ID: 1073535090

View in Genome Browser
Species Human (GRCh38)
Location 10:104269169-104269191
Sequence GCAAGGAGGCGGGGCCTAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535090_1073535102 22 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535090_1073535104 25 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535090_1073535097 6 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535090_1073535096 1 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535090 Original CRISPR GCAAGGAGGCGGGGCCTAGA CGG (reversed) Exonic
900182601 1:1318919-1318941 GCAGGGAGGCAGGGGCTGGAGGG - Intronic
901438768 1:9264930-9264952 GGCAGGTGGCGGGGCCGAGAAGG - Exonic
901819334 1:11816681-11816703 GTGAGGAGGCAGGGCCTGGAGGG + Intronic
903017896 1:20373531-20373553 GAGAGGAGGCGGGGCCAAAATGG - Intergenic
904377067 1:30088340-30088362 GCAAAGAGGCAGGGCATGGATGG - Intergenic
904615828 1:31749093-31749115 GCAAGGACCAGGGGCTTAGATGG - Intronic
904976523 1:34461058-34461080 GCAAGCAGGGTGGGGCTAGACGG - Intergenic
905260184 1:36711756-36711778 GCAGGGAGTCTGGGCCCAGATGG + Intergenic
906161250 1:43650511-43650533 CCAAGGCGGCGGGGCCGGGAGGG + Intronic
906633163 1:47389451-47389473 GCCAGGAGGCAGGTGCTAGAAGG - Intergenic
906698431 1:47840471-47840493 GACAGGAGGCTGGGCCTATAGGG - Intronic
907726778 1:57027385-57027407 GCAAAGAGGCAGGGGCTGGATGG - Intronic
912234149 1:107830595-107830617 GCAAAGAGGCAGGGGCTGGAGGG - Intronic
913070273 1:115292286-115292308 GGGAGGAGGCATGGCCTAGAAGG + Intronic
915358915 1:155273683-155273705 GACAGGAGGCGGGGCATAGCGGG - Intronic
915519891 1:156436079-156436101 GCAGGGAAGGGGGCCCTAGACGG + Intergenic
915574647 1:156767680-156767702 GCCAGGTGGCGGGGCCTACTAGG + Exonic
915580387 1:156809577-156809599 GGGAGGAGGAGGGGCCTAGCGGG - Intronic
916185550 1:162129115-162129137 CCAAGGAGGCGGAGCTTAGCTGG - Intronic
918349195 1:183635964-183635986 CGAAGGAGGCGGGGGCGAGAGGG + Intergenic
919763191 1:201111130-201111152 GCAAGGAGGGAGGGCCTAGGAGG + Intronic
919905952 1:202078431-202078453 GCATGGAGGTGGGGCTGAGAGGG - Intergenic
920022676 1:202967332-202967354 GGCAGGAGGCGGGGCCTGGCGGG + Intergenic
920452170 1:206067736-206067758 GCAAAGAGGCAGGGACTGGAGGG - Intronic
921008508 1:211117287-211117309 GCAAGGAGGCAGGGCTTATTGGG - Intronic
921879967 1:220245151-220245173 GCAAAGAGGAGGAGCCAAGATGG + Intronic
922329364 1:224560530-224560552 GAAAGGAGGCGGAGCTTAGGTGG - Intronic
923263856 1:232293643-232293665 GGAATGAGGCGGGGACAAGAGGG - Intergenic
923959160 1:239057242-239057264 GCCAAGAGGCGGGGGCTGGAGGG - Intergenic
1065485312 10:26231215-26231237 GGAGGGAGGAAGGGCCTAGAGGG + Intronic
1065852325 10:29801173-29801195 GCTTGGAGGTGGGGCCTAGTGGG - Intergenic
1067525826 10:47038024-47038046 GGAAGGAGGAGGGGCTCAGAAGG + Intergenic
1067681656 10:48445545-48445567 GCAGGGAAGCGGGGGCTGGAAGG + Intergenic
1067842192 10:49689960-49689982 GAAAGGAGGTGGGTCCGAGAGGG + Intronic
1068856049 10:61798443-61798465 AGAAGCAGGCGGGGGCTAGATGG - Intergenic
1069596478 10:69675086-69675108 TCAAGGAGGGTTGGCCTAGATGG + Intergenic
1070179420 10:73999192-73999214 GCCAGGAGGAGGGGCCAAGGAGG - Intronic
1070525496 10:77292630-77292652 GAAAGGAGCTGGGGCCTGGAAGG - Intronic
1070786855 10:79166930-79166952 GAAAGGAGGCTGGGGCCAGATGG - Intronic
1072280389 10:93860651-93860673 TGATGGAGGTGGGGCCTAGAGGG + Intergenic
1073082411 10:100868428-100868450 GCAGGGAGACGGGGCCTGGGTGG + Intergenic
1073502034 10:103948610-103948632 TCGAAGAGGAGGGGCCTAGAAGG + Intergenic
1073535090 10:104269169-104269191 GCAAGGAGGCGGGGCCTAGACGG - Exonic
1074676078 10:115852740-115852762 TCAAGGAGGAAGGACCTAGAGGG + Intronic
1074753736 10:116609738-116609760 GCGCGGAGGCGGGGCCCAGGCGG + Intergenic
1076404147 10:130201229-130201251 GGAAGGAGGCAGGGCCTCCATGG + Intergenic
1077241441 11:1512735-1512757 GCTAGGAGGTGGGGCCTGGTGGG + Intergenic
1077265631 11:1648078-1648100 GCATGGAGACGCGGCCTGGAGGG + Intergenic
1078186455 11:9055739-9055761 GGAATGAGGCTGGGCCTGGAGGG - Intronic
1078451533 11:11444152-11444174 GCAGGGAGGCGGGGCCTGGAGGG - Intronic
1078451547 11:11444201-11444223 GCAGGGAGGCGGGGCCTGGAGGG - Intronic
1078451561 11:11444250-11444272 GCAGGGAGGCAGGGCCTGGAGGG - Intronic
1078495355 11:11811559-11811581 AAACGGAGGCGGGGCCTGGAAGG - Intergenic
1078855888 11:15206292-15206314 GCAATGAAGCTGGGCCCAGAAGG + Intronic
1079237024 11:18698583-18698605 CCAAGGGGGCGGGGCCTGGGGGG + Intronic
1080640857 11:34157532-34157554 GGCAGGAGGCAGGTCCTAGAGGG - Intronic
1081784071 11:45733957-45733979 GAAGGGAGGCTGGGCATAGAGGG - Intergenic
1083149332 11:60782096-60782118 GCAAGGAAGCGGGGCCTCCCTGG - Intergenic
1083618652 11:64038298-64038320 GCAAGGAAGCCGGTCCCAGAGGG - Intronic
1084001195 11:66296174-66296196 GCAAGGAGGAGGGGCCTATCAGG - Exonic
1084044114 11:66559383-66559405 TCAAGTAGGCGGGGCCTCGCGGG + Exonic
1084048248 11:66583379-66583401 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1084890437 11:72234158-72234180 GCAAGGAGGCAGGGCCAGGAGGG - Intronic
1084899722 11:72300572-72300594 GCAAGGAGGCTGGGCCAGGTGGG + Intronic
1085227165 11:74932431-74932453 GGGAGGAGGCTGGGCTTAGATGG - Intronic
1085353726 11:75816854-75816876 TAAAGGAGGCGGGGGCTAAAGGG + Intronic
1087202568 11:95360657-95360679 GCAAGTATGCGGGGCCCACAAGG - Intergenic
1087533758 11:99416738-99416760 GCAAGGAGGCAGAGGCTGGAGGG + Intronic
1087687527 11:101281460-101281482 GGGAGGAGGCGGAGCCAAGATGG - Intergenic
1088099661 11:106141963-106141985 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1088100280 11:106146809-106146831 GCAAAGAGACGGGGGCTGGAGGG - Intergenic
1089353071 11:117832281-117832303 GGAAGGAGGTGGGCCCCAGAGGG + Intronic
1089540214 11:119185401-119185423 TCAAGGAGGCGGGACCTGGGAGG + Intergenic
1090788427 11:130069771-130069793 GCAAGGGGGCGGGGTCTTGAGGG + Intergenic
1098268425 12:68746597-68746619 GCCAGGAGGAGGAGCCTGGAGGG - Exonic
1099466429 12:82993902-82993924 GCAAAGAGGTAGGGGCTAGATGG + Intronic
1100429549 12:94518358-94518380 CCAAGGATGCAGGGCCTAAAAGG - Intergenic
1101605994 12:106247999-106248021 GGAAGGAGGCCGGGCCGAGGAGG + Intronic
1103775713 12:123364964-123364986 GGAGGGAGGCGGGGCGGAGAGGG - Intergenic
1104692845 12:130839344-130839366 GCCTGGGGGCGGGGCCTAGGCGG + Intergenic
1105943331 13:25170344-25170366 CCAAGGAGGCGGGGAAGAGATGG - Exonic
1108069156 13:46609823-46609845 GCGGGGAGGCGGGGACCAGATGG + Intronic
1108609630 13:52071400-52071422 GCTAAGAGGCAGGGGCTAGAGGG - Intronic
1109308044 13:60662152-60662174 GGCAGGGGGCGGGGCCAAGAGGG - Intergenic
1109443608 13:62405804-62405826 GCAGCGAGGCAGGGTCTAGAAGG - Intergenic
1110363854 13:74659513-74659535 GACAGGAGGTGGGGCCCAGAAGG + Intergenic
1112095331 13:96126541-96126563 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1112490830 13:99861806-99861828 GCAAGGAGGGGGCAGCTAGAAGG + Intronic
1113907520 13:113826671-113826693 GCCAGGAGGCGGGGGAGAGAAGG - Intronic
1119318884 14:73717922-73717944 GCAAGGAGGCTGGCCCCAGGAGG + Exonic
1120970348 14:90201882-90201904 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1121818035 14:96943308-96943330 GCATGGTGGCGAGGCCTGGAAGG + Intergenic
1122118123 14:99537661-99537683 GCGGGGAGGCTGGGCCTGGATGG - Intronic
1122421089 14:101577828-101577850 GCAAGGGGGGTGGGCCTAGGTGG + Intergenic
1122526066 14:102385341-102385363 GCTGGGAGGTGGGGCCTAGTAGG - Intronic
1122982955 14:105199789-105199811 TCAATGAGGCGGGGCTGAGAGGG - Intergenic
1124121057 15:26888894-26888916 GCAAGGAGGGAGTCCCTAGAAGG + Intronic
1124196774 15:27638719-27638741 CCAAGGAGGAGGGGCTAAGACGG + Intergenic
1126387902 15:48112745-48112767 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1128342275 15:66830892-66830914 GGAAGGAGGCGGGGCAGAGGAGG - Intergenic
1129360166 15:75019535-75019557 TGAAGGAGGCGAGGCCTGGAGGG - Exonic
1129457425 15:75683248-75683270 GCAGGGAGGCTGGGCCTGGAGGG - Intronic
1129726366 15:77903697-77903719 GCAGGGAGGCTGGGCCTGGAGGG + Intergenic
1130274407 15:82469056-82469078 GCAGGGATGCTGGGCCTGGAGGG + Intergenic
1130466754 15:84196430-84196452 GCAGGGATGCTGGGCCTGGAGGG + Intergenic
1130497510 15:84477106-84477128 GCAGGGATGCTGGGCCTGGAGGG - Intergenic
1130589049 15:85201023-85201045 GCAGGGATGCTGGGCCTGGAGGG + Intergenic
1130613419 15:85381136-85381158 GCAAGGATTCGGGGCCTCGCTGG - Intronic
1132028446 15:98421622-98421644 GCCAGGAGGCTTGGCCGAGAGGG - Intergenic
1132601432 16:774791-774813 GCAAGGAGGCGGGGACGAGACGG - Intronic
1133021552 16:2969165-2969187 GCTAGGAGGCGAGGCCTGGGCGG + Intronic
1133976396 16:10602286-10602308 GCAAGGAGGGAGGGGCTGGAAGG - Intergenic
1134263689 16:12674548-12674570 GAAAGGAGGCGGGGCCTGGAAGG + Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136274551 16:29170774-29170796 GCCAGGAGGCTGGGTCCAGATGG + Intergenic
1137538028 16:49342309-49342331 GCGAGGAGGTGGGGCCTGAAAGG + Intergenic
1137561523 16:49505516-49505538 GCAAGGGGGCTGGGCCATGAGGG - Intronic
1140466918 16:75189996-75190018 GCAAAGAGGCAGGGGCTTGAGGG - Intergenic
1140874090 16:79134404-79134426 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1141042972 16:80688072-80688094 GCAAGGGTGCAGGGTCTAGATGG + Intronic
1141156675 16:81601788-81601810 GCAAGGTGACGGTGCCCAGAGGG - Intronic
1141574187 16:84953645-84953667 GCAAGGAGGCGGCTGCAAGAGGG + Intergenic
1142078838 16:88136433-88136455 GCCAGGAGGCTGGGTCCAGATGG + Intergenic
1142135803 16:88451595-88451617 GGAAGGAGGCGAGGCCTGGTGGG + Intergenic
1142217735 16:88838084-88838106 GGAAGGAGCCGGGGCCACGAGGG - Intronic
1143208407 17:5163536-5163558 GTTAGGAGGTGGGGCCTAGTAGG - Intronic
1143575809 17:7792480-7792502 GACAGGAAGCGGGACCTAGAGGG + Intronic
1144953445 17:19005732-19005754 ACAAGGATGCTGGGCCTAGGAGG - Intronic
1146383644 17:32350097-32350119 GGTAGGAGGCGGAGCCAAGAAGG - Exonic
1146660789 17:34663888-34663910 CCAAGAAGGTGGGGCTTAGATGG + Intergenic
1147661654 17:42120174-42120196 TGAAGGAGGTGGGGCCTTGAGGG - Intronic
1149314074 17:55422118-55422140 GCAGCGAGGCGGGGCCTCGCTGG + Intergenic
1149871861 17:60190008-60190030 GTTAGGAGGTGGGGCCTAGCAGG + Intronic
1151660125 17:75514575-75514597 GCCAGGAGGTGGGGCCGGGAGGG + Intronic
1151882520 17:76903933-76903955 GCAGGGAGACGGGGACCAGAGGG + Intronic
1151946148 17:77321024-77321046 CCAAGGAGGCTGGGCCTGGGAGG - Intronic
1152101713 17:78305387-78305409 GCAATGAGGAGTGGCCCAGATGG + Intergenic
1153772414 18:8426282-8426304 GCCTGGAGGCGGGGGCTGGAGGG + Intergenic
1154210852 18:12377390-12377412 GGCAGGAGGCGGGGCCGAGAAGG + Intergenic
1155565558 18:27130110-27130132 GGGAGGAGGCTGGGACTAGATGG + Intronic
1156475124 18:37401089-37401111 GCTGTGAGGCAGGGCCTAGATGG + Intronic
1157751614 18:50183742-50183764 GGTGGGAGGCGGGGCCTAGTGGG + Intronic
1158782789 18:60670790-60670812 GCAAGGAGACAGGGGCTGGAGGG - Intergenic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1160887124 19:1355183-1355205 GCGAGGAGGCCGGGCCTGGGGGG + Intronic
1160906875 19:1455763-1455785 GCAGGTGGGTGGGGCCTAGAAGG + Intronic
1161307117 19:3574268-3574290 GGATGGGGGCGGGGCCTAGCTGG - Intronic
1161443406 19:4304975-4304997 GCAGGGTGGGGGGGCGTAGAAGG - Intronic
1161866657 19:6837307-6837329 GGAAGGAGCAGGGACCTAGAAGG + Intronic
1161939745 19:7395037-7395059 GGAAGGAGGCGTGCCCTCGAGGG - Intronic
1162572023 19:11479646-11479668 CCCTGGGGGCGGGGCCTAGATGG + Intronic
1162675447 19:12294921-12294943 CCCAGGAGGCGGGACCTGGAGGG - Intergenic
1162752158 19:12835440-12835462 GGAAAGAGGCGGGGCCTGCACGG + Intronic
1163651864 19:18522388-18522410 CTATGGAGGCGGGGCCTGGAGGG - Intergenic
1163736017 19:18981324-18981346 GCAAGGAGGCTGGGCGTGGTGGG - Intergenic
1165400497 19:35596614-35596636 GCTAGGAGGCGGGGCCTGCCTGG + Intergenic
1165781634 19:38438052-38438074 GCAAGGAGGAGGGGCAAACAGGG - Intronic
1165879254 19:39031439-39031461 GGAAGGGGGCGGGGCCTCGGTGG - Intronic
1166658110 19:44627097-44627119 GCCAGGTGGCAGGGCCTCGAAGG + Intronic
1167567487 19:50266010-50266032 GCAAGGAGTCGGGGCAGAAAAGG + Intronic
1167627236 19:50599741-50599763 GCAAAGAGGCAGGGGCTAGAGGG + Intergenic
1167672060 19:50859130-50859152 CCTGGGAGGAGGGGCCTAGAGGG + Intronic
1167709857 19:51103981-51104003 GCGAGGAGGCGGGACCTGAAAGG - Intronic
1167715518 19:51140625-51140647 GCAAGGAGGAGGCGCCCAGGAGG + Intergenic
1167838634 19:52095800-52095822 GCCTGGGGGCGGGGCCTAGGCGG + Intergenic
1168276251 19:55280250-55280272 GCTTGGAGGCGGGGCCCGGATGG - Exonic
1168465019 19:56595107-56595129 CCAAGGAGGCTGGGGCGAGAGGG - Intergenic
925740283 2:6999551-6999573 TCAAGGAGTCCGGGGCTAGAGGG + Intronic
929536723 2:42788469-42788491 GCAAGGAGCCTGGCCCTAGCGGG - Intronic
929636342 2:43525569-43525591 GCTAGAAGGCTGGGCCTAGTTGG - Intronic
930655910 2:54007047-54007069 CCAAGGAGGCGGAACCTAGGAGG + Intronic
931681173 2:64751029-64751051 GCTAGGAGGCGGCGACGAGAGGG + Intergenic
932284096 2:70518210-70518232 GCCAGCAGGAGTGGCCTAGAAGG - Intronic
932539648 2:72638927-72638949 GCAAGGAGGCGTGGCCAGGCTGG - Intronic
932577940 2:72972943-72972965 GGAGGGTGGCGGGGCCTAGTGGG + Intronic
933812526 2:86041823-86041845 GCTAGGAGGCAGGGGCTAGGAGG + Intronic
935470221 2:103450458-103450480 ACAAGGAGGCAAGGCTTAGAAGG - Intergenic
937283701 2:120736867-120736889 GCAAAGAGGGGGGGCCGAGGAGG - Intronic
939341506 2:140901294-140901316 GCAAAGAGGCAGGGGCTGGAAGG - Intronic
944143840 2:196485044-196485066 GCAAGGAGGAAGGGCCAACAGGG + Intronic
945631756 2:212287129-212287151 GCAAAGAGGCAGGGGCTGGAGGG - Intronic
946051539 2:216866865-216866887 GCAAAGAGGCAGGGGCTAGAGGG + Intergenic
1168790283 20:571818-571840 GCAGGGAGGTGGGGCCGAGGGGG - Intergenic
1170947961 20:20908983-20909005 GCAAAGAGGCAGGGGCTAGAGGG + Intergenic
1172753965 20:37270521-37270543 GCAAGGAGGGGGTGTCTACAGGG + Intergenic
1172776704 20:37411684-37411706 GAAAGGAGGAGAGGCCTCGATGG - Intergenic
1174457568 20:50660578-50660600 GTTGGGAGGCGGGGCCTAGTGGG - Intronic
1174536099 20:51252591-51252613 GCAAAGAGGGAGGGCCTGGAAGG - Intergenic
1174961477 20:55161967-55161989 GCCAGGAGGCAGGGCATACAAGG - Intergenic
1175790643 20:61738063-61738085 CCAAGGAGGTGGGCCCCAGAGGG - Intronic
1175801563 20:61803922-61803944 TCCAGGAGGCGGTGCCGAGACGG + Intronic
1176053902 20:63134700-63134722 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053991 20:63134895-63134917 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054206 20:63135389-63135411 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054295 20:63135584-63135606 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1178600551 21:33990824-33990846 GAAAGGAGGAGGGGAGTAGATGG + Intergenic
1179649292 21:42796403-42796425 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
1180100591 21:45582180-45582202 GCAAGCAGGAGGGGCCCCGAGGG + Intergenic
1181998880 22:26903984-26904006 GCTAGGAAGAGGGGACTAGAAGG - Intergenic
1182137465 22:27919261-27919283 GCAGGGAGGCGGGGCCGCGCAGG - Intronic
1182294919 22:29307005-29307027 CCAGGGAGGCGGGGCGGAGACGG + Exonic
1182946480 22:34327612-34327634 GTTAGGAGGCAGGGCCTAGTGGG + Intergenic
1183356976 22:37364804-37364826 GCAAGGAGGCTGGGGCTGGGCGG + Intergenic
1183357432 22:37367189-37367211 GCAAGGAGGCTGGGGCTAGCAGG + Intergenic
1183361388 22:37384968-37384990 GCCAGGAGGGCGGGCCTAGCCGG - Intronic
1183746330 22:39694112-39694134 GCAAGGAGGCACAGCCTGGAGGG + Intergenic
1183912984 22:41092563-41092585 ACAAGGAGGCGGGGGCGAAAAGG - Exonic
1184924177 22:47625868-47625890 GCAGGGAGGCAGGGCGAAGACGG - Intergenic
950836864 3:15928625-15928647 GCACAGAGGAGGGGCATAGAGGG + Intergenic
952888279 3:38024918-38024940 CCCAGGAGGCGGGGCCGAGGAGG + Intronic
954448880 3:50561121-50561143 GTCAGGAGGCAGGGCCTGGAGGG - Intronic
954702007 3:52455502-52455524 GGAAGAAGGCGGGGCCAAGATGG + Exonic
955409047 3:58644024-58644046 GGAAGGAGGCAGGACCCAGAAGG + Intronic
959746861 3:109785743-109785765 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
961048005 3:123722515-123722537 GGAGGAAGACGGGGCCTAGAGGG + Intronic
961474241 3:127136828-127136850 GCAGGGAGGCGGGGCACAGGGGG - Intergenic
964232375 3:154486491-154486513 TCAGGGAGGAGGGGCCAAGATGG + Intergenic
967751190 3:193118220-193118242 GCAAAGAGGCAGGGCCTGGAGGG + Intergenic
968284234 3:197498919-197498941 GCAAGGCCGCGGGGCCGGGAAGG + Intergenic
968482332 4:839801-839823 GTCAGGAGGTGGGGCCTAGTGGG - Intergenic
968493220 4:901483-901505 GAGAGGAGGCGGGGCCCAGGTGG + Intronic
968616664 4:1580601-1580623 GGCAGGAGGCAGGGCCTAGGCGG - Intergenic
968753565 4:2402876-2402898 GCTAGGAGGAGGGGCCTTGGTGG - Intronic
968960313 4:3739987-3740009 ACAAGCTGGCGGGGACTAGAGGG - Intergenic
971863361 4:32137894-32137916 GAAAGGAGGCGGAGCTCAGATGG - Intergenic
972437040 4:39044756-39044778 GCGAGGGGGCGGGGCCTGGCGGG + Intergenic
974561761 4:63532518-63532540 GCAAGGGGGAGGAGCCAAGATGG + Intergenic
975779158 4:77820303-77820325 GGAAGGAGGCGGGGCGGTGACGG + Intergenic
977229423 4:94434159-94434181 GAAAGGAGGCGGAGCTCAGATGG - Intergenic
977461900 4:97336787-97336809 GAATGGAGGCAGGGCCAAGATGG + Intronic
978655513 4:111061284-111061306 GCAATGAGCCTGGGCCTAGCGGG + Intergenic
979118547 4:116861056-116861078 GCCAGGAGGCTGGCACTAGAGGG - Intergenic
979734979 4:124072501-124072523 TCAAGGGGGCAGGGCCAAGATGG + Intergenic
982087366 4:151849462-151849484 ACAAGGAGGTGGGGCCTGGTGGG + Intergenic
983919963 4:173334478-173334500 GCAAGGGGGCGGGGACTATCTGG - Exonic
984163520 4:176282352-176282374 CTGAGGAGGCGGGGCCAAGATGG + Intergenic
984349411 4:178571030-178571052 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
985489254 5:169646-169668 TCAGAGAGGCGGGGCCTACAGGG + Intronic
985840382 5:2301143-2301165 GCCAGGAGGTGGGGCCCACAGGG - Intergenic
987633869 5:20512927-20512949 CCAAGGAGACTTGGCCTAGATGG + Intronic
989843686 5:46112340-46112362 GATAGGAGGTGGGGCCAAGATGG - Intergenic
990015932 5:51063287-51063309 GATAGGAGGCAGGGCCAAGAGGG + Intergenic
995407749 5:111820045-111820067 GCAAGGAATAGGGGCCTAGGTGG - Intronic
996398158 5:123033763-123033785 GCCAGGAGGCTGTGGCTAGATGG - Intronic
996583781 5:125062179-125062201 GCAAGGAGAAGGGCCCTGGATGG + Intergenic
997582079 5:135024468-135024490 GCAAGGAGGCAGGGACCAGCAGG + Intergenic
998057602 5:139092230-139092252 GAAGGGAGGGGAGGCCTAGAGGG - Intronic
1002093551 5:176818065-176818087 GCACGGAGGCGGGGCGGAGGCGG - Intronic
1002463524 5:179389198-179389220 GCAAGGAGGCCGAGCCCAGCAGG + Intergenic
1005173172 6:23011890-23011912 GCAAGGTGGGTGGGCCCAGAGGG - Intergenic
1005656424 6:27943282-27943304 CCAAGGAGGAGGAGCCAAGATGG + Intergenic
1006022023 6:31122914-31122936 GCAGGGAGGAGTGGACTAGAAGG + Intronic
1009556553 6:65178205-65178227 GCAAAGAGGCAGGAGCTAGAGGG - Intronic
1010832714 6:80550961-80550983 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
1011664582 6:89622125-89622147 GCAAGGAGGAGAGGCAGAGAGGG - Intronic
1012741278 6:103018936-103018958 ACAGGGAGGCGGGACCAAGATGG - Intergenic
1013462669 6:110390204-110390226 GCTAGCAGTGGGGGCCTAGAAGG + Intergenic
1014670434 6:124297706-124297728 GACAGGGGGCGGGGCCAAGATGG - Intronic
1015705658 6:136084986-136085008 GCTAGGAGTCGAGACCTAGAGGG - Intronic
1015929529 6:138343919-138343941 GGCAGGAGGAGGTGCCTAGAGGG + Exonic
1018085027 6:160294096-160294118 GCCAGGGGGCGTGGCCTGGAGGG + Intergenic
1019451849 7:1102995-1103017 GTAAGGGGTCGGGGTCTAGACGG - Intronic
1019462793 7:1169995-1170017 GCAAGGGGGCGTGGCCGGGAGGG - Intergenic
1020110839 7:5446925-5446947 GCAAAGTGGAGGGGCCTACAGGG - Intronic
1021776407 7:24059270-24059292 GCCAGGAGGAGGGGCCAAGATGG + Intergenic
1023682673 7:42703462-42703484 GCAAGGAGGCCAGGCCCAGGTGG + Intergenic
1026491892 7:70870661-70870683 GGGAGGAGGAGTGGCCTAGACGG - Intergenic
1026941901 7:74291871-74291893 GCCAGGAGGGGAGGCCAAGAGGG - Intronic
1029238553 7:99143250-99143272 GCAAGGGGGCGGGGCCTGGGGGG + Intronic
1029238655 7:99143555-99143577 GCGAGGGGGCGGGGCCAGGAGGG + Intronic
1029366412 7:100119342-100119364 ACGAGGGGGCGGGGCCAAGATGG - Intronic
1029524763 7:101087943-101087965 GCCCGGAGGCCGGGCCTGGAGGG + Exonic
1035236269 7:157499482-157499504 GCAAGGCGGCGGGGTCAAGCGGG + Intergenic
1035662568 8:1359138-1359160 GCAGGGATACGTGGCCTAGAGGG - Intergenic
1035757376 8:2044260-2044282 GCCAAGAGGCGGGGCCTCAAGGG - Intergenic
1040906012 8:52470419-52470441 GCTGGGAGGTGGGGCCTAGTGGG + Intergenic
1041003701 8:53478953-53478975 GTTAGGAGGTGGGGCCTAGTGGG + Intergenic
1042902867 8:73746458-73746480 GCGAGGAGGCCGGGCCAAGTGGG - Intronic
1043271083 8:78334440-78334462 GCTGGGAGGCGGGGCCTAGTGGG - Intergenic
1043284644 8:78514333-78514355 GGAAGCAGGCAGGGCCTACATGG - Intergenic
1043358262 8:79439352-79439374 GCAAGGAGGCGCGTCTTACATGG - Intergenic
1044122349 8:88412982-88413004 GCCTGGAGGCTGGGCCAAGAGGG + Intergenic
1044746450 8:95375717-95375739 GCTAGGAGGAGGAGCCAAGATGG - Intergenic
1046133076 8:109992597-109992619 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1049166375 8:141128559-141128581 GGCTGGAGGCGGGGCCTGGAGGG - Intronic
1049203882 8:141354446-141354468 GCAAGGAGGCAGGGGCCAGCGGG - Intergenic
1049222103 8:141432905-141432927 GCATGGAGGCGGGGCCTGGGGGG + Intergenic
1049662166 8:143824363-143824385 GCAAGGAGGGGGGTCCGAGCCGG - Exonic
1050069964 9:1800178-1800200 GCCAGGAGGTGGGGCTGAGATGG + Intergenic
1051982824 9:23045428-23045450 GAAAGGGGGAGGGGCCAAGATGG + Intergenic
1052283023 9:26754430-26754452 GTGAGGAGGTGGGGCCTAGTGGG - Intergenic
1052712325 9:32071819-32071841 GCATGGATGCGGGGCCTTGTAGG - Intergenic
1053108717 9:35438213-35438235 TCAAGGAGGCTGGGACAAGAAGG - Intergenic
1055091140 9:72365360-72365382 TCCAGGAGGCGGGGCCGAGACGG + Intergenic
1056161715 9:83902767-83902789 GAAAGGAGGAGGAGCCAAGAAGG + Intronic
1057030263 9:91769746-91769768 GGAGGGAGGCGGGGCCGGGACGG - Intronic
1060043715 9:120323899-120323921 GAAAGGAGGTAGGGACTAGAAGG + Intergenic
1061096583 9:128460715-128460737 GCGAGGAGGCTGGGCTTAGCAGG - Intronic
1061816422 9:133199943-133199965 CCAAGGAGGCTGGGGATAGAAGG + Intergenic
1061869460 9:133513097-133513119 GTATGGGGGAGGGGCCTAGAGGG + Intergenic
1062730131 9:138104022-138104044 GCAAGCAGGCAGGGCCATGATGG + Intronic
1186033712 X:5397502-5397524 GCAAAGAGGCAGAGGCTAGAGGG + Intergenic
1186467378 X:9794263-9794285 GCAAAGAGGCAGGGGCTGGAGGG - Intronic
1187427100 X:19187901-19187923 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
1187588125 X:20686392-20686414 GGAGGGAGGTGGGGCCTAGTTGG + Intergenic
1191816729 X:65253660-65253682 GCAAGCAGGCGTGGCCAAGCTGG - Intergenic
1192667770 X:73106139-73106161 ACAAGGAGGAGGAGCCAAGATGG + Intergenic
1193043929 X:77032712-77032734 ACAAGGAGGAGAGGCCAAGATGG + Intergenic
1195153309 X:102096841-102096863 GACAGGAGGCGGGGCCAAGATGG + Intergenic
1195906105 X:109846013-109846035 GTCAGGAGGTGGGGCCTAGTGGG + Intergenic
1196690583 X:118554687-118554709 TGAAGAAGGCGGGGCCTCGAAGG + Intronic
1198242367 X:134798350-134798372 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1198243064 X:134803193-134803215 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1199540035 X:148948585-148948607 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1200633004 Y:5612181-5612203 GCTAGGAGGAGGAGCCAAGATGG - Intronic