ID: 1073535089

View in Genome Browser
Species Human (GRCh38)
Location 10:104269168-104269190
Sequence CAAGGAGGCGGGGCCTAGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535089_1073535097 7 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535089_1073535104 26 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535089_1073535096 2 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535089_1073535102 23 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535089 Original CRISPR CAAGGAGGCGGGGCCTAGAC GGG (reversed) Exonic