ID: 1073535091

View in Genome Browser
Species Human (GRCh38)
Location 10:104269178-104269200
Sequence GCAGCAGCAGCAAGGAGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 2, 3: 84, 4: 611}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535091_1073535096 -8 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535091_1073535107 26 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535091_1073535108 27 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1073535091_1073535102 13 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535091_1073535104 16 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535091_1073535097 -3 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535091 Original CRISPR GCAGCAGCAGCAAGGAGGCG GGG (reversed) Exonic