ID: 1073535088

View in Genome Browser
Species Human (GRCh38)
Location 10:104269167-104269189
Sequence AAGGAGGCGGGGCCTAGACG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535088_1073535097 8 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535088_1073535104 27 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535088_1073535096 3 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535088_1073535102 24 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535088 Original CRISPR AAGGAGGCGGGGCCTAGACG GGG (reversed) Exonic
900014380 1:138197-138219 CAGGAGGCTGGGCCTTGTCGAGG + Intergenic
900044245 1:493399-493421 CAGGAGGCTGGGCCTTGTCGAGG + Intergenic
900065653 1:728305-728327 CAGGAGGCTGGGCCTTGTCGAGG + Intergenic
900218658 1:1495587-1495609 AAGGCGGAGGGGCCTGGGCGCGG + Exonic
905459959 1:38116050-38116072 AATGAGGCCGGGCCTAGATGTGG - Intergenic
905925746 1:41748413-41748435 AAGGAGGTGGGGCAGAGATGAGG - Intronic
906198821 1:43946688-43946710 ACAGCGGCGGGGCCTAGACTCGG + Intergenic
906411856 1:45584748-45584770 CAGGGGGCGGGGCCTTGAGGAGG + Intronic
906529121 1:46513052-46513074 ACAGAGGCTGGGCCGAGACGGGG - Exonic
907484023 1:54764532-54764554 CAGGAGGCGGGGCTTAGGAGCGG - Intergenic
912446463 1:109740355-109740377 AAGGGGGCGGGGCCCACGCGCGG + Exonic
912800192 1:112715338-112715360 ATGGGGGCGGGGCCTGGGCGGGG - Exonic
913972189 1:143423766-143423788 GAGGAGGCGGTGCCTAGACTTGG + Intergenic
914066570 1:144249379-144249401 GAGGAGGCGGTGCCTAGACTTGG + Intergenic
914112583 1:144716975-144716997 GAGGAGGCGGTGCCTAGACTTGG - Intergenic
915519893 1:156436081-156436103 AGGGAAGGGGGCCCTAGACGGGG + Intergenic
915580385 1:156809575-156809597 GAGGAGGAGGGGCCTAGCGGGGG - Intronic
915607043 1:156958980-156959002 AAGGAGCCAGGGCCAAGAGGCGG + Intronic
916185548 1:162129113-162129135 AAGGAGGCGGAGCTTAGCTGGGG - Intronic
916226898 1:162497756-162497778 AAGGAGGGGGGGCTCAGAAGGGG - Intronic
920022678 1:202967334-202967356 CAGGAGGCGGGGCCTGGCGGGGG + Intergenic
922100436 1:222473854-222473876 CAGGAGGCCGGGCCTTGTCGAGG + Intergenic
922262053 1:223951692-223951714 CAGGAGGCTGGGCCTTGTCGAGG + Intergenic
1063555784 10:7078261-7078283 AATGAGGCGGTGCCTATATGAGG + Intergenic
1065844802 10:29735835-29735857 AACGAGGCGGGGCGTGGCCGCGG - Intronic
1066406800 10:35126749-35126771 CAGGGGGCGGGGCCAAGAGGAGG - Intergenic
1067850743 10:49752255-49752277 AAGGAGGCGTGGCCGAGCCCCGG + Intronic
1068396840 10:56473194-56473216 AAGGAGGCAGGGCTTATACTTGG - Intergenic
1069557785 10:69408876-69408898 GAGGGGGCGGGGCCTGGAGGGGG - Intronic
1069667220 10:70170661-70170683 GAGCAGGCGGGGCCGAGGCGGGG - Intergenic
1072741756 10:97914111-97914133 GAGGAGGCGAGGCCTAGGGGAGG + Intronic
1073535088 10:104269167-104269189 AAGGAGGCGGGGCCTAGACGGGG - Exonic
1076970577 11:129874-129896 CAGGAGGCTGGGCCTTGTCGAGG + Intergenic
1076986027 11:236468-236490 AAGGAGGCGGGGGCGGGGCGCGG - Intronic
1077582048 11:3423004-3423026 CAGGAGGCGGGGCCAGGGCGGGG + Intergenic
1078495353 11:11811557-11811579 ACGGAGGCGGGGCCTGGAAGGGG - Intergenic
1079243882 11:18739498-18739520 AAGGAGGCTGGGGCCACACGAGG + Intronic
1081133951 11:39414225-39414247 CAGGAGGTGGGGGCTAGAGGAGG + Intergenic
1083185523 11:61015729-61015751 CAGGGGGCGGGGCCTGGACCTGG - Exonic
1083594126 11:63910936-63910958 GGGGAGGAGGGGGCTAGACGGGG - Exonic
1084001193 11:66296172-66296194 AAGGAGGAGGGGCCTATCAGGGG - Exonic
1084088698 11:66866398-66866420 CATGAGGCGGGGGATAGACGAGG + Intronic
1084238966 11:67805821-67805843 CAGGAGGCGGGGCCAGGGCGGGG + Intergenic
1084284330 11:68121572-68121594 AAGGGGGCGGGGCGTCGAGGGGG + Intergenic
1084833468 11:71787019-71787041 CAGGAGGCGGGGCCAGGGCGGGG - Intergenic
1085037194 11:73307755-73307777 GAGGAGGCGTGGCCTGGGCGGGG + Intergenic
1088436406 11:109818084-109818106 AAGGAGGTGGGGGCCAGGCGCGG + Intergenic
1088547839 11:110979522-110979544 AAGGAGGCTGGACCTACAGGTGG - Intergenic
1089355020 11:117843872-117843894 CAGGAGGCAGGGCCAAGAGGTGG + Intronic
1089540216 11:119185403-119185425 AAGGAGGCGGGACCTGGGAGGGG + Intergenic
1089809787 11:121122202-121122224 AAGGAGGTGGGACCTTGAGGAGG + Intronic
1091335392 11:134762397-134762419 AAGGAGGCGGGGGTCAGACCGGG + Intergenic
1091349614 11:134882420-134882442 TAAGAGGCGGGGCCTTGAAGAGG + Intergenic
1094161463 12:27395251-27395273 AAGGAGGAGGAGCCCAGACAAGG - Intronic
1095276086 12:40284006-40284028 AAGGAGGCTGGCCCTGGATGTGG + Exonic
1095810980 12:46372898-46372920 AGGGAGGCGGGGCCTAGGTCTGG - Intergenic
1096536784 12:52279946-52279968 AGGGAGGTGGGCCATAGACGAGG + Intronic
1096907246 12:54946855-54946877 CAGGTGGCGGGGGCTAGTCGGGG + Intergenic
1097003996 12:55901901-55901923 AAGGAGGAGGGCGCTAGAAGAGG - Exonic
1101753495 12:107602787-107602809 AAGGAGGCGGCACCGAGGCGGGG - Intronic
1104692848 12:130839346-130839368 CTGGGGGCGGGGCCTAGGCGGGG + Intergenic
1105473369 13:20711461-20711483 TGGGAGGCGGGGCCTTGAAGAGG - Intronic
1106182948 13:27383806-27383828 AAGGAGGCGGAGTTTGGACGGGG + Intergenic
1106287279 13:28328886-28328908 AAGCAGGCGGGGCCGTGTCGAGG + Intronic
1109343037 13:61085981-61086003 AAGGTAGAGGGGCCTAGAAGAGG + Intergenic
1114318355 14:21526394-21526416 AGGGAGGCGGGAGCTAGAGGAGG + Intronic
1116809430 14:49524994-49525016 AAGGAGGAGGGGGTCAGACGTGG + Intergenic
1117368086 14:55051311-55051333 AAGGAGGCTGGGTATGGACGCGG - Intergenic
1118825471 14:69376390-69376412 AAGGAGGCTGGGCATAGAATGGG - Intergenic
1121676211 14:95754999-95755021 AAGGAGGCTGGGCTCAGACAAGG + Intergenic
1121754578 14:96392085-96392107 AAGGAGGCGGGGCCCGGGCCAGG - Intergenic
1122558245 14:102592817-102592839 GAGGAGGGGGCGCCGAGACGGGG - Exonic
1122787991 14:104172757-104172779 AAGGAGGCTGGTCCTACACATGG + Intronic
1124922160 15:34038394-34038416 ACGGAGGCGCGGCCACGACGTGG - Intronic
1127492245 15:59476166-59476188 TAGGAGGTGGGGCCTATAAGAGG - Intronic
1128300510 15:66563927-66563949 CAGGAGCCGGGGCCAAGACAGGG + Exonic
1131059446 15:89395596-89395618 CAGCAGGCAGGGCCTAGACCCGG + Intergenic
1132478537 16:154227-154249 GAGGGGGCGGGGCCTAGCCCGGG - Intronic
1132844132 16:1992261-1992283 GAGGGGGCGGGGCCTGGGCGGGG + Intronic
1132844170 16:1992373-1992395 GAGGGGGCGGAGCCTGGACGGGG + Intronic
1133350625 16:5098233-5098255 CAGGAGGCGGGGCCGGGGCGGGG + Intergenic
1134263691 16:12674550-12674572 AAGGAGGCGGGGCCTGGAAGGGG + Intronic
1135822218 16:25693830-25693852 AAGGAGGCGGAGATTAGACAGGG - Intronic
1136460694 16:30408234-30408256 AGGGAGGCTGGGCCTGGACCAGG - Intronic
1137264672 16:46859124-46859146 ATTGAGGCGGGGGCTAGAAGCGG + Intergenic
1138196257 16:55054419-55054441 AATGAGGTGGGGCCTAGGCAGGG + Intergenic
1138660074 16:58511601-58511623 ATGGCGGTGGGGCCTCGACGTGG - Exonic
1139320045 16:66107010-66107032 TAGGAGGTGGGGCCTTGAAGAGG - Intergenic
1142449671 16:90167608-90167630 CAGGAGGCTGGGCCTTGTCGAGG - Intergenic
1142457417 17:64237-64259 CAGGAGGCTGGGCCTTGTCGAGG + Intergenic
1142507167 17:371776-371798 GAGGAGGCGGGGCCTTTAGGAGG + Intronic
1144109779 17:12020779-12020801 TCGGAGGCGGGGCCAAGGCGGGG + Intergenic
1145766713 17:27463217-27463239 AAGGAGGCTGGGCCTGGGTGCGG + Intronic
1146383642 17:32350095-32350117 TAGGAGGCGGAGCCAAGAAGGGG - Exonic
1147945881 17:44079980-44080002 CAGGGGGCAGGGCCTAGACTTGG - Intronic
1151283388 17:73092722-73092744 AAGGGGGCGGGGCCCGGAGGCGG - Intergenic
1151582885 17:74990124-74990146 AAGGAGCCAGGGCATAGAGGTGG + Intronic
1151675902 17:75597189-75597211 AAGGTGGCGGGGACTGCACGAGG + Intergenic
1152049010 17:77958481-77958503 GAGGAGGCGTGGCCTGGCCGAGG + Intergenic
1152970658 18:158449-158471 ACCGGGGCGGGGCCTAGAGGTGG - Intronic
1157590928 18:48836112-48836134 AGGGAGGTGGGGCCTGGAGGTGG - Intronic
1157773841 18:50374952-50374974 AAGGAGGGGTGGCCGAGCCGGGG - Intergenic
1160901939 19:1433121-1433143 TAGTAGGCGTGGCCTGGACGTGG + Intronic
1161672837 19:5623680-5623702 ACGGAGGAGGGGACGAGACGAGG - Intronic
1162470722 19:10871013-10871035 ACGGGGGCGGGGCCTCGTCGCGG + Intergenic
1163442247 19:17328117-17328139 CAGGGGGCGGGGCCTCGCCGGGG - Intronic
1163717228 19:18879561-18879583 AAGGATGTGGGGCCTTGGCGAGG - Intronic
1163717252 19:18879623-18879645 GAGGAGGTGGGGCCTTGGCGAGG - Intronic
1163717299 19:18879748-18879770 AAGGAGGTGGGGCCTTGGTGAGG - Intronic
1164723967 19:30452910-30452932 AAGGAGGCGGGGGCTGAGCGAGG + Intronic
1166931534 19:46304249-46304271 AAGGGGGCGGGGCCTCCCCGGGG - Intronic
1166935415 19:46329522-46329544 CAGGAGGCAGGGGCAAGACGGGG - Intronic
1166981454 19:46634445-46634467 CAGGAGGAGGGGCCAGGACGAGG - Intronic
1167251140 19:48398933-48398955 GCGGGGGCGGGGCCTAGAGGGGG + Intronic
1167636584 19:50659238-50659260 AAGGAGGCGGGGCCGGCTCGAGG + Exonic
1167838637 19:52095802-52095824 CTGGGGGCGGGGCCTAGGCGGGG + Intergenic
1167915268 19:52735095-52735117 AGGTAGGCGGGGCCTGGGCGAGG + Intergenic
1167934885 19:52897742-52897764 AGGTAGGCGGGGCCTGGACTAGG + Intergenic
1167999266 19:53431908-53431930 AGGTGGGCGGGGCCTGGACGAGG - Intergenic
1168280430 19:55302586-55302608 AAGGGGCCGGGGCCTAGACTCGG + Intronic
1168351888 19:55680707-55680729 AGGGAGGCGCTGGCTAGACGTGG - Intronic
925294616 2:2768860-2768882 AGGGAAAGGGGGCCTAGACGGGG - Intergenic
932567284 2:72917880-72917902 AAGGCGGCGGCGCCAGGACGCGG + Exonic
933131010 2:78673890-78673912 AAGCAGGGGGGGCCTAGAGGTGG + Intergenic
933544364 2:83691895-83691917 AAGGAGGTGGGCCCTTGACTGGG + Intergenic
934176886 2:89584703-89584725 GAGGAGGCGGCGCCTAGACTTGG + Intergenic
934287193 2:91659063-91659085 GAGGAGGCGGCGCCTAGACTTGG + Intergenic
934933125 2:98444824-98444846 AAGGGGGCGGGGCCAGGGCGGGG + Intergenic
935612284 2:105038038-105038060 GAGGGGGCGGGGCCTAGAGACGG - Exonic
936236110 2:110744039-110744061 TAGGAGGCAGGGCCTAGGTGTGG - Intronic
936520138 2:113206751-113206773 AAGGAGGAGGGGAGCAGACGTGG - Intronic
937271272 2:120654571-120654593 CAGGGGGCGGGGCCTGGGCGAGG + Intergenic
937338417 2:121076012-121076034 CAGGAGGCGGGGTTTAGACTGGG - Intergenic
937643157 2:124236317-124236339 CAGGAGGCGTGGCCTGGACCAGG + Intronic
938377551 2:130818789-130818811 ATGGAGGTGGGGCTTAGACAGGG + Intergenic
945305456 2:208255116-208255138 GAGGAGGCGGGGCCTGGGAGGGG - Intronic
946389716 2:219408293-219408315 AAGGAGGCTGGGCCTCAAGGGGG - Intergenic
1171349246 20:24490378-24490400 AATGAGGAGAGGCCTAGAGGAGG + Intronic
1171474836 20:25400428-25400450 AACGAGACGGGGCCTGGACCCGG - Intergenic
1173821259 20:46021962-46021984 AAGGGGGCAGGGCCAAGACCGGG + Intronic
1176054297 20:63135586-63135608 GGGGAGGCGGGGCCCAGAGGGGG + Intergenic
1176146147 20:63566408-63566430 GAGGAGGCGGGACCTAGGCCAGG - Exonic
1179157421 21:38862593-38862615 GAGGAGGCTGGGCCAAGAGGGGG + Intergenic
1179165155 21:38929675-38929697 CAGGAGGTGGGGCCTTGAAGAGG + Intergenic
1179444269 21:41420457-41420479 AAGGGGGCGGTGCCACGACGAGG - Intronic
1179632133 21:42685130-42685152 ATGAAGGCGGGGCCTCGGCGTGG + Intronic
1180110057 21:45643401-45643423 GAGGAGGCGGGGCCTCGAACGGG - Intergenic
1181299786 22:21871533-21871555 AAGGAGACGGGGGCCAGGCGCGG + Intergenic
1182295041 22:29307378-29307400 GAGGAGGCGGGGCCTGGCCCTGG + Intronic
1182639315 22:31753947-31753969 AAGGAGGCGGGGCCCCGGGGCGG + Intronic
1183248660 22:36712806-36712828 AGGGAGGCGGGGCCTGGTCAGGG + Intergenic
1183912982 22:41092561-41092583 AAGGAGGCGGGGGCGAAAAGGGG - Exonic
1184100142 22:42337779-42337801 AAGGAGGCAGAGCCCAGATGTGG - Intronic
953518808 3:43622044-43622066 GACGCGGCGGGGCCTAGATGCGG + Exonic
954198069 3:49007904-49007926 AAGGAGACGGGGCCGAGCTGGGG + Intronic
954397301 3:50299525-50299547 AAGGAGGAGGGGCCTGTATGGGG - Intergenic
957054892 3:75435580-75435602 CAGGAGGCGGGGCCGGGGCGGGG + Intergenic
957054925 3:75435694-75435716 CAGGAGGCGGGGCCGAGTCCGGG + Intergenic
961299941 3:125916094-125916116 CAGGAGGCGGGGCCAGGGCGGGG - Intergenic
961888563 3:130111979-130112001 CAGGAGGCGGGGCCGGGGCGGGG + Intronic
962842840 3:139251445-139251467 GAGGAGGCCGGGGCTGGACGAGG - Intronic
967760433 3:193218236-193218258 AAGGAGGAGGGGACTGGAAGAGG + Intergenic
968616646 4:1580562-1580584 TAGGAGGCGGGGCCTAGGGCGGG - Intergenic
969816625 4:9691964-9691986 CAGGAGGCGGGGCCGGGGCGGGG - Intergenic
970620254 4:17810760-17810782 AAGGGGGAGGGGCCTTGACTCGG - Intergenic
971125073 4:23744903-23744925 GAGGAGGCAGTGCCTAGACGTGG - Intergenic
975779160 4:77820305-77820327 AAGGAGGCGGGGCGGTGACGGGG + Intergenic
979259379 4:118633786-118633808 CAGGAGGCCGGGCCTTGTCGAGG - Intergenic
981592782 4:146382974-146382996 GAGGAGGCAGTGCCTAGAGGTGG - Intronic
988174028 5:27697001-27697023 AAGGAGGTGGGGCCTTTAAGAGG + Intergenic
988265266 5:28941487-28941509 CAGGAGCCGGGGCCTAGAGTTGG + Intergenic
988825238 5:34929453-34929475 AGGAAGGCGGGGCCTTGGCGAGG - Intergenic
989214038 5:38885156-38885178 AAGGAGAAGGGGCCAAGATGAGG + Intronic
991481624 5:67087326-67087348 GAGGAGGAGGGACCTAGACCAGG - Intronic
994197416 5:96935883-96935905 CTGGGGGCGGGGCCTAGGCGGGG - Exonic
997613689 5:135232097-135232119 AAGGAGGGGGGACATAGAAGTGG - Intronic
999265965 5:150267089-150267111 AAGGAGGTGGGGCCAAGTTGGGG + Intronic
999616770 5:153433160-153433182 TAGGAGTCTGGGCCTAGACCTGG + Intergenic
999953181 5:156672025-156672047 ATGGAGGCAGGGCCTAGAGGAGG - Intronic
1000282332 5:159792986-159793008 AAGAAGGCGGGGCCGGGGCGGGG + Intergenic
1001652367 5:173324951-173324973 AAGGAGGGGAGGCGAAGACGGGG - Intronic
1001947960 5:175796509-175796531 AAGGAGGCGGGGGCTGGCGGCGG - Exonic
1002729598 5:181325530-181325552 CAGGAGGCTGGGCCTTGTCGAGG - Intergenic
1003078025 6:2999710-2999732 GTGGAGGCGGGGCCTGGGCGCGG + Intronic
1005882933 6:30074404-30074426 AAGGAGCCGGGGCCCAGGAGAGG + Intronic
1006340197 6:33442659-33442681 AAGGGGGTGAGGCCTAGAGGAGG - Intronic
1006505489 6:34486194-34486216 AGGGAGGCAGGGCCTAGGGGTGG + Intronic
1006924819 6:37648507-37648529 ACGCAGGCGGAGCCCAGACGTGG + Intronic
1007264583 6:40587007-40587029 AAGGATGCGTGGCCGAGCCGGGG - Exonic
1007318578 6:41009761-41009783 AAGGAGGCTGTGCATAGACCAGG + Intergenic
1012443215 6:99281571-99281593 AAGGAGGTGGGGCCTTTAAGAGG + Intronic
1013366276 6:109440670-109440692 CAGGAGGCGGGGCCCAGGGGCGG + Exonic
1017532965 6:155314740-155314762 GACGAGGCGGGGCCTGGACAGGG + Intergenic
1019381692 7:727397-727419 AGGGGGGCGGGGCCGAGCCGCGG - Intronic
1021615633 7:22500216-22500238 AAGGAGGCGGGGCCTGCAGCAGG - Exonic
1022570241 7:31445514-31445536 AAGAAGGCAGTGCCTAGACGTGG - Intergenic
1023400822 7:39792316-39792338 CAGGAGGCCGGGCCTTGTCGAGG - Intergenic
1023850206 7:44146127-44146149 GAGGAGGCGGGGTCCGGACGGGG - Intronic
1026639860 7:72114701-72114723 AAGGAGGCTGGGGCTAGGCATGG + Intronic
1028376867 7:90154419-90154441 AAGGAGGCGGGGCCTGCAGCTGG + Exonic
1029149665 7:98470843-98470865 CACGGGGCGGGGCCTTGACGAGG - Intergenic
1032051319 7:128652651-128652673 CAGGAGGCTGGGCCTTGTCGAGG - Intergenic
1032082757 7:128868328-128868350 CAGGAGGCGAGCCCTAGAAGCGG + Intronic
1032503639 7:132419005-132419027 AAGGAGACGGTGCCTGTACGTGG - Intronic
1035068479 7:156124473-156124495 AAGGAGGCAGGGCCTGGCCGTGG + Intergenic
1048540137 8:135334827-135334849 CAGGAGGCAGTGCCTAGACAAGG - Intergenic
1049222105 8:141432907-141432929 ATGGAGGCGGGGCCTGGGGGGGG + Intergenic
1049239846 8:141531785-141531807 AAGGAGGTGGGGGCCAGAGGAGG + Intergenic
1049508933 8:143018284-143018306 AAGGAGGCCGGGCCTGGCCGTGG + Intronic
1049557299 8:143289450-143289472 GAGGAGGCGGGGCCAAGGCGAGG + Intergenic
1049760669 8:144330750-144330772 AAGGCGGCGGGGCACAGGCGGGG + Exonic
1049795586 8:144496005-144496027 GAGGAGGCGGGGCCTACCCTTGG + Intronic
1050472652 9:6008300-6008322 AAGGAGGCGGTGCACGGACGGGG + Intergenic
1056163608 9:83921522-83921544 ATGGGGGCGGGGCCAGGACGCGG - Intergenic
1056471454 9:86908427-86908449 AAGGAGGCGGGGTGTAGTTGTGG + Intergenic
1059801395 9:117752921-117752943 AAGGAGTCAGGGGCTAGGCGTGG - Intergenic
1061095076 9:128451946-128451968 AAGGAAGCGGGGCCCAGCCTGGG + Intergenic
1061245951 9:129401430-129401452 AAGGAGCCGGGCCCTAGCCTAGG + Intergenic
1061777807 9:132977650-132977672 GAGGAGGCGGGGGCCAGAGGAGG + Intronic
1061807473 9:133144427-133144449 AACCAGGCGGGGCCGAGGCGGGG - Intronic
1061811178 9:133163557-133163579 CGGGAGGCGGGGGCGAGACGGGG - Intronic
1062483492 9:136763185-136763207 GAGGAGGCGGAGCCTAAACTCGG + Intronic
1203577568 Un_KI270745v1:20799-20821 CAGGAGGCTGGGCCTTGTCGAGG - Intergenic
1185621366 X:1453013-1453035 ATGGAGGCGTGGCCTGGGCGCGG - Intronic
1185621427 X:1453245-1453267 AAGGAGGTGTGGCCTGGGCGTGG - Intronic
1186137460 X:6534350-6534372 AAGGAGGCGAGGGGAAGACGAGG + Intronic
1186266972 X:7843329-7843351 AAGGAGGCGAGGGGAAGACGAGG - Intronic
1186298132 X:8170496-8170518 AAGGAGGCGAGGGGAAGACGAGG + Intronic
1186324662 X:8465576-8465598 AAGGAGGCGAGGGGAAGACGAGG - Intronic
1188482917 X:30653196-30653218 ACGGGGGCGGGGCCTGGGCGCGG - Intergenic
1193293742 X:79809258-79809280 CAGGAGCCAGGGCCTAGACTTGG + Intergenic
1196407583 X:115380819-115380841 TAGGAGGTGGGGCCTATAGGAGG + Intergenic
1200057855 X:153470832-153470854 AAGGAGGCGGGGCGGACACCGGG + Intronic
1201371858 Y:13274260-13274282 AAGGAGTCGGGGGCTAGGGGAGG - Intronic