAGGG - Intergenic
1133503648 16:6389218-6389240 TGCCCACAGACACAGAAAAATGG - Intronic
1140561072 16:75982501-75982523 TGCCAAGATACACAGTTAAAAGG - Intergenic
1143484815 17:7248133-7248155 TGCCCATAGCCCCAGCTACTCGG + Intronic
1144643573 17:16953076-16953098 TGACCACAGCAACAGGTAAAGGG - Intronic
1145205176 17:20981003-20981025 TGACCACAGCAACAGGTAAAGGG + Intergenic
1146091847 17:29887031-29887053 TGACCAGAGCCAGAGTTAAGTGG + Intronic
1146591323 17:34130392-34130414 TGCCCATATCCCCATTTATACGG - Intronic
1147251835 17:39157315-39157337 TGCCCAGAGACACAGCTAAGGGG - Intronic
1150053586 17:61990115-61990137 TGCCCACATCAAAAGTTAAATGG + Intronic
1150559149 17:66280218-66280240 TGCCCATAGTCCCAGTTACTCGG + Intergenic
1152462142 17:80447040-80447062 TGCCCAGGGCCACAGTCCAAGGG - Intergenic
1152598029 17:81247414-81247436 TGTCCAGAGCAACAGTCAAAAGG + Intronic
1155048576 18:22126916-22126938 TGCCCATTTCCACATTAAAAGGG - Intergenic
1157340811 18:46776626-46776648 TGTGCATAGCCACACTTAAGTGG + Intergenic
1159429199 18:68329350-68329372 TGCCCATATCCCCATGTAAAAGG + Intergenic
1166322980 19:42030582-42030604 TGCCTATAGTCACAGTTACTCGG - Intronic
925926222 2:8672678-8672700 TGCCCATAGCCCCAGCTACTTGG + Intergenic
926073970 2:9925506-9925528 TACCCATAGTCACAGCTAATGGG + Intronic
926573176 2:14552145-14552167 TGCCCGTAGTCACAGTTAGGAGG + Intergenic
926641631 2:15244143-15244165 TGCCCGTAGCCACATCTACAGGG - Intronic
927166592 2:20329304-20329326 TGCCTATAGCCACAGCTACTCGG + Intronic
937843948 2:126556843-126556865 TGCCCTTATCCAGAGTAAAATGG + Intergenic
939322695 2:140644778-140644800 TGCTCTTTGCCACAGTGAAATGG + Intronic
944769387 2:202898274-202898296 TGCCCATAGTCCCAGTTACTCGG - Intronic
945284077 2:208064943-208064965 TGCCCAAACCCACTCTTAAAAGG - Intergenic
945534739 2:211001433-211001455 TGTCCATAGTCACATTTACAAGG - Intergenic
945617280 2:212087839-212087861 TGCCCAAAGTCACAAGTAAATGG - Intronic
946584266 2:221166546-221166568 TCCTCACAGCCACAGTTCAAAGG - Intergenic
947161283 2:227217509-227217531 TACCAATAGCCACAGTTTATAGG + Intronic
1169748833 20:8970680-8970702 CCCCCATAGCCACAGGTAACAGG + Intergenic
1171480068 20:25448003-25448025 TGCCTGTAGTCACAGTTACACGG + Exonic
1172121157 20:32599537-32599559 TGCCTATAGCCCCAGCTACATGG - Intronic
1176957134 21:15118600-15118622 TGCCTATAGCCCCAGTTACTCGG + Intergenic
1177379872 21:20326340-20326362 TGCCCATAGCCCCAGCTACTTGG + Intergenic
1178070236 21:28957145-28957167 TGCCCACTGCCACTGTCAAATGG + Intronic
1178170852 21:30038401-30038423 TGCCCATAGTCCCAGTTACTCGG - Intergenic
1178402597 21:32299458-32299480 TGCCCATAGTCTCAGTTACTTGG - Intronic
1181371838 22:22425056-22425078 TGCCCATAGTCACAGCTACTTGG - Intergenic
1181975487 22:26726393-26726415 TGCCCAAACCCACAGTCAAAGGG + Intergenic
1182250453 22:28995899-28995921 TGCCTATAGTCACAGTTACTCGG - Intronic
1182368462 22:29794181-29794203 GGCCAAGAGCCACTGTTAAAAGG + Intronic
1184866969 22:47206840-47206862 TGCCCAGAGCGGCAGTTCAAAGG - Intergenic
949865267 3:8542118-8542140 TGCCTATAGCCCCAGCTAATTGG - Intronic
950290759 3:11782419-11782441 TGCCCATAGTCTCAGTTACTTGG + Intergenic
950734886 3:14998874-14998896 CGCCCATAGTCCCAGTTACATGG + Intronic
951758358 3:26117732-26117754 TCCTCCTGGCCACAGTTAAACGG - Intergenic
955090289 3:55743790-55743812 TACCCAGGGCCACAGTCAAAAGG - Intronic
956147113 3:66201457-66201479 TGCCCATAGTCACAGCTACTTGG - Intronic
956599944 3:71009872-71009894 TGCCCATAGTCTTAGTTAATTGG - Intronic
957479024 3:80767628-80767650 TGCACATATCCACATTTTAAGGG + Intergenic
959002882 3:100985273-100985295 TGCCCATAGTCACAGCTACTCGG - Intronic
959391294 3:105777500-105777522 TGCCTATAGCCCCAGTTATTAGG + Intronic
959420502 3:106122215-106122237 TGCCCATGGCAACATTTATATGG - Intergenic
959611346 3:108298299-108298321 TGTTTATAGCCCCAGTTAAACGG - Intronic
960597824 3:119422561-119422583 AACCCATAGACACAGTTAAAGGG - Intergenic
960607427 3:119521565-119521587 TGCCTATAGCCCCAGTTACTTGG + Intronic
960923831 3:122777296-122777318 TGCCCGAAGCCACAAATAAAAGG + Intronic
961249164 3:125485118-125485140 TGCCTATAGTCCCAGTTACATGG + Intronic
962563367 3:136631969-136631991 TGCTAAAAACCACAGTTAAAGGG + Intronic
963903164 3:150752012-150752034 TGTCCATAGCCAGAGTTAGCAGG + Intronic
965587435 3:170331341-170331363 AGCCCGCAGCCACAGTGAAAGGG + Intergenic
965976171 3:174625182-174625204 TGCCCATAGTCCCAGTTACCTGG - Intronic
967874100 3:194254861-194254883 TGCCTGTAGCCACAGTTACTCGG + Intergenic
967919917 3:194606818-194606840 TGCCCATAGTCTCAGTTATTTGG + Intronic
968123652 3:196143281-196143303 TGCCCACAGCCACAGAGAGAAGG + Intergenic
969087997 4:4670759-4670781 TGCCCATAGCCAGAGCCAACTGG - Intergenic
969380961 4:6797638-6797660 TGCCCATAGTCCCAGTTACCTGG + Intronic
969519341 4:7666674-7666696 TGCCCATGGCCACAGTTCATGGG + Intronic
970480948 4:16473598-16473620 TGCTCAAAGCCACAGGTAAAGGG + Intergenic
971291335 4:25343709-25343731 TGCTCTTAACCACAGTTAATGGG + Intronic
971299505 4:25430158-25430180 TGCCCAAAGCCACAGTGTCAGGG - Intergenic
971431407 4:26571877-26571899 TGCTCATGCCCACAGGTAAAAGG + Intergenic
975678698 4:76853424-76853446 TGCCCATAGTCACACTTACTTGG - Intergenic
978567763 4:110102531-110102553 TGCCCATAGTCCCAGCTACATGG + Intronic
981696193 4:147561647-147561669 TGCCTATAGCCCCAGTTACTTGG + Intergenic
983196808 4:164815682-164815704 TTCCCTTCACCACAGTTAAATGG + Intergenic
983577794 4:169276997-169277019 TGTCCAGAGGCACATTTAAAAGG + Intergenic
983662458 4:170143668-170143690 TCCCCTTGGCCACATTTAAATGG - Intergenic
986117725 5:4795867-4795889 TGCCCAAAGGCACAGCTAACTGG + Intergenic
986710507 5:10485184-10485206 TGCCCCTGGCCACAGTTGATTGG - Intergenic
987348040 5:16996333-16996355 TGCCTATAGCCCCAGCTACATGG - Intergenic
987395162 5:17416069-17416091 TGCCCATAGCCCCAGCTACTCGG - Intergenic
988770261 5:34426260-34426282 AGCAAATAGCTACAGTTAAAAGG + Intergenic
989405626 5:41057680-41057702 TGCCCATAGCCCCAGCTACTCGG - Intronic
990214547 5:53515565-53515587 TGCCTATACCCATATTTAAAGGG + Intergenic
991049831 5:62260915-62260937 TGCCCAAAGTCACAGATAAATGG - Intergenic
991901060 5:71461103-71461125 TGCCTATAGCCACAGCTACTTGG - Intronic
992787608 5:80184818-80184840 TGCCCAGAGCCAGACTTAAGAGG - Intronic
995401904 5:111751840-111751862 TCCTCATAGCCAAAGTGAAATGG - Intronic
1000311837 5:160052372-160052394 TGCCCATAGTCCCAGCTACATGG + Intronic
1000869016 5:166552343-166552365 TGTGCATTGCCAGAGTTAAAGGG - Intergenic
1001039501 5:168323419-168323441 TGCCCATAGTCCCAGTTATTTGG + Intronic
1002625071 5:180520968-180520990 TGCCCATAGTCCCAGTTACTCGG - Intronic
1003006222 6:2384389-2384411 TGGCAATTGCCACAGCTAAAAGG - Intergenic
1005584139 6:27259769-27259791 TCTCCATAGCCAGAGTAAAAGGG + Intergenic
1007391899 6:41554187-41554209 TGCCCCGAGTCACAGTTAACTGG + Intronic
1009923723 6:70095316-70095338 AACTCATATCCACAGTTAAAAGG + Intronic
1012160509 6:95879425-95879447 TGCCCCAAGCCAAAGTTAATTGG - Intergenic
1012929734 6:105304490-105304512 TGCTCTTAGCCACTGTAAAAAGG + Intronic
1013639139 6:112056385-112056407 TGCCCAGAGACAATGTTAAACGG - Intronic
1013998854 6:116342318-116342340 TGCCCAGAGCCAGAGTGCAATGG + Intronic
1014215315 6:118747153-118747175 TGCCCAAAGCCACAACTCAAAGG + Intergenic
1019521493 7:1462496-1462518 GGCCCAGAGCCACTTTTAAAGGG - Intergenic
1020174462 7:5871227-5871249 TGCCCATAGTCACAGCTACTTGG + Intergenic
1023434912 7:40132223-40132245 TGGCCTTGGCCACAGTTAATTGG + Exonic
1025787847 7:64659733-64659755 GGGCCATACCCACAGATAAAGGG + Intergenic
1026825960 7:73581615-73581637 TGCCTATAGCCCCAGCTAACTGG + Intergenic
1028940302 7:96514336-96514358 TGCCCATAGTCATAGCTAATCGG - Intronic
1031627400 7:124006215-124006237 TGGCCAAAGCCAAAGTCAAAAGG + Intergenic
1036684535 8:10900497-10900519 TGCCCATTGTAACAGTTAACAGG - Intronic
1041400853 8:57443138-57443160 TGCCCATAGTCCCAGTTACTTGG - Intergenic
1041783571 8:61606134-61606156 TGCTCACAGCAGCAGTTAAAAGG + Intronic
1042404685 8:68390571-68390593 TTCCCATAGCCAAAGAAAAAAGG - Intronic
1045302044 8:100920114-100920136 TGCCCTTATCCAGAGTAAAATGG + Exonic
1047858084 8:128934737-128934759 TGCCCATAGTCACAGCTACAAGG + Intergenic
1049589749 8:143452037-143452059 TGCCCAGAGGCACAGGCAAAGGG + Intronic
1050094746 9:2052346-2052368 TGCCTATAGCCCCAGCTACATGG + Intronic
1053046279 9:34921600-34921622 TGCCCTTATCCAGAGTAAAATGG + Intergenic
1053058873 9:35012790-35012812 TGCCTATAGTCCCAGTTATATGG + Intergenic
1054874136 9:70077534-70077556 TGTAAATAGCCACATTTAAATGG + Intronic
1059010232 9:110450051-110450073 TGCCAATAGCTTCAGGTAAAAGG - Exonic
1060610194 9:124957115-124957137 TGCCCATAGCCCCAGTTACCTGG - Intronic
1061268681 9:129523661-129523683 TGCCTATAGCCCCAGTTACTTGG + Intergenic
1188505477 X:30878372-30878394 TGCCTGTAGCCCCAGTTACATGG + Intronic
1189096770 X:38148819-38148841 TGCCCAAGGCCTCAGATAAAGGG - Intronic
1189512294 X:41675174-41675196 TGCCCTTATCCAGAGTAAAATGG + Intronic
1190074033 X:47302522-47302544 AGCCAATAGCTACAGATAAAAGG + Intergenic
1190364383 X:49677654-49677676 TAACCATAGCCATAGTTCAATGG - Intergenic
1190785544 X:53644381-53644403 TTCCCAAGTCCACAGTTAAAAGG - Intronic
1194865146 X:99055827-99055849 TTCCCATAGCCAAAATTAACTGG + Intergenic
1198174483 X:134142015-134142037 TGCCTATAGCCCCAGTTACTTGG + Intergenic
1202099922 Y:21296573-21296595 TGGCCATAGCCAGAGTGAAGGGG + Intergenic
1202257618 Y:22938221-22938243 TGCCCAAAGCCCCATTTTAAGGG + Intergenic
1202410608 Y:24571968-24571990 TGCCCAAAGCCCCATTTTAAGGG + Intergenic
1202460173 Y:25098104-25098126 TGCCCAAAGCCCCATTTTAAGGG - Intergenic