ID: 1073533047

View in Genome Browser
Species Human (GRCh38)
Location 10:104250601-104250623
Sequence ATGTCAACATAAAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073533044_1073533047 2 Left 1073533044 10:104250576-104250598 CCTTTTAACTGTGGCTATGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073533047 Original CRISPR ATGTCAACATAAAAGGAAGA GGG Intronic
No off target data available for this crispr