ID: 1073535090

View in Genome Browser
Species Human (GRCh38)
Location 10:104269169-104269191
Sequence GCAAGGAGGCGGGGCCTAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535090_1073535102 22 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535090_1073535104 25 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535090_1073535097 6 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535090_1073535096 1 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535090 Original CRISPR GCAAGGAGGCGGGGCCTAGA CGG (reversed) Exonic