ID: 1073535089

View in Genome Browser
Species Human (GRCh38)
Location 10:104269168-104269190
Sequence CAAGGAGGCGGGGCCTAGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535089_1073535096 2 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535089_1073535104 26 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535089_1073535102 23 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535089_1073535097 7 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535089 Original CRISPR CAAGGAGGCGGGGCCTAGAC GGG (reversed) Exonic
902333577 1:15742667-15742689 GAAGGGGGCGGGGCCAAGGCAGG - Intronic
902532952 1:17102322-17102344 CAGGGAGGTGGAGCCTAGCCTGG - Intronic
902821758 1:18947689-18947711 CAAAGAGCAGGGGCCTGGACAGG + Intronic
903023726 1:20412116-20412138 CAAGGAGGTGGCCCCTAAACTGG - Intergenic
903125110 1:21242508-21242530 CAAGGAGGAGGGACCTGGCCTGG + Intronic
903829276 1:26164884-26164906 AAAAGAGGCGGGGCACAGACAGG + Intergenic
904463200 1:30692620-30692642 CAAGGAGGTGCTGCCTACACTGG + Intergenic
904976522 1:34461057-34461079 CAAGCAGGGTGGGGCTAGACGGG - Intergenic
905014151 1:34765621-34765643 CAATGTGGCGGGGCCAAGGCAGG + Intronic
905675220 1:39819813-39819835 CAAGGATCCTGAGCCTAGACAGG + Intergenic
905910231 1:41648416-41648438 GAAGGTGGCAGGGCCCAGACTGG + Intronic
906161251 1:43650512-43650534 CAAGGCGGCGGGGCCGGGAGGGG + Intronic
906679577 1:47716634-47716656 CAAGGAGGCAGGGTCTATAGTGG - Intergenic
907303533 1:53502201-53502223 CAAGGAGGCGGGGGAGGGACAGG + Intergenic
912800193 1:112715339-112715361 CATGGGGGCGGGGCCTGGGCGGG - Exonic
915519892 1:156436080-156436102 CAGGGAAGGGGGCCCTAGACGGG + Intergenic
916185549 1:162129114-162129136 CAAGGAGGCGGAGCTTAGCTGGG - Intronic
918049807 1:180964349-180964371 CCAGGAACCGGGGCCTGGACAGG - Intergenic
918059451 1:181048877-181048899 CCAGGAACCGGGGCCTGGACAGG - Intronic
919763192 1:201111131-201111153 CAAGGAGGGAGGGCCTAGGAGGG + Intronic
921286420 1:213613764-213613786 CAAGTTGGCTGGGCCCAGACAGG + Intergenic
1062951046 10:1503788-1503810 CAAGGGGGCGGGGCGTGGGCAGG - Intronic
1064156876 10:12909720-12909742 CAAGGAGGGGGATCCTAGACAGG + Intronic
1069766189 10:70861940-70861962 CAAGGAGGCTGGGGCCACACAGG - Intronic
1072757449 10:98030477-98030499 CTAGGCGGCGGGGCCGAGAGCGG - Exonic
1073535089 10:104269168-104269190 CAAGGAGGCGGGGCCTAGACGGG - Exonic
1073544051 10:104334324-104334346 CATGGAGGCTGGGCCAAGGCTGG - Intronic
1074095161 10:110305049-110305071 GAAGTAGGCGGGGCCTAGGAAGG + Intergenic
1074753737 10:116609739-116609761 CGCGGAGGCGGGGCCCAGGCGGG + Intergenic
1076547980 10:131258529-131258551 CCAGGAGGCTGGGTCTGGACCGG - Intronic
1077582079 11:3423117-3423139 CCGGGAGGCGGGGCCGAGTCCGG + Intergenic
1078210301 11:9265067-9265089 CATGGCGCCGGGGCCGAGACCGG + Exonic
1078495354 11:11811558-11811580 AACGGAGGCGGGGCCTGGAAGGG - Intergenic
1080569191 11:33541090-33541112 CAAGGAGGCAGGGCATAAGCTGG - Intergenic
1080655910 11:34258028-34258050 CAAGGAGGCAAGGCCCAGGCAGG + Intronic
1080786058 11:35476217-35476239 GATGGAGGCTGGGGCTAGACAGG - Intronic
1081545361 11:44067668-44067690 CATGCAGGTGGGGCCCAGACAGG - Exonic
1082004570 11:47412446-47412468 CAAGGAGGAGGGGACCAGCCAGG + Exonic
1083610449 11:64001757-64001779 CAAGAAGGCAGGGCCCAGAGCGG + Intronic
1084001194 11:66296173-66296195 CAAGGAGGAGGGGCCTATCAGGG - Exonic
1084044115 11:66559384-66559406 CAAGTAGGCGGGGCCTCGCGGGG + Exonic
1084833436 11:71786906-71786928 CCGGGAGGCGGGGCCGAGTCCGG - Intergenic
1084890436 11:72234157-72234179 CAAGGAGGCAGGGCCAGGAGGGG - Intronic
1084927574 11:72525688-72525710 CAAAGAGGCGGGGCCTTGATTGG + Intergenic
1085050681 11:73378629-73378651 CTAGTAGGCGTGGCCTAGCCAGG + Intronic
1089540215 11:119185402-119185424 CAAGGAGGCGGGACCTGGGAGGG + Intergenic
1090482671 11:127081890-127081912 CAAGGCGGCGGGCCCTGGAGTGG + Intergenic
1090669715 11:128937741-128937763 CCAGGAGGCAGGGCCTGGGCAGG - Exonic
1090788428 11:130069772-130069794 CAAGGGGGCGGGGTCTTGAGGGG + Intergenic
1091335391 11:134762396-134762418 AAAGGAGGCGGGGGTCAGACCGG + Intergenic
1096646775 12:53042791-53042813 CAAGGAGGTGGAGCATAGAAAGG + Intergenic
1099441708 12:82707182-82707204 CAAGGAAGTGGGGCCTCTACAGG - Intronic
1102255044 12:111410277-111410299 CAAGGAGGAGAGGCCCAGAGAGG + Intronic
1104692847 12:130839345-130839367 CCTGGGGGCGGGGCCTAGGCGGG + Intergenic
1105243541 13:18628417-18628439 GACGGGGGCGGGGCCTGGACAGG - Intergenic
1109336724 13:61003764-61003786 CCAGGAGTTGGGGCCTAGAATGG + Intergenic
1115730377 14:36262277-36262299 GAAGGAGGAGGGGGCTATACTGG + Intergenic
1118825472 14:69376391-69376413 AAAGGAGGCTGGGCATAGAATGG - Intergenic
1119181471 14:72608144-72608166 CAAGGAGGCAGGCACCAGACAGG - Intergenic
1122084432 14:99289931-99289953 AAAGGAGGCTGGACGTAGACGGG - Intergenic
1122264564 14:100540616-100540638 CAGGGCGGCGGGGCCTTGGCTGG - Intronic
1122289091 14:100670105-100670127 CAAGGAGTAGTGGCTTAGACAGG - Intergenic
1123487757 15:20756214-20756236 GACGGGGGCGGGGCCTGGACAGG + Intergenic
1123544256 15:21325292-21325314 GACGGGGGCGGGGCCTGGACAGG + Intergenic
1124322348 15:28724562-28724584 CAAGGAGGCAGAGCCTGGAGTGG - Intronic
1125682945 15:41544229-41544251 CAAGATGGCGGCGCCCAGACAGG - Exonic
1127775972 15:62264551-62264573 CAGGGAGCCAGGGCCTGGACAGG + Intergenic
1128300509 15:66563926-66563948 GCAGGAGCCGGGGCCAAGACAGG + Exonic
1202952602 15_KI270727v1_random:52563-52585 GACGGGGGCGGGGCCTGGACAGG + Intergenic
1132478538 16:154228-154250 TGAGGGGGCGGGGCCTAGCCCGG - Intronic
1132601431 16:774790-774812 CAAGGAGGCGGGGACGAGACGGG - Intronic
1133350657 16:5098346-5098368 CCGGGAGGCGGGGCCGAGTCCGG + Intergenic
1134263690 16:12674549-12674571 AAAGGAGGCGGGGCCTGGAAGGG + Intronic
1135822219 16:25693831-25693853 GAAGGAGGCGGAGATTAGACAGG - Intronic
1138196256 16:55054418-55054440 TAATGAGGTGGGGCCTAGGCAGG + Intergenic
1142697799 17:1643342-1643364 CAGGGGGGCGGGGCGGAGACAGG - Intronic
1144845731 17:18217904-18217926 CAAGGAGCTGGGGCCAAGAGAGG - Intergenic
1144852339 17:18250430-18250452 CAAGGAGGTGGGGCCAAGGGCGG - Intronic
1145957166 17:28862455-28862477 CAAGGAGGCCAGACCTAGGCAGG + Intergenic
1147661653 17:42120173-42120195 GAAGGAGGTGGGGCCTTGAGGGG - Intronic
1147914510 17:43878562-43878584 CAAGGAGGAGGTGCCCAGAATGG + Intronic
1149035786 17:52133098-52133120 CAAGAAGGTGAGGCCCAGACAGG - Intronic
1149347184 17:55750954-55750976 GGAGAAGGCGGGGCCTAGACTGG - Intergenic
1149436713 17:56639563-56639585 CAAGGAGGTGAGTCCTAGGCTGG + Intergenic
1149626692 17:58084530-58084552 CAAGGAGGGAGGGGCTAGGCTGG + Intronic
1151946147 17:77321023-77321045 CAAGGAGGCTGGGCCTGGGAGGG - Intronic
1154445396 18:14431464-14431486 GACGGGGGCGGGGCCTGGACAGG + Intergenic
1162572025 19:11479647-11479669 CCTGGGGGCGGGGCCTAGATGGG + Intronic
1162911679 19:13851161-13851183 CAAGGAGGTGAGGGCAAGACTGG + Intergenic
1162911846 19:13851798-13851820 CAAGGAGGGGAGGCCTAGGCAGG - Intergenic
1163651863 19:18522387-18522409 TATGGAGGCGGGGCCTGGAGGGG - Intergenic
1165329068 19:35131441-35131463 CAGGGAGGCGGGGCCCGCACAGG + Exonic
1165415802 19:35692612-35692634 CAAGGACGCGGGGACCAGAGAGG - Intergenic
1166222766 19:41376473-41376495 AAGGGAGGCGGGGCCAAGCCAGG + Exonic
1166448656 19:42879758-42879780 CAAGGAGGCAGGACTTAGAGAGG - Intronic
1166465339 19:43026550-43026572 CAAGGAGGCAGGGCTGAGAGAGG - Intronic
1166746397 19:45143912-45143934 CCAGGAGGCGGGGGCTGGAGTGG - Intronic
1167838636 19:52095801-52095823 CCTGGGGGCGGGGCCTAGGCGGG + Intergenic
1168094341 19:54106037-54106059 CAGGGAGGCTGGGCCTATTCCGG - Intronic
1168235567 19:55061060-55061082 GATGGAGGCGGGGCCAAGAGTGG - Intronic
925042275 2:740836-740858 CGAGGGGGCGGGGCCCAGCCAGG + Intergenic
928200717 2:29246173-29246195 GAAGGATGCTGGTCCTAGACAGG + Intronic
930817804 2:55617303-55617325 CGAGGAGGCGGCGGCTAGAGCGG - Exonic
931243365 2:60472040-60472062 AAAGGAGGTGGGTCCTGGACAGG - Intronic
933544363 2:83691894-83691916 AAAGGAGGTGGGCCCTTGACTGG + Intergenic
933708642 2:85309318-85309340 CAAGGGGGAGGGGCCGGGACAGG - Exonic
933752936 2:85614872-85614894 AAATGAGGCTGGGCCTTGACAGG - Intronic
934602562 2:95669003-95669025 CAAGGCGGCAAGGCCTAGCCTGG + Intergenic
934933124 2:98444823-98444845 CAAGGGGGCGGGGCCAGGGCGGG + Intergenic
937046287 2:118853773-118853795 CAGGGAGGCGCGGCCTGGATCGG - Intergenic
937096796 2:119240831-119240853 CAGGGAGCCAGGGCCCAGACAGG + Intronic
937338418 2:121076013-121076035 ACAGGAGGCGGGGTTTAGACTGG - Intergenic
937829429 2:126403376-126403398 CCAGGAGGAGGGGACCAGACAGG + Intergenic
938377550 2:130818788-130818810 AATGGAGGTGGGGCTTAGACAGG + Intergenic
938577689 2:132619636-132619658 CCAGGAGGCTGTGCCTAGACAGG - Intronic
938962320 2:136354773-136354795 CTGGGAGCCGGGGCCTAGGCTGG - Intergenic
939931634 2:148241590-148241612 CAGGGAGGGGGGGCCCAGAAAGG - Intronic
944454843 2:199882607-199882629 CAAGGAGGCTGGGCTTAGGTAGG + Intergenic
946051540 2:216866866-216866888 CAAAGAGGCAGGGGCTAGAGGGG + Intergenic
946202175 2:218076761-218076783 CCAGGAGGCGGGGCCTTTCCTGG - Intronic
946716450 2:222558778-222558800 CAAGGAGGCCAGGCGGAGACTGG + Exonic
1173178476 20:40783487-40783509 CTAGGAGGCAGGGCCTGAACAGG + Intergenic
1173821258 20:46021961-46021983 GAAGGGGGCAGGGCCAAGACCGG + Intronic
1174121397 20:48268430-48268452 CACAGTGGCGGGGCCTGGACAGG - Intergenic
1175411669 20:58774165-58774187 CCAGGAAGCGGGGCCTATGCAGG + Intergenic
1175916214 20:62427207-62427229 CAAAGAGGCCAGGCCTAGTCTGG - Intronic
1175947695 20:62566415-62566437 CCAGGAGGCGGCGCCTGGCCAGG - Intronic
1175999481 20:62825555-62825577 CCACGAGGAGGGGCCTGGACAGG + Intronic
1176450583 21:6858395-6858417 GACGGGGGCGGGGCCTGGACAGG - Intergenic
1176828753 21:13723413-13723435 GACGGGGGCGGGGCCTGGACAGG - Intergenic
1176857745 21:13985472-13985494 CCAGGAGGCTGGGCCAGGACAGG - Intergenic
1180110058 21:45643402-45643424 GGAGGAGGCGGGGCCTCGAACGG - Intergenic
1180132423 21:45835206-45835228 CCCGGGGGCGGGGCCTACACAGG + Intronic
1182380372 22:29883053-29883075 GACGGGGGCGGGGCCTGGACAGG - Intergenic
1182413016 22:30202973-30202995 CTAGGAGGCTGGGCCTACAGAGG + Intergenic
1182718509 22:32378631-32378653 CCAGGAGGCTGGGGCTGGACTGG + Intronic
1183248659 22:36712805-36712827 AAGGGAGGCGGGGCCTGGTCAGG + Intergenic
1183912983 22:41092562-41092584 CAAGGAGGCGGGGGCGAAAAGGG - Exonic
1184091478 22:42295165-42295187 CAAGGAGGAAGGGCCCAGGCTGG - Intronic
1184924176 22:47625867-47625889 CAGGGAGGCAGGGCGAAGACGGG - Intergenic
950499651 3:13355550-13355572 CAGGCAGGCGGGGCCTGGCCAGG - Intronic
956752450 3:72354011-72354033 CAAGCAGGCTGGGCCTCGTCCGG - Intergenic
957054924 3:75435693-75435715 CCAGGAGGCGGGGCCGAGTCCGG + Intergenic
963007598 3:140740623-140740645 CAAGGAGGAGAGGCCTGGAGTGG + Intergenic
966236507 3:177707155-177707177 CCAGGAGGCCGGGTCTTGACAGG + Intergenic
968572033 4:1347023-1347045 CTAGGGGGCGGGGCCTTGACCGG + Intergenic
968616647 4:1580563-1580585 GTAGGAGGCGGGGCCTAGGGCGG - Intergenic
968616663 4:1580600-1580622 GCAGGAGGCAGGGCCTAGGCGGG - Intergenic
969756266 4:9152653-9152675 CCGGGAGGCGGGGCCGAGTCCGG - Intergenic
973907693 4:55547141-55547163 CGGGGAGGCGGGGCCTGGTCGGG + Intergenic
975779159 4:77820304-77820326 GAAGGAGGCGGGGCGGTGACGGG + Intergenic
976297323 4:83485158-83485180 CGAGGAGGCGGGGCCTGCGCCGG + Exonic
979625747 4:122843286-122843308 CAAGGAGGCAGGGCCAGGTCTGG + Intronic
986300665 5:6476164-6476186 CTAGGAGGCGGGGCCTGAGCAGG + Intronic
995724108 5:115166879-115166901 CAAGGAGCCGGCGCCCATACTGG + Intronic
995836405 5:116404146-116404168 CAGGGAGGAGGGCCATAGACAGG - Intronic
1000282331 5:159792985-159793007 CAAGAAGGCGGGGCCGGGGCGGG + Intergenic
1001652368 5:173324952-173324974 CAAGGAGGGGAGGCGAAGACGGG - Intronic
1006639808 6:35484162-35484184 CAAGGTGGCGGGGCTGAGAGAGG - Intronic
1007663951 6:43503558-43503580 CAAGGAAGCAGGGCCGAGCCAGG - Intronic
1013405242 6:109837575-109837597 CGAGGAAGCAGGGCCTAGAATGG + Intergenic
1017532964 6:155314739-155314761 GGACGAGGCGGGGCCTGGACAGG + Intergenic
1018949592 6:168370582-168370604 CAAGGAGGAGGGTCCCAGCCTGG - Intergenic
1019145229 6:169971641-169971663 CAAGGAGCCGGGGTCTAGGGAGG - Intergenic
1020235067 7:6348850-6348872 GAAGGAGGCGGCGGCTAGACCGG + Exonic
1020762623 7:12287339-12287361 CAAGGAGTGGTGGGCTAGACAGG - Intergenic
1022537441 7:31106818-31106840 GAAGGAGGCAGGGCACAGACTGG + Exonic
1029361052 7:100088954-100088976 GAAGGGGGCGGGGCCGAGGCTGG + Exonic
1032068746 7:128791374-128791396 CGAGGGGGCGGGGCCTGGCCGGG - Intronic
1035417893 7:158704927-158704949 CTAAGAGGCGGGGCATAGACAGG - Intergenic
1035671274 8:1419053-1419075 CAGGGAGGCGGTGCCCAGAGAGG - Intergenic
1036379506 8:8227961-8227983 CCGGGAGGCGGGGCCGAGTCCGG - Intergenic
1036850052 8:12194654-12194676 CCGGGAGGCGGGGCCGAGTCCGG + Intergenic
1036871416 8:12436927-12436949 CCGGGAGGCGGGGCCGAGTCCGG + Intergenic
1040891784 8:52324455-52324477 CACAGAGGAGGGGCCTAGAAAGG + Intronic
1048836065 8:138520128-138520150 CATGGAGGTGGGGCATAGATTGG - Intergenic
1049222104 8:141432906-141432928 CATGGAGGCGGGGCCTGGGGGGG + Intergenic
1049760668 8:144330749-144330771 CAAGGCGGCGGGGCACAGGCGGG + Exonic
1052781028 9:32782737-32782759 CGAGGAGAAGGGGCCTTGACCGG - Intergenic
1053056635 9:34996860-34996882 CAAGGAGGTGGGGCCTAGTCAGG + Exonic
1054805990 9:69396175-69396197 CAAGGAGGAGGAGCCAAGAGAGG + Intergenic
1055091142 9:72365361-72365383 CCAGGAGGCGGGGCCGAGACGGG + Intergenic
1057030262 9:91769745-91769767 GAGGGAGGCGGGGCCGGGACGGG - Intronic
1057298654 9:93863848-93863870 GAATGGGGAGGGGCCTAGACTGG - Intergenic
1057673827 9:97121283-97121305 GAGGGAGGCGGCGGCTAGACTGG - Intergenic
1058142161 9:101368222-101368244 CAAGGAGGCGAAGCCACGACTGG + Exonic
1060831627 9:126721324-126721346 CCAGGAGGCGGAGCCAAGATCGG + Intergenic
1061095075 9:128451945-128451967 CAAGGAAGCGGGGCCCAGCCTGG + Intergenic
1061444398 9:130629683-130629705 CATGGAGGAGGGGCCGACACTGG + Intronic
1061816423 9:133199944-133199966 CAAGGAGGCTGGGGATAGAAGGG + Intergenic
1203518599 Un_GL000213v1:26122-26144 GACGGGGGCGGGGCCTGGACAGG + Intergenic
1192915512 X:75647074-75647096 CAAGGGGGTGGGGCTTTGACTGG + Intergenic
1194584930 X:95720190-95720212 GAAGGAGGCTGTGCCCAGACTGG - Intergenic
1197623576 X:128779328-128779350 CCAGGAGCTAGGGCCTAGACTGG + Intergenic
1200057854 X:153470831-153470853 GAAGGAGGCGGGGCGGACACCGG + Intronic
1201938725 Y:19435428-19435450 CAAAGAGGTGGAGCCTAGAGAGG - Intergenic