ID: 1073535091

View in Genome Browser
Species Human (GRCh38)
Location 10:104269178-104269200
Sequence GCAGCAGCAGCAAGGAGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 2, 3: 84, 4: 611}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535091_1073535108 27 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1073535091_1073535097 -3 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535091_1073535096 -8 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535091_1073535102 13 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535091_1073535107 26 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535091_1073535104 16 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535091 Original CRISPR GCAGCAGCAGCAAGGAGGCG GGG (reversed) Exonic
900123936 1:1061357-1061379 GCAGGAGCTGCAAGGAGTGGAGG + Intergenic
900241379 1:1619037-1619059 GCAGCTGCAGGAAGGAGCTGAGG + Intronic
900959363 1:5909415-5909437 GCACCAGCAGCCAGGAGAGGGGG + Intronic
901407610 1:9059944-9059966 GCAGCACCTGCAAGGAGCCCTGG + Intronic
901505301 1:9681391-9681413 GCAGCAGCAGCAGCCAGGCATGG - Intronic
901535837 1:9882644-9882666 GGAGCAGCAGGAAGCAGGAGAGG + Intronic
901604729 1:10450235-10450257 GCAGCAGCAGCAGGAGGCCGGGG - Exonic
901936430 1:12630256-12630278 CCAGCTGCAGCAGGGAGGCGAGG + Intergenic
902410335 1:16208269-16208291 GCAGCAGCAGGGAGGAGGTTGGG - Intronic
902644909 1:17791267-17791289 CCTGCTGCAGCAGGGAGGCGTGG - Intronic
903057383 1:20645611-20645633 GCAGCAGCATCATGGCGGCGAGG - Exonic
903217811 1:21852808-21852830 GCAGCCGCAGCAGCGAGCCGTGG + Exonic
903235040 1:21944669-21944691 GCAGGAGCAGCAAAGAGGCTCGG - Intergenic
903628010 1:24745245-24745267 GCGGCAGGAGCACGGGGGCGTGG - Intergenic
904083341 1:27885935-27885957 GAAGCAGCAGTTAGGAAGCGTGG - Exonic
904365826 1:30010432-30010454 GCAGCAGCACCCAGGAGGGCTGG + Intergenic
904409462 1:30316523-30316545 CCAACAGCAGCAAGGAAGGGAGG + Intergenic
904576269 1:31507015-31507037 GCAGCTGCAGCAAGGTGTCTGGG + Intergenic
905108346 1:35577144-35577166 GCAGCAGCAGCAAAGGGGAAGGG + Intronic
905387110 1:37612784-37612806 GCAGCAGCAGCAAGGGACAGTGG - Exonic
905519952 1:38589913-38589935 GGAGGGGCAGCAAGGAGGCCAGG + Intergenic
905654741 1:39678820-39678842 GCAGCAGTAGAAAGGAGGCTTGG - Exonic
906061177 1:42949678-42949700 GCAGCAGCAGCAGCGAGCTGAGG + Intronic
906261919 1:44399094-44399116 GAAGGAGGAGCAAGGAGGAGGGG - Intergenic
906315954 1:44786523-44786545 GCAGCACCAGCACGGACGCCAGG + Exonic
906375618 1:45294309-45294331 AAAGCAGGAGCAAGAAGGCGGGG - Intronic
907306901 1:53518252-53518274 GCACTAGCAGCAGGGAGGTGCGG + Intronic
907312380 1:53546312-53546334 GCAGCAGCAGCCAAGAGTCATGG + Intronic
907603516 1:55793773-55793795 GCAGCTGCAGCAGGGAAGCGCGG + Intergenic
909352694 1:74673418-74673440 GCAGCAGGAGGGAGGAGGAGGGG + Intronic
910208907 1:84774592-84774614 GCAGCAGCTGTGAGGAGGAGAGG + Intergenic
911329196 1:96507445-96507467 GCAACACCAGCAAGAAGGCCTGG - Intergenic
911664439 1:100538215-100538237 GCAGCAGCAGCAAGAATGCTTGG - Exonic
911793038 1:102042614-102042636 GCAGCAGGAGCAAGAAGGTAAGG - Intergenic
912264014 1:108137242-108137264 GCAGCAGCAGCACTGTGGGGTGG - Intronic
912472167 1:109913285-109913307 GCATCAGCCGCCAGGAGGCTTGG + Intronic
912942930 1:114061068-114061090 CCAGCTGCAGCAGGGAGGTGTGG + Intergenic
912996418 1:114536371-114536393 GCAGCAGCACCATGGAGGTGGGG + Intergenic
913334715 1:117698599-117698621 GCAGCAGCAGGAGAGAGGGGTGG + Intergenic
914444460 1:147738260-147738282 TCCCCAGCAGCAAGGAGGAGAGG - Intergenic
914898421 1:151697526-151697548 CCAGCTGCAGCAAGGAGGTGGGG + Exonic
914918010 1:151830218-151830240 GCAGCAGCAGCAGAGAAGGGAGG - Intronic
915478998 1:156172469-156172491 GCACCTCCAGCAAGGAGGCCTGG - Intronic
915517175 1:156420425-156420447 GCGACAGCAGCCAGGAGGCGGGG - Intronic
915841800 1:159219036-159219058 GCACCAGCACCAAGGAGAGGTGG + Intergenic
917235657 1:172888920-172888942 GCATAAGCAGCCAGGAGGTGGGG + Intergenic
917415009 1:174799865-174799887 GCAGCAGTAGCCAGGAAGCCAGG - Intronic
917815788 1:178708535-178708557 GCAGCAGCAGCAAGGGGCTTTGG + Intergenic
918125797 1:181582297-181582319 GAGGCAGCAGGAAGGAGGGGAGG + Intronic
918826981 1:189336883-189336905 GCAGCAGCAGCAGTGTGGCAGGG - Intergenic
919799506 1:201344929-201344951 GCAGCAGGAGGCAGGAGGGGTGG - Intergenic
919917591 1:202148435-202148457 GCAGCAGCAGTAAGGACAAGGGG - Exonic
920095661 1:203484969-203484991 GCAGCAGCAGAAGGGAAGAGAGG + Intronic
920374836 1:205502673-205502695 ACAGCGGCAGCAGGGAGGAGAGG - Intergenic
920413662 1:205783086-205783108 CCAGCAGCAGCACAGAGGAGAGG + Intergenic
920631438 1:207656668-207656690 GGAGCAGGAGCAAGGTGGGGAGG + Intronic
920641923 1:207760793-207760815 GCAGGAGGAGCAAGGTGGGGAGG + Intronic
920849487 1:209618874-209618896 GCTGCAGCAGGGAGGAGGAGGGG + Intronic
920850738 1:209626561-209626583 AGGGCAGCAGCAAGGAGGGGAGG - Intronic
921333290 1:214062032-214062054 TCAGCAACAGTAAGGAGGCCTGG - Intergenic
921764434 1:218953509-218953531 GCAGCAGCAGGAGGGAGGGAGGG + Intergenic
922041845 1:221904510-221904532 CCAGCTGCAGCAGGGAGGTGTGG - Intergenic
922567013 1:226607562-226607584 CCAGCTGCAGCGAGGAGGTGAGG - Exonic
922698415 1:227743501-227743523 GCAGAGGCAGCAAGGGGCCGAGG - Intronic
922996074 1:229962643-229962665 GTAGCAGCAGCTAGGAGTGGAGG + Intergenic
923018252 1:230143401-230143423 GCAGAAGCAGCAACAAGGTGTGG + Intronic
923141062 1:231162092-231162114 GCAGCGGCGGGAGGGAGGCGGGG + Intronic
923321805 1:232841795-232841817 GGAGCAGGAGCAAAGGGGCGGGG + Intergenic
923767063 1:236902081-236902103 GCAGCAGGAGGATTGAGGCGGGG - Exonic
924259246 1:242212595-242212617 GCAGCAGCCGCCAGGCAGCGGGG + Intronic
924289788 1:242524948-242524970 CCAGCAGGACCGAGGAGGCGCGG - Intergenic
1062826807 10:575958-575980 GTAGCATCTGCAAGGAGGTGGGG - Intronic
1063486268 10:6423701-6423723 GCAGCAGAAGCCAGGAGGTAGGG - Intergenic
1064665241 10:17644143-17644165 GCGGCAACAGCAAGGAGCCGAGG - Exonic
1065174227 10:23061381-23061403 GCAGCAGCAGCATGGTGCAGAGG - Intergenic
1065875414 10:29993478-29993500 GCAGCAGCCCCAGGGAGGCGAGG + Intergenic
1066101667 10:32123154-32123176 CCAGCTGCAGCAGGGAGGAGTGG - Intergenic
1066460530 10:35608529-35608551 GCTGCTGCAGGAAGGGGGCGCGG - Exonic
1066504896 10:36031273-36031295 CCAGCAGCTGCAAGGATGTGTGG + Intergenic
1067102802 10:43345032-43345054 GCAGGAGGAGCGAGGAGGCAGGG - Intergenic
1067286554 10:44911589-44911611 GGATCAGCAGCCAGGAGGCAGGG - Intronic
1067381106 10:45774241-45774263 GAAGCAGCAGCAGGGAGCCTGGG - Intronic
1067437325 10:46287295-46287317 GCAGCAGCAGCAGGAAGACCAGG - Exonic
1067888803 10:50114870-50114892 GAAGCAGCAGCAGGGAGCCTGGG - Intronic
1067941205 10:50658834-50658856 GCACCAGCAGCCAGCAGGCCAGG - Intergenic
1068130492 10:52889814-52889836 GCAGCAGCACCAGGGAGGACGGG - Intergenic
1068955627 10:62817180-62817202 GCAGCAGCTGAAGGGGGGCGGGG - Intronic
1069217687 10:65842513-65842535 GGAGCAGGAGAAAGGAGGGGGGG + Intergenic
1069249240 10:66246488-66246510 CCAGCTGCAGCAAGGAGGCATGG - Intronic
1069486632 10:68827851-68827873 GCAGCACCTGCAGGCAGGCGGGG - Exonic
1069486719 10:68828187-68828209 GCAGCACCTGCAGGCAGGCGGGG - Intronic
1069724241 10:70567152-70567174 GCAGCAGGAGTAAGGAAGTGGGG - Exonic
1069818655 10:71214213-71214235 GCAGCAGGAGGTAGGAGGTGGGG - Intronic
1070161309 10:73868263-73868285 GAAGCAGCAGGAAGAAGGCAGGG + Intronic
1070326833 10:75395321-75395343 GCAGCAGGAGAAAAGAAGCGAGG + Intergenic
1070380138 10:75873810-75873832 GGAACAGCAGCAAGGAGAGGTGG + Intronic
1070555273 10:77522557-77522579 GCAGCAGCAGCTGTGAGGTGTGG - Intronic
1071175986 10:82927167-82927189 TCAGCACCAGCAAGGAGACAAGG - Intronic
1071470669 10:85981956-85981978 GCAGCAGCACCAAGAAGGCAAGG + Intronic
1072520365 10:96225362-96225384 GCACCAGGAGCATAGAGGCGAGG - Intronic
1072611105 10:97018260-97018282 GCAGGAGCAGGAAGAAGGCCTGG + Intronic
1072686085 10:97537764-97537786 GTAGAAGCAGAAAGGAGGCCTGG + Intronic
1073330797 10:102668828-102668850 GCAGCAGCTGCAGGGTGGGGCGG + Intergenic
1073340777 10:102742908-102742930 GAAGAAGCAGCAAGGAGATGGGG + Exonic
1073535091 10:104269178-104269200 GCAGCAGCAGCAAGGAGGCGGGG - Exonic
1073539476 10:104306721-104306743 GCAGCAAGGGCAAGGAGGTGAGG - Intergenic
1073579886 10:104655777-104655799 GAAGCAGGAGCAAGGCGGAGTGG - Intronic
1074533583 10:114313117-114313139 GGGGCAGCAGGAAGGAGGGGAGG + Intronic
1075004469 10:118820177-118820199 GCAGCAGCAGCCAGCAGAAGAGG + Intergenic
1075263090 10:120979784-120979806 GCGGCGGCAGCAGGGACGCGGGG - Intergenic
1076053260 10:127351905-127351927 GCAGCAGCAGTGAGGAAGAGTGG - Intronic
1076395739 10:130136410-130136432 GCGGCGGCAGCATGGCGGCGGGG + Exonic
1076423993 10:130354438-130354460 GAGATAGCAGCAAGGAGGCGGGG - Intergenic
1076719310 10:132386316-132386338 GCAGCAGCTGGAAGGCGGGGTGG + Intergenic
1076993377 11:287313-287335 CCAGAAGCAGCAAGGAAGCCAGG + Intergenic
1076993405 11:287435-287457 CCAGAAGCAGCAAGGAAGCCAGG + Intergenic
1076993434 11:287557-287579 CCAGAAGCAGCAAGGAAGCCAGG + Intergenic
1076993464 11:287679-287701 CCAGAAGCAGCAAGGAAGCCAGG + Intergenic
1076993492 11:287801-287823 CCAGAAGCAGCAAGGAAGCCAGG + Intergenic
1077326724 11:1967161-1967183 GCAGCAGCAGCACAGAGCCCCGG - Intronic
1077342865 11:2033718-2033740 GCAGCACCAGCAGGGTGGTGTGG + Intergenic
1077758248 11:5059576-5059598 CCAGCAACAGGAAGGAGGAGGGG + Exonic
1077760614 11:5092705-5092727 CCAGCAACAGGAAGGAGGAGGGG - Intergenic
1078910201 11:15723975-15723997 GAAGCAGCAGGAAGTAGGCAGGG - Intergenic
1079472465 11:20790857-20790879 CCAGGTGCAGCAGGGAGGCGTGG - Intronic
1080278895 11:30533529-30533551 GCAGCAGCTGCCAGGTGGCCTGG - Intronic
1081418038 11:42839235-42839257 GCAGCAGCAGCGTGGAGTAGTGG - Intergenic
1081418225 11:42841003-42841025 GTAGCAGCAGCATGGAGAAGTGG - Intergenic
1081730546 11:45369037-45369059 GCAGCTGCAGCAAGGGAGCCCGG + Intergenic
1082750213 11:57006528-57006550 CCAGCTGCAGCAGGGAGGTGTGG - Intergenic
1083163250 11:60868411-60868433 GCAGCAGGACCTAGTAGGCGTGG + Intronic
1083229897 11:61310168-61310190 GGAGGAGCAGAAAGGAGGGGTGG - Intronic
1083591025 11:63895004-63895026 GCAGCAGAAGAAAGGAGAGGGGG - Intronic
1083827995 11:65213935-65213957 GCAGCAGCAGCAGGGCTGTGTGG - Intergenic
1083863751 11:65442218-65442240 ACAGCAGCAGCGTGAAGGCGAGG - Intergenic
1083879388 11:65540649-65540671 GCAGCTGCAGCCCGGAGGCGTGG + Intronic
1084742178 11:71146921-71146943 CCAGCGGCAGCAGGGAGGGGAGG + Intronic
1085037305 11:73308237-73308259 GCGGCAGAGGCAAGGGGGCGGGG - Intergenic
1085527324 11:77172042-77172064 GCAGCAGCAGGCTGGGGGCGGGG - Intronic
1085533217 11:77203670-77203692 GGAGCAGCAGCAAGGCCCCGAGG + Intronic
1085698802 11:78728481-78728503 GGAGCAGAAGCAAGGAAGGGAGG - Intronic
1085939798 11:81195454-81195476 GGAGCAGGAGCAAGGAGACAGGG - Intergenic
1087036091 11:93758158-93758180 GCGGCTGCAGCAGGGAGGCACGG + Intronic
1088231337 11:107676524-107676546 GCTGCAGCAGCAAAGAAGCCAGG - Intergenic
1088522184 11:110712121-110712143 GCAGCTGCACCAAGAAGGTGAGG - Exonic
1088822567 11:113469169-113469191 GCAGGAGCAGGAGGGAGGCAGGG - Intronic
1089526583 11:119101143-119101165 GGCCCAGCAGCAAGGGGGCGAGG + Intronic
1089555264 11:119312521-119312543 TCAGCATCAGCAAGCAGGTGTGG - Exonic
1089588605 11:119525650-119525672 GCTGAAGGAGCAAGGAGGCAAGG - Intergenic
1089605317 11:119638202-119638224 GCAGCAGCAGCAAGAAGAGGAGG - Intronic
1090027586 11:123180954-123180976 CCAGCAGCAGCAAGCAGACTGGG + Intronic
1090125155 11:124076480-124076502 CTGGCTGCAGCAAGGAGGCGTGG - Intergenic
1090941855 11:131393999-131394021 GCAGCAACAGCAGGCAGGCCAGG + Intronic
1091282685 11:134390975-134390997 GCTGAAGCAGGAAGGAGGGGCGG + Exonic
1202809705 11_KI270721v1_random:22341-22363 GCAGCAGCAGCACAGAGCCCCGG - Intergenic
1202825851 11_KI270721v1_random:88907-88929 GCAGCACCAGCAGGGTGGTGTGG + Intergenic
1091812357 12:3409945-3409967 GTAGCAGCAACTGGGAGGCGTGG + Intronic
1092502601 12:9064328-9064350 CCAGCTGCAGCAGGGAGGGGCGG + Intergenic
1092832818 12:12461696-12461718 GCAGCAGCAGAGTGGAGGAGGGG + Intronic
1094465433 12:30749187-30749209 TGAGGAGCAGCAAGGAGGCTAGG + Intronic
1094523405 12:31216161-31216183 GCAGCAGCAGCAGTGAGGTGGGG - Intergenic
1095401356 12:41818076-41818098 GGAGCAGGAGCAAGGGGGCAGGG - Intergenic
1095705772 12:45235577-45235599 GCAGAACTAGCAAGGAGGCTTGG + Intronic
1096742779 12:53706270-53706292 GCAGGTGCAGCAGGGAGGCCCGG - Intergenic
1100385572 12:94102075-94102097 CGAGCAGCAGTGAGGAGGCGTGG - Intergenic
1100985664 12:100199848-100199870 GCAGCCGCAGCGCGAAGGCGCGG - Intronic
1101981006 12:109406888-109406910 GCAGCAGCAGCAGGGAGGGCTGG - Intronic
1103074151 12:117968883-117968905 GCAGCAGCAGCAGCGCGGGGAGG - Intronic
1103564045 12:121806563-121806585 GAAGGGGCAGCAAGGAGGTGGGG - Intronic
1103928136 12:124435039-124435061 GCAGCAGGAGCCAGGTCGCGTGG - Intronic
1104460274 12:128950185-128950207 GGAGCAGCTGCAGGGAGGTGGGG + Intronic
1104879474 12:132060522-132060544 TCAGCAGCAGCAGTGAGGCCGGG + Intronic
1105543924 13:21338277-21338299 GCAGCAGTAGCGGGGAGGCGAGG + Intergenic
1106298368 13:28439360-28439382 GCAGGACCAGCAAGCAGGTGGGG - Intronic
1106445935 13:29830942-29830964 GCAGATACAGCAAGGAGGTGAGG - Intronic
1106541720 13:30696580-30696602 GCAAGAGCAGGAAGGAGGCAGGG + Intergenic
1106670415 13:31898942-31898964 CCAGCAGCATCAAGGAGCTGTGG - Intergenic
1107999433 13:45892732-45892754 GCAACAGGAGGAAGGAGGAGGGG + Intergenic
1108623164 13:52203554-52203576 GAAGCAGCAGCATGGAGCAGGGG + Intergenic
1108639710 13:52371711-52371733 GCAGCAGCAGCAGGATGGGGGGG + Intergenic
1108663559 13:52607486-52607508 GAAGCAGCAGCATGGAGCAGGGG - Intergenic
1109302103 13:60600250-60600272 GCAGGAGCAGTGAGGATGCGGGG - Intergenic
1110180411 13:72610666-72610688 GCAGCAGCGGCAGCGAGGCTGGG + Intergenic
1110275846 13:73640933-73640955 GCAGCAGCGGCAGCGAGGCTGGG + Intergenic
1110328174 13:74241537-74241559 GCAGCAGCGGCAGCGAGGCTGGG - Intergenic
1110939359 13:81330376-81330398 CCAGCTGCAGCAGGGAGGCGTGG + Intergenic
1111512830 13:89287982-89288004 CCTGCTGCAGCAGGGAGGCGTGG - Intergenic
1112286248 13:98107078-98107100 AAAGCAGGAGCAAGGCGGCGGGG + Intergenic
1112432550 13:99363543-99363565 ACAGCAGCAGCAAAGAGCCGGGG - Intronic
1112741034 13:102472702-102472724 CCAGCTGCAGCAGGGAGGCATGG - Intergenic
1113919859 13:113901067-113901089 CCAGCAGCAGCAAAGGGGTGGGG + Intergenic
1115103042 14:29726220-29726242 GCAGCAGCAGAAGGGAGAGGTGG - Intronic
1115616260 14:35097769-35097791 GCAGCAGCAGCCAGGCGCAGTGG - Intronic
1115641423 14:35337842-35337864 GCAGCAGCAGCAAGAAAGGAAGG - Intergenic
1116257098 14:42570864-42570886 CCAGCTGCAGCAGGGAGGCACGG + Intergenic
1118092609 14:62498699-62498721 GAAGGAGAAGCAAGGAGGAGAGG + Intergenic
1118804525 14:69224005-69224027 GGAGCAGCACCAAGACGGCGGGG + Intronic
1119187415 14:72652504-72652526 GCAGGAGAAGCAGGGAGGCAAGG + Intronic
1119766893 14:77195990-77196012 GAAGGAGCTGCAAGGAGGCCAGG + Intronic
1119970842 14:78968393-78968415 GCAGAGGCAGCAAAGAGGCTTGG - Intronic
1120388516 14:83876294-83876316 GAAGCAGAAGCAAGGTGGTGGGG - Intergenic
1120723856 14:87916478-87916500 ACAGCGGGAGAAAGGAGGCGGGG + Intronic
1121526737 14:94624401-94624423 GCTGCAGGAGCAAGGAGTCCGGG - Intronic
1121573821 14:94967198-94967220 GCAGCAGCAGGAATGGGGCCAGG - Intergenic
1121767158 14:96497805-96497827 GCAGCAGCTGGAGGGAGGTGTGG + Intergenic
1122267949 14:100555388-100555410 GCAGCAGGAGCAAGTTGGAGGGG - Intronic
1122608773 14:102966738-102966760 GCAGAAGCAGCAGGGAGACTTGG - Intronic
1122619370 14:103046039-103046061 GCAGCAGGGGCAACGAGGCTGGG + Intronic
1122711397 14:103661091-103661113 CCAGCAGCAGTAAGCAGCCGTGG - Intronic
1122740250 14:103867998-103868020 GAAGCAGCACCAGGGAGGCCTGG - Intergenic
1122937312 14:104966225-104966247 GGAGCAGTAGGAAGGTGGCGGGG - Intronic
1122967465 14:105138042-105138064 GCAGCAGCAGCTGGGTGGTGTGG - Intergenic
1122999411 14:105284428-105284450 GCAGCAGCAGCCAGGAGCAGAGG + Intronic
1124209234 15:27748406-27748428 GCAGCATCAGCAGGGAGCAGTGG + Intergenic
1125331591 15:38587999-38588021 GCAGAAGCTGCAAGCAGGCTGGG - Intergenic
1125397858 15:39269754-39269776 CCACCAGCAGGAAGGAGGTGAGG + Intergenic
1125398549 15:39275518-39275540 CCAGCAGCAGCGAGGAGAGGCGG - Intergenic
1125435883 15:39645282-39645304 TCAGCTGCAGCAGGGAGGCGTGG + Intronic
1125826643 15:42682150-42682172 ACAGCAGCAGCAAGAAGACCAGG + Exonic
1128657408 15:69472585-69472607 GCAGCAGCTGTCAGGAGGCAAGG + Intergenic
1128735293 15:70050222-70050244 GGAGAAGCAGCAGGAAGGCGTGG + Intronic
1128847711 15:70916652-70916674 CCAGCTGCAGCAGGGAGGCGTGG + Intronic
1129199860 15:73992293-73992315 GAAGCAGCAGCCAGGAGGGCGGG - Exonic
1129298896 15:74614649-74614671 GCAGCCGCAGCTCGGAAGCGGGG + Intronic
1129513977 15:76145305-76145327 GTCGCAGCAGGAAGGAGGCCTGG - Intronic
1130770170 15:86916253-86916275 GCTGCAGCAGCAATGAAGCAAGG - Intronic
1131821394 15:96277921-96277943 ACAGCATCAGCATGGAGTCGGGG + Intergenic
1132078616 15:98845445-98845467 GCAGGAGAAGGAAGGAGGGGAGG - Intronic
1132645499 16:997534-997556 GCAGGAGCGGCAGGGAGGCTGGG + Intergenic
1132728539 16:1349336-1349358 CCAGCAGCCGCAAAGAGCCGAGG + Exonic
1133229733 16:4360812-4360834 GGACCAGCAGCGAGGAGGGGTGG - Intronic
1133249195 16:4469194-4469216 GCAGGAGCTGCAGGGAGGCCCGG - Intronic
1133436483 16:5784471-5784493 GCAGGAGCAGCAGAGAGACGGGG + Intergenic
1133783624 16:8958346-8958368 CCGGCAGCACCAAGGAGGCTGGG + Intronic
1134041714 16:11073700-11073722 GGAGCAGGAGGAAGGAGGCTGGG - Intronic
1134078581 16:11309184-11309206 CCAGCTGCAGCAAGGAGGCATGG - Intronic
1135574017 16:23571232-23571254 GCAGCAGCAGCACGGCGGGAGGG - Exonic
1136140967 16:28288492-28288514 ATAACTGCAGCAAGGAGGCGGGG - Intergenic
1136696427 16:32085123-32085145 GCAGCGGCAGCAAAAAGCCGCGG + Intergenic
1136933206 16:34436755-34436777 CCAGCAGGAGCAGGGAGGGGCGG + Intergenic
1136971366 16:34975059-34975081 CCAGCAGGAGCAGGGAGGGGCGG - Intergenic
1137036780 16:35575033-35575055 GCAGCATCAGCACGCTGGCGTGG - Intergenic
1137382923 16:48015191-48015213 GGAGCAGGAGCAAGGGGCCGGGG + Intergenic
1137677142 16:50309303-50309325 GCGGCAGCAGCCAGGGGGAGGGG - Intronic
1138470793 16:57234146-57234168 TCAGGAGCAGCAAGGAGGCCAGG - Intronic
1139390119 16:66601990-66602012 CCAGCTGCAGCAGGGAGGCATGG - Intergenic
1139519436 16:67472115-67472137 GCAGCAGCAGCAAGCTGGAGGGG + Intronic
1141484998 16:84333123-84333145 GCAGCAGCAGCCACGAGGCATGG + Intergenic
1141775698 16:86121546-86121568 GGAGGAGCAACAAGGAGGTGGGG - Intergenic
1141837355 16:86550695-86550717 GCAGCAGTAGCAAGGAAGGACGG - Intronic
1142003187 16:87675731-87675753 GCTGCAGCAGGAAGCAGGTGTGG + Intronic
1142153321 16:88522165-88522187 GTGGCAGCAGCAAGGCGGCAGGG + Intronic
1142200901 16:88760713-88760735 GCAGCAGCACCCAGGGGGCCCGG + Intronic
1142310181 16:89307667-89307689 GGAGCTGCAGCCAGGCGGCGGGG - Intronic
1142561838 17:814479-814501 GGAGCAGCAGAGAGGGGGCGCGG + Intronic
1142669720 17:1482614-1482636 GCAGCAGTAGCTACAAGGCGGGG - Intronic
1142981218 17:3673112-3673134 GCAGAAGCTGCAATGAGCCGAGG + Intronic
1143492899 17:7294374-7294396 GGAGCCGCAGAAAGGCGGCGGGG - Exonic
1144167322 17:12625286-12625308 CCAAGGGCAGCAAGGAGGCGTGG - Intergenic
1144351623 17:14402591-14402613 GCTGGAGCAGCTAGGAGGCAAGG - Intergenic
1144519695 17:15945488-15945510 GCACCAGCACGAAGCAGGCGAGG - Exonic
1144650615 17:17004688-17004710 GCAGCAGCAGCCCAGGGGCGTGG - Intergenic
1144677009 17:17168246-17168268 GCAGGGGCAGGAAGGAGGCAAGG - Intronic
1145755492 17:27386924-27386946 GCAACAGGAACAAGGAGGCATGG + Intergenic
1146306077 17:31730807-31730829 GCAGCAGCAGCAAGAAAGAAGGG + Intergenic
1146402974 17:32514791-32514813 GCAGCAGCAGGAAAGAGATGCGG + Intronic
1146559656 17:33857175-33857197 CCAGCAGCAGAAAGGGGCCGAGG - Intronic
1146588866 17:34110433-34110455 GCAGCGGCAGCAGAGAGGCTGGG - Intronic
1147122745 17:38345300-38345322 CTAGCAGCAGGAAGGAGGTGAGG - Intergenic
1147741618 17:42673713-42673735 GCAGCAGCGGGAAAGGGGCGCGG - Exonic
1147924089 17:43936036-43936058 GTAGCAGAGGCAGGGAGGCGTGG - Intergenic
1148742801 17:49902256-49902278 CCGGCAGCAGCAAGGGGGTGCGG - Intergenic
1148769260 17:50057416-50057438 CCAACAGCTGCAAGGAGGAGGGG + Intronic
1148828793 17:50415470-50415492 ATACCAGCAGCAAGGTGGCGGGG + Intergenic
1150952640 17:69821037-69821059 CCAGCTGCAGCAGGGAGGTGCGG + Intergenic
1151352815 17:73541704-73541726 GCGGCAGAAGGAAGGGGGCGCGG + Intronic
1151460199 17:74249795-74249817 GCAGCTGCAGCCAGGTGGGGGGG + Intronic
1151757744 17:76084206-76084228 ACAGCAGCAGCAAGCAGTGGAGG + Intronic
1151878155 17:76879019-76879041 GCAGCAGCAGCATGGTGGCATGG - Intronic
1152371172 17:79889442-79889464 GCAGTAGCAGCAATGGGGCATGG - Intergenic
1152586636 17:81192312-81192334 GCCGCACCAGGAAGGAGGTGGGG - Exonic
1152630318 17:81408075-81408097 GCAGCAGGAGGAAGGGGGCCGGG - Intronic
1152904494 17:82962912-82962934 TCAGCAGCAGCAATCAGGGGAGG - Intronic
1156812954 18:41274312-41274334 GCAACAGCAGCAAGAAGACCCGG + Intergenic
1158350174 18:56557206-56557228 GCAGCAGCAGAGAGTAGGGGAGG - Intergenic
1158432275 18:57400185-57400207 GCAGCAGCAGCAAGTAGCTTTGG - Intergenic
1158732861 18:60044925-60044947 GGAGCAGCAGCAGGTAGGGGTGG + Intergenic
1158960946 18:62587331-62587353 GCTGCAGGAGCTGGGAGGCGGGG + Intronic
1159285104 18:66338431-66338453 GCAGGAGTAGCAAGAAGGCCAGG + Intergenic
1159395190 18:67846825-67846847 GCAACAGCAGCACAGAGGAGCGG - Intergenic
1159935009 18:74358038-74358060 GCAGTAGCAGGAAGGTGGCCTGG - Exonic
1160025342 18:75211498-75211520 CCAGCAGCAGCGCGGCGGCGGGG + Intronic
1160378286 18:78430016-78430038 GCCGCAGCAACAGGGCGGCGTGG + Intergenic
1160699552 19:499178-499200 GGAGGAACAGCGAGGAGGCGAGG - Intronic
1160842231 19:1151285-1151307 GCAGCTGCAGGAAGGGGGCGGGG + Intronic
1160900732 19:1426834-1426856 GCTGCCGCACCAAGGAGGCCGGG - Intronic
1161063473 19:2226669-2226691 GCAGCCGCGGCAAGGAGGCAGGG + Exonic
1161237388 19:3204730-3204752 GCAGCAGCATCATGGACGTGCGG + Exonic
1161252158 19:3286009-3286031 GCAGCAGCAGCGAGAAGGTGAGG + Exonic
1161362344 19:3857759-3857781 GCAGCAGCAGCAAATAGCCTGGG - Intronic
1161378789 19:3953626-3953648 CCAGCAGCTGCAGGGGGGCGGGG + Intergenic
1162136409 19:8558036-8558058 GCAGGGGCAGCAGGGAGGCAGGG - Intronic
1162462579 19:10821901-10821923 GCAGCAGCAGGAAGGAGAGGAGG + Intronic
1162516170 19:11149164-11149186 GCAGGTGCACCAGGGAGGCGTGG - Exonic
1162573393 19:11485264-11485286 GCAGCAGCAGGAAGGAGAGCTGG - Intronic
1163104923 19:15117813-15117835 GCAGCAGAAACCAGGAGGAGAGG + Intronic
1163124755 19:15238853-15238875 GCAGCAACAGCAAGCAGCTGCGG - Exonic
1163311976 19:16520289-16520311 TCAGCAGCAGCCAGGCGTCGTGG + Exonic
1163369968 19:16896460-16896482 GGCGCAGCAGCTGGGAGGCGCGG + Exonic
1163815354 19:19461729-19461751 GCAGCACCAGCAAGGCTGAGTGG - Intronic
1163846863 19:19643091-19643113 GCAGCAGTAGAAATGTGGCGGGG - Intronic
1163847598 19:19646347-19646369 GCTGCAGCAGCAAGGCGGGTGGG + Exonic
1164537851 19:29099587-29099609 AAAGCAGCAGCATGGAGGCAGGG - Intergenic
1164630794 19:29760289-29760311 GCAGCAGGAGGCAGGCGGCGGGG + Intergenic
1164754426 19:30679392-30679414 GCAGCAGAAACAAGGTGGCTGGG + Intronic
1164875060 19:31678892-31678914 GCAGCAGCAGGAGGGAGATGTGG + Intergenic
1164880230 19:31726687-31726709 ACAGCACCAGCAGGGAGGTGTGG - Intergenic
1164958604 19:32407225-32407247 GCAGCAGCAAGTGGGAGGCGGGG - Intronic
1165026982 19:32969451-32969473 GCAGCAGGAGGAAGGGGGTGGGG - Intronic
1165826609 19:38709325-38709347 GCAGGAGCAGGAGGGAGGCAGGG - Intronic
1166081195 19:40444825-40444847 GGAGGGGCAGCAAGGGGGCGAGG - Intergenic
1166341503 19:42140206-42140228 GGGGCAGCAGCAAGGGGGCTAGG - Intronic
1167037947 19:47005319-47005341 GCAGGAGCTGCAGGCAGGCGTGG + Intergenic
1167310540 19:48735216-48735238 GGAGCAGCAGGAAGTAGGGGCGG + Exonic
1167341993 19:48921862-48921884 GCAGCAGCAGCAAGGCCACAAGG + Exonic
1167425644 19:49428436-49428458 GCTGCAGAAACCAGGAGGCGTGG - Intronic
1168105419 19:54163122-54163144 GCAGGACCACCAGGGAGGCGAGG + Exonic
1168148024 19:54430379-54430401 GCAGGAGCAGAAGGGACGCGGGG + Intronic
1168315146 19:55481835-55481857 GCAGCAGCAGGTTGGAGGAGTGG - Exonic
1168315454 19:55483005-55483027 GCAGCAGCAGGTTGGAGGAGTGG - Exonic
925128896 2:1480784-1480806 GCAGCAGGAGGAAGGTGGTGTGG - Intronic
925281182 2:2686441-2686463 GCCGCAGCAGCCAGGAGGGACGG + Intergenic
925354387 2:3227762-3227784 GCAGCAGCAGCTGGGATGCAGGG - Intronic
925733715 2:6942491-6942513 GCAGCAGCAGCAGGGAAAAGTGG + Intronic
929351823 2:40965541-40965563 GCAGCAGCTAGAAGGAGGTGAGG - Intergenic
929419693 2:41777991-41778013 CCAGCAGGGGCAAGGAGGCAGGG + Intergenic
929508773 2:42550501-42550523 GCAGCAGAAGGAAGGAGGTCAGG + Intronic
930092584 2:47541995-47542017 GCAGCGGCAGCAGGGAGCCCAGG + Intronic
930716101 2:54595553-54595575 GCACCAGCAGCATGGAGCTGGGG - Intronic
930920605 2:56748904-56748926 ACAGCAGCAGAAAGGAGACATGG + Intergenic
931139880 2:59445652-59445674 TCAGGAGCAGCCAGGAGGCCAGG - Intergenic
932086213 2:68764704-68764726 ACAGCAGCAGCATGGAGGCAGGG - Intronic
933339577 2:81004925-81004947 GCAGCTGCTGCCAGGAGGTGGGG + Intergenic
934524971 2:95046184-95046206 GCAGCAGGTGCAGGGAGGTGGGG + Intronic
934653101 2:96103542-96103564 GCAGCAGCAGGAGGGAAGGGTGG - Intergenic
934908045 2:98222701-98222723 GCAGCACCAGCAAGGACCAGTGG + Intronic
935122855 2:100197682-100197704 GCAGCAGCAGCCTGGGGGAGGGG + Intergenic
935126825 2:100231555-100231577 AGAGCAGCAGCAAGGAGGGCAGG - Intergenic
935223189 2:101032352-101032374 ACAGCAGCAGCACGGAGGTCAGG + Exonic
936572329 2:113627237-113627259 GTAGCAGCTGCGAGGACGCGGGG + Exonic
936598129 2:113868901-113868923 GCAGCAGCAGAAGGAAGGTGTGG + Intergenic
937024071 2:118682868-118682890 GCAGCAGCAGCACAGAGGCAGGG - Intergenic
937033803 2:118763991-118764013 GCAGGAGAAGCAGGGAGTCGGGG - Intergenic
937039585 2:118810557-118810579 GCAGCAAGAGCAGGGAGGAGGGG + Intergenic
937313389 2:120915843-120915865 GCAGCAGCTGCAAGGGGTCTGGG - Intronic
938365004 2:130727482-130727504 GCAGCTGGGGCAGGGAGGCGGGG + Intergenic
940362728 2:152813457-152813479 GCAGCAGCAGTCAGGAGCAGTGG + Intergenic
942057584 2:172199008-172199030 ACAGCAGCAGCAAGGACTGGGGG - Intergenic
942103323 2:172607727-172607749 TCAGCAGCAGCAAGGATGCAAGG + Intronic
943025628 2:182624302-182624324 GCAGCTGCAGCCAGGAGTAGAGG - Intergenic
943051263 2:182916066-182916088 GGAGCAGGAGCAGGGAGACGGGG - Intronic
943093748 2:183404540-183404562 GCAGCAGCAGCCATGTGGCAAGG + Intergenic
943462910 2:188191901-188191923 CCAGCAGCAACAAGGAGGCAAGG - Intergenic
943811661 2:192195343-192195365 GCAGCAGCAGCAGGGCAGAGAGG + Exonic
944451759 2:199850944-199850966 GCAGCAGCGGCGAGGGCGCGGGG + Exonic
944875902 2:203963993-203964015 GCAGCCGCTGCAAGGAGACATGG + Intergenic
944905159 2:204255030-204255052 AAAGCAGGAGCAAGGAGGTGGGG + Intergenic
945223910 2:207512291-207512313 GCACCAGAAGCAAGGAAGAGAGG + Intergenic
946103661 2:217351007-217351029 GCAGCAGCAGCAGTGTGGCAAGG + Intronic
946181444 2:217951542-217951564 GCAGCTGCAGCAAGCCGGCAGGG + Intronic
946448607 2:219761005-219761027 GCAGCAGCAGCAAGGCTCAGAGG - Intergenic
946664827 2:222037564-222037586 GCAGAAACAGCAAGGAGGCCAGG - Intergenic
947568743 2:231214218-231214240 GCAGCTGCAGCTGGCAGGCGTGG + Intronic
947827066 2:233113741-233113763 GCAGCAGCAGGAGAGAGGCAAGG - Intronic
948180967 2:235979930-235979952 GCAGAGGCAGCAAGGCGACGAGG - Intronic
948373448 2:237505162-237505184 TCAGGACCAGCAAGGAGGTGGGG - Intronic
948617473 2:239209999-239210021 GCAGCAGCATGAATGAGACGGGG + Intronic
948674157 2:239587377-239587399 GCAATAGCAGAGAGGAGGCGGGG + Intergenic
948992758 2:241563146-241563168 GCAGCAGGAGCAGGGAGGCAGGG - Intronic
949037264 2:241821586-241821608 AAAGCAGCAGCAAGGTGGGGAGG - Intergenic
1169278616 20:4249319-4249341 GCAGCGCCAGGAAGGAGGAGGGG + Intergenic
1169345301 20:4823835-4823857 AGGGCAGCAGCAAGGAGGTGAGG - Intergenic
1169425633 20:5495150-5495172 GGAGGAGCAGCAGGGAGGAGGGG + Intergenic
1170030128 20:11935796-11935818 GCAGCAGCTGAAAGGATGTGCGG + Intergenic
1170142792 20:13141929-13141951 GCAGCAACAGCAAGGCAGAGAGG - Intronic
1170566855 20:17612438-17612460 GCAGCAGCAGCGTAGAGGCGTGG - Intergenic
1170681473 20:18529622-18529644 ACAGCAGCAGGAAGGAGGAAAGG + Intronic
1170765051 20:19282752-19282774 GCAGAACCAGCAAGGATGGGGGG + Intronic
1171012301 20:21515235-21515257 GGAGCAGCGGGAAGGCGGCGGGG + Intergenic
1171982427 20:31637623-31637645 GGAGAAACAGCAAGGAGGGGAGG + Intergenic
1172556919 20:35850258-35850280 GCAGCCCCAGCAAAGAGGTGAGG - Intronic
1172991236 20:39038582-39038604 GGGGCAGCAGCATGGAGGAGAGG - Exonic
1173176732 20:40770697-40770719 GCAGGAGCCTCAAAGAGGCGAGG + Intergenic
1173395589 20:42676886-42676908 GCAGTAGAAGCCAGGAGGCCTGG + Intronic
1173853473 20:46233756-46233778 GAAGCAGCAGACAGGAGCCGAGG - Intronic
1174412374 20:50344343-50344365 GCAAGAGCAGCCAGGAGGCTGGG + Intergenic
1175120275 20:56711153-56711175 AAAACAGCAGCAAGGAGGAGAGG - Intergenic
1175281090 20:57804646-57804668 GCGGCAGCAGCATGTGGGCGGGG + Intergenic
1175371691 20:58496762-58496784 GCAGAAGCTGCAAGGAAGAGTGG + Intronic
1175501056 20:59451152-59451174 GCAGCAGCAGCAAGGGGAAAGGG - Intergenic
1175861463 20:62152340-62152362 GGGGCCGCAGCAAGGAGGGGTGG - Intronic
1175924155 20:62463778-62463800 GCAGCAGCCGGACGGAGGCGAGG + Exonic
1175956735 20:62614479-62614501 GCAGAAGCAGCAGGGTGGCAGGG + Intergenic
1176143653 20:63555855-63555877 GCAGCAGCTGCATGCGGGCGTGG - Exonic
1178140828 21:29681424-29681446 AGAGCAACAGCAAGGAGGCCAGG - Intronic
1179613991 21:42569928-42569950 GCAGCAGCAGCGTGGAGCTGGGG - Intronic
1179787310 21:43737284-43737306 GCAGCAGCCTCGAGGCGGCGAGG - Intronic
1180642178 22:17307803-17307825 GCAGCAGAAGGAAGAAGGCAAGG + Intergenic
1180762255 22:18219794-18219816 GCAGCTGCTGCGGGGAGGCGGGG + Intergenic
1180773412 22:18404814-18404836 GCAGCTGCTGCGGGGAGGCGGGG - Intergenic
1180804763 22:18654363-18654385 GCAGCTGCTGCGGGGAGGCGGGG - Intergenic
1180805981 22:18715047-18715069 GCAGCTGCTGCGGGGAGGCGGGG + Intergenic
1180997883 22:19974469-19974491 GCAGGAGCATCCAGGAGGCCTGG + Intronic
1181030913 22:20148579-20148601 GCGGCCCCAGCAAGGAGGCCAGG - Exonic
1181039649 22:20185801-20185823 GCAGCACCAGCAAGGACCAGCGG + Intergenic
1181171928 22:21014833-21014855 GCAGCAGCAGCAGGGCGGGGAGG - Intronic
1181192508 22:21151747-21151769 GCAGCTGCTGCGGGGAGGCGGGG - Intergenic
1181216931 22:21340828-21340850 GCAGCTGCTGCGGGGAGGCGGGG + Intergenic
1181493355 22:23274495-23274517 TCAGAAGCAGCACTGAGGCGAGG + Intronic
1181507985 22:23374595-23374617 GGAGCAGCAGCATGGGGGCGTGG - Intergenic
1181844306 22:25694331-25694353 GCTGCAGCAGGAAGCATGCGAGG - Intronic
1182131383 22:27855312-27855334 TCAGAAGCAGCAAAGAGGTGTGG - Intronic
1182460750 22:30481887-30481909 GCAGCAGGAGCAGGAGGGCGGGG + Intergenic
1182604996 22:31496369-31496391 GCAGCAGCAGCAATGAGAATCGG - Intronic
1183018478 22:35008672-35008694 GAAGCTGCAGCAAGGAGTGGGGG + Intergenic
1183178208 22:36239659-36239681 AGTGCAGCAGCAAGGAGGCTGGG - Intronic
1183795521 22:40113815-40113837 ACAACACCAGCAAGGAGGCCTGG - Intronic
1184561076 22:45263219-45263241 CCAGCTGCAGCAGGGAGGCACGG - Intergenic
1184670190 22:46008184-46008206 GCTGCAGCAGGCAGGTGGCGTGG + Intergenic
1184834950 22:47015657-47015679 ACAGCAGCAGCCAGGAAGCCAGG + Intronic
1184838707 22:47039900-47039922 GGAGCAGGAGCAAGGCGTCGGGG + Intronic
1184913205 22:47549750-47549772 GCAGCAACAGCAGGAAGGTGGGG + Intergenic
1184933724 22:47702247-47702269 GCAGCAGCAGCGGGGTGGGGAGG - Intergenic
1184933725 22:47702250-47702272 GCAGCAGCAGCAGCGGGGTGGGG - Intergenic
1185245406 22:49770503-49770525 GCAGCTGCACCCAGGAGGAGTGG + Intergenic
1203235242 22_KI270731v1_random:145796-145818 GCAGCTGCTGCGGGGAGGCGGGG - Intergenic
950242705 3:11386050-11386072 GCAGCTGCAGCAGGGTGGTGTGG + Intronic
950424746 3:12919109-12919131 CAAGCAGCAGCCAGGAGGCCGGG - Intronic
951136370 3:19107972-19107994 CCAGCTGCAGCAGGGAGGCGTGG - Intergenic
952706163 3:36380313-36380335 GCAGGAGGAGGAAGGAGGCGGGG - Intergenic
953369539 3:42375809-42375831 GCAGCAGCAGAAAGCAGGAGCGG + Intergenic
953462712 3:43094477-43094499 AGAACAGCAGCAAGGAGGCAAGG + Intronic
953782236 3:45881458-45881480 GCAGCAGCAGCAGGAATGGGAGG - Intronic
954039052 3:47870636-47870658 GCCCCAGCAGCAGGGAGGCGGGG - Intronic
954753024 3:52824248-52824270 ACAGCAGCAACCAGGAGGAGCGG - Exonic
955400979 3:58591408-58591430 TCAGGAGCAGCAAGGAGGTCAGG + Intronic
955978237 3:64498429-64498451 AAAGGAGCAGCAAGGAGGCCAGG - Intergenic
956070720 3:65447994-65448016 GCAGCAGCAGCAGGCAGGGAGGG + Intronic
956678199 3:71754370-71754392 CCAGCAGCAGGAAGGCGGCGTGG - Exonic
958636116 3:96749959-96749981 GCAGCTGCAGCAGGGAGGCCAGG + Intergenic
958814424 3:98901023-98901045 GCAGACGCTGCAGGGAGGCGCGG - Intronic
960216443 3:115043991-115044013 AAAGCAGGAGCAAGGAGGTGAGG - Intronic
960687419 3:120307928-120307950 GCAGCAGCAGCAAGGAATGGAGG + Intergenic
960868928 3:122230338-122230360 GCAGCGTCAGCAAGGAGGAGAGG - Intronic
960903769 3:122577677-122577699 GCAGCGGCAGGAAGGGGGCCTGG - Exonic
961340500 3:126213940-126213962 ACAGCAGCCGCGCGGAGGCGAGG + Intergenic
961442352 3:126960564-126960586 GCAGCAGCAGCAGGCTGCCGCGG + Intergenic
961791302 3:129378569-129378591 CCAGCTGCAGCAGGGAGACGTGG - Intergenic
962264504 3:133935475-133935497 GCAGCAGCAGAAAGAAGGGGCGG - Intronic
962717312 3:138137795-138137817 GCAGCAGCAGCCAGGACCCCTGG + Intergenic
962786099 3:138769165-138769187 CCAGCTGCAGCAAGGAGGTGTGG - Intronic
963483181 3:145903584-145903606 CCAGCTGCAGCAGGGAGACGTGG + Intergenic
963926993 3:150961178-150961200 GCAGAAGCCACAAGGAGGAGGGG - Intronic
964255171 3:154767032-154767054 CCAGCTGCAGCAGGGAGGCGTGG - Intergenic
964486162 3:157186922-157186944 GCAGCAGCAGCAATGCGTGGGGG - Intergenic
964926291 3:161962653-161962675 GTGGCAGCAGCAAGGAGAAGTGG - Intergenic
965876894 3:173335027-173335049 CCAGCAGCATAAAGGAGGCAAGG - Intergenic
966256689 3:177925261-177925283 TGAGCAGCAGCAAGGAAGGGAGG + Intergenic
967135422 3:186508945-186508967 ACAGCAGGAGCCAGGAAGCGAGG + Intergenic
967945043 3:194797602-194797624 GCAGCAGCAGCCAGCAGCAGTGG + Intergenic
968831202 4:2933794-2933816 GCAGCAGCAGCGTGAAGGCCAGG + Exonic
968938445 4:3625576-3625598 GCAGCATCTGCAAAGAGGCTGGG - Intergenic
968946885 4:3669527-3669549 GCAGCAGCTGCCAGGAAGCTGGG - Intergenic
968947219 4:3671351-3671373 GCGACAGCAGCAAGGCGGTGTGG - Intergenic
968985098 4:3870735-3870757 GCAGCAGGACTAAGGGGGCGAGG + Intergenic
969227496 4:5808270-5808292 GCAGCAGCAGGCAGGAGTCATGG + Exonic
969244810 4:5925254-5925276 CCTGAAGCAGCAAGGAGGTGTGG + Intronic
969302821 4:6307307-6307329 GGAGCAGCAGGAAGGTGGTGGGG - Intergenic
969475959 4:7422556-7422578 GCAGGAGCACCAAGGGGGCCTGG - Intronic
969516834 4:7652674-7652696 GCAGCAGCAGAATGGAGAGGAGG - Intronic
971371820 4:26026028-26026050 CTAGCAGCAGGAAGGAGGAGAGG - Intergenic
971459570 4:26880172-26880194 CCAGCAGCAGAAAGGAAGCTGGG - Intronic
972626580 4:40805335-40805357 GTGACAGCAGCAAGGAGACGAGG - Intronic
975636875 4:76458995-76459017 TCAACAGCAGCAGGGGGGCGGGG + Intronic
979915724 4:126431198-126431220 GGAGTAGGAGGAAGGAGGCGGGG + Intergenic
981287388 4:143034505-143034527 GCAGGAGCAAGAAGGAGGGGAGG + Intergenic
981511960 4:145567019-145567041 GCAGCAGCAGCAGCATGGCGGGG - Intergenic
982560456 4:156923209-156923231 GAAGGAGCAGCAAGAAGGCCTGG - Intronic
983238649 4:165207495-165207517 GCAGCAGCAGGAGGAAGGGGAGG + Intronic
985489520 5:171246-171268 GCCGCAGCAGGTAGGAGGCCAGG - Exonic
986297052 5:6448629-6448651 GCAGCAGCACCCCGGGGGCGCGG + Exonic
986402961 5:7396640-7396662 GCAGGAGAAGCAGGGAGCCGCGG - Intronic
987110820 5:14684821-14684843 GCAGCAGCAGAAAGGAAGCCCGG - Intronic
990521744 5:56587924-56587946 GAAGAAGCAGCAAAGAGGCCAGG + Intronic
991963995 5:72072984-72073006 GCAGCAGCAGGAAGCACTCGGGG + Intergenic
992162318 5:74015451-74015473 GCACCAGCAGGAAGGTGGAGGGG - Intergenic
993852073 5:93023172-93023194 AGAGCAGCAGGAAGGAGGCAGGG - Intergenic
993901225 5:93585140-93585162 GCAGCAGCAGCAGGCGGGCTCGG + Exonic
995350827 5:111173467-111173489 GCAGCAGAAGGAAGGAGATGGGG + Intergenic
996249953 5:121317370-121317392 GCAGCAGCAGCAAGGTGGCAGGG + Intergenic
996618141 5:125466825-125466847 GAAGCAGCACCAAGGAGGACAGG + Intergenic
996862644 5:128083680-128083702 GCAGCAGCACGCGGGAGGCGGGG - Intergenic
997011434 5:129883242-129883264 CCAGAAGCAGCAAGGAGGCTGGG - Intergenic
997210623 5:132074725-132074747 GCAGCAGCAAAAAGGAGTGGTGG + Intronic
997393240 5:133533890-133533912 GCAGCAGGAGCAAGGACTCGGGG - Intronic
997432544 5:133850720-133850742 ACAGCAGCACCAAGGATGTGAGG + Intergenic
997727534 5:136133727-136133749 ACAGCAGCTGAAAGGAGGAGAGG - Intronic
997741729 5:136260774-136260796 GGGGCAGCAGCAAGGAGACCTGG + Intronic
997870906 5:137504381-137504403 GGAGCAGGGGCAAGGAGGCTGGG + Intronic
997878670 5:137570996-137571018 GCAGGAACAGCAAGGGGGCCAGG + Intronic
998389928 5:141780730-141780752 CCAAGAGCAGCAAGGAGGAGCGG + Intergenic
998799680 5:145856531-145856553 GCCCCAGCAGCAAGGGGGCGGGG + Intergenic
998997330 5:147879954-147879976 GTGGCAGCAGAAAGGAGGTGGGG + Intronic
999082391 5:148856609-148856631 TCAGCTGCAGCAAGGAGCAGGGG + Intergenic
999132456 5:149294830-149294852 GCAGCAGAGGCTAGGAGGCCAGG - Intronic
999230154 5:150057127-150057149 GCAGCAGCTGCAAGGATGAGTGG - Intronic
999295147 5:150454822-150454844 CTAGCAACAGCAAGGAGGCCAGG + Intergenic
999393890 5:151214305-151214327 GTAGAGGCAGGAAGGAGGCGGGG + Intronic
1000338581 5:160260127-160260149 GCAGCAGCAGCCAGGGGCTGGGG + Intronic
1001797630 5:174515342-174515364 GGCCCAGCAGCCAGGAGGCGGGG - Intergenic
1002175244 5:177397923-177397945 GCAGCAGCAGGAAGCAGACAAGG - Exonic
1002365033 5:178703187-178703209 GGAGCAGCAGGAGTGAGGCGTGG + Intergenic
1002523557 5:179804061-179804083 AGAGCAGCAGCAATGAGGCCTGG + Intronic
1003058117 6:2841415-2841437 GCAGCTGCAGATAGGAGCCGCGG + Intronic
1003408166 6:5840103-5840125 GCAGCAGTAGCCGGGAGGCAAGG - Intergenic
1003577714 6:7313090-7313112 GAAGCAGCAGCAAGCGGGGGAGG + Exonic
1003798882 6:9639122-9639144 GGAGGAGCAGCAAGGAGATGTGG + Intronic
1004069786 6:12288061-12288083 GCAGCCTCAGCAAGGTGGGGTGG + Intergenic
1006079665 6:31558107-31558129 GCAGCAGCAGCGAGAAGCAGAGG + Exonic
1006272693 6:32976414-32976436 GCAGTAACAGCAAGGAGCGGGGG - Exonic
1006425190 6:33959151-33959173 GCAGCAGCAGAGAGGGAGCGGGG + Intergenic
1006514719 6:34539483-34539505 GCAGCGGCAGGGTGGAGGCGGGG - Intronic
1006867798 6:37222860-37222882 CCAGCTGCAGCAGGGAGGCGCGG - Intronic
1007113882 6:39329698-39329720 GCAGCAGCAGCAAGAAGCCTGGG + Intergenic
1007342580 6:41200981-41201003 GCAGCAGCAGCAGGAAGGCTGGG + Exonic
1007556118 6:42767938-42767960 GGAGCAGCATGGAGGAGGCGTGG + Intronic
1007649817 6:43412568-43412590 CCAGCTGCAGCAGGGAGGCCTGG + Intergenic
1008015840 6:46518600-46518622 GCAGCAGCAGGTTCGAGGCGAGG + Intergenic
1009493367 6:64319812-64319834 GCAGCAGCAGCAGGGAAGAAAGG - Intronic
1009627020 6:66147003-66147025 GCAGCAGCATCTGGGGGGCGAGG + Intergenic
1010129898 6:72479227-72479249 GCGGAAGCAGGAATGAGGCGCGG + Intergenic
1010129901 6:72479246-72479268 GCGGAAGCAGGAATGAGGCGCGG + Intergenic
1010129904 6:72479265-72479287 GCGGAAGCAGGAATGAGGCGCGG + Intergenic
1010129907 6:72479284-72479306 GCGGAAGCAGGAATGAGGCGCGG + Intergenic
1010238247 6:73592641-73592663 GCAGCAGGTGAAAGGAGGAGAGG + Intergenic
1010252317 6:73720836-73720858 ACAGCAGTAGCCAGGAGGCCTGG - Intronic
1010716782 6:79239339-79239361 GCAGCAGGAGCAAGAAGGAGAGG - Intergenic
1013373977 6:109496340-109496362 CCTGCAGCAGCCAGGAGGCGAGG - Intronic
1013576072 6:111483927-111483949 ACTGCAGCAGCAAAGAGGAGGGG - Intergenic
1014558052 6:122856822-122856844 ACAGCAGGAGCAAGGTGGTGGGG + Intergenic
1014854391 6:126381654-126381676 GCAGCAGCAGCAGTGCGGCAAGG - Intergenic
1015311392 6:131770891-131770913 CCAGGACCAGCAAGGAGGCCAGG + Intergenic
1016203531 6:141443336-141443358 CCAGGAACAGCAAGGAGGCCAGG + Intergenic
1016738812 6:147507960-147507982 CCAGCTGCAGCGAGGAGGGGCGG + Intergenic
1016808598 6:148237870-148237892 GCAGGAACAGCAAGGAGGCCTGG - Intergenic
1017161793 6:151372307-151372329 GCAGCAGAATGAAGGAGGGGAGG + Intronic
1018065114 6:160119106-160119128 ATGGCAGCAGCAGGGAGGCGTGG - Intergenic
1018109203 6:160519285-160519307 GCTCCTGCAGCAACGAGGCGTGG - Intergenic
1018134747 6:160768279-160768301 GCTCCGGCAGCAACGAGGCGTGG + Intergenic
1018584293 6:165338764-165338786 GCAGCTGTAGAAAGGAGTCGTGG + Intronic
1018795216 6:167180049-167180071 GCAGCAGAAACAAGGTGGCCAGG - Intronic
1018821104 6:167375013-167375035 GCAGCAGAAACAAGGTGGCCAGG + Intronic
1019543238 7:1560754-1560776 GCAGCAGAGGCCAGGAGGCCGGG - Intronic
1019850719 7:3553892-3553914 GCAGCATCAGCAGGGACCCGTGG + Intronic
1020085438 7:5307775-5307797 GCAGCAGCAGCCTGGAGGGCCGG + Exonic
1020131791 7:5562936-5562958 GCACCAGCGGCGACGAGGCGGGG + Intronic
1020482718 7:8681980-8682002 GGAGCAAAAGCAAGGAGGCAAGG + Intronic
1020690920 7:11353604-11353626 GAGGCAGCAGCAAGGTGGCATGG + Intergenic
1021131139 7:16913971-16913993 GCAGCAGCAGCAGTGTGGTGCGG - Intergenic
1021746487 7:23745884-23745906 GCAGCAGCAGCCAGTAGTGGTGG + Intronic
1022566454 7:31407570-31407592 GCAACAGCAGCAAGGAGTCAAGG + Intergenic
1022663102 7:32384971-32384993 GGAGAAGAACCAAGGAGGCGGGG + Intergenic
1023085069 7:36562274-36562296 GCAGCAACAGCAAGCAGCTGGGG - Intronic
1023791460 7:43757012-43757034 GGGGCAGCAGCAGGGAGGGGTGG + Intergenic
1024261966 7:47580177-47580199 GCAGCAGCAGCCAGGAACAGGGG + Intronic
1024483932 7:49894737-49894759 ACAGGAGCAGCCAGGAGGGGAGG + Intronic
1027128234 7:75572595-75572617 CCAGCTGCAGCAGGGAGGCATGG + Intronic
1028915301 7:96252489-96252511 ACAGAAGCAGCAGGGAGGAGAGG + Intronic
1029020211 7:97357222-97357244 TGAGCAGCAGCAAGGAGTGGGGG + Intergenic
1029159294 7:98540490-98540512 GCAGCAGCTGCAAGGTGGTTTGG + Intergenic
1029270200 7:99373053-99373075 GCAGGAGCAGCAAGGTTGGGGGG + Intronic
1029973946 7:104815245-104815267 CCGGCTGCAGCAGGGAGGCGGGG - Intronic
1031265159 7:119572275-119572297 CCAGCAGCAGCAGGGAGGCCTGG + Intergenic
1031362765 7:120866898-120866920 AAAGCAGGAGCAAGGAGGTGGGG - Intergenic
1031375326 7:121017610-121017632 GTAGCAGCAACAAGAAGGCAGGG - Intronic
1032086184 7:128885024-128885046 CCAGCAGCGGCAGGGAGGTGTGG + Intronic
1034093430 7:148384728-148384750 GAAGCAACAGCTAGGAGGCCTGG + Intronic
1034238530 7:149591810-149591832 GCAGAAGCAGCAAAAAGACGAGG + Intergenic
1034464378 7:151217924-151217946 GGAGCAGCAGCCAGGAGAGGGGG - Intronic
1034520305 7:151614316-151614338 GGAGCAGCAGCAGGGTGGCAGGG + Intronic
1034524622 7:151649697-151649719 GCAGGAGCAAGAAGGAGGGGAGG - Intronic
1034524623 7:151649700-151649722 GGAGCAGGAGCAAGAAGGAGGGG - Intronic
1034747841 7:153538929-153538951 GCAGAAGCAGCAGGAAGGAGAGG - Intergenic
1034840419 7:154390677-154390699 GAAGAAGCAGCAAGGAGGAACGG + Intronic
1035096484 7:156360171-156360193 GCAGAGGCACCAAGGAGGTGAGG - Intergenic
1035434704 7:158850494-158850516 CCAGCTGCAGCAGGGAGGCCTGG - Intergenic
1035609139 8:948686-948708 GCTGGAGCAGCAGGGAGACGTGG - Intergenic
1036122975 8:6038005-6038027 GGAGTAGCAGCAAGGAAGCGAGG - Intergenic
1037155747 8:15696230-15696252 GCTGGAGCAGCAAGGATGCAAGG - Intronic
1037252573 8:16913985-16914007 GCAGAATCAGCAAGGTGTCGTGG - Intergenic
1037805168 8:22054856-22054878 GCCGCGGCAGCAGGGAGGGGGGG - Intronic
1037835639 8:22213405-22213427 GAAGCAGCAGCAGGGAGGAGTGG - Intergenic
1038271918 8:26082114-26082136 TCAGCTGCAGGAAGGAGGCAGGG - Intergenic
1038295958 8:26291396-26291418 GGCGCAGCAGGAAGGGGGCGTGG + Intergenic
1039672125 8:39613047-39613069 GCAGCAGCAACAGGGAGACATGG - Intronic
1041205382 8:55494134-55494156 GCAGCAGCAGCTAGCATGCCTGG - Intronic
1041783720 8:61607961-61607983 GCAGGAGCAGGAAGGAGGATGGG + Intronic
1042488839 8:69376578-69376600 GCAGGAACAACAGGGAGGCGGGG - Intergenic
1042898263 8:73694751-73694773 CCAGCAGCAGCCATGTGGCGTGG + Intronic
1047251502 8:123184706-123184728 GCAGCAGCAGGAGTGAGGTGTGG - Intronic
1047434341 8:124823513-124823535 GGGGCTGCAGCAGGGAGGCGAGG + Intergenic
1047504366 8:125467092-125467114 TCAGAAGCAGGAAGGAGGCTGGG - Intergenic
1048006362 8:130422441-130422463 GGAGCAGGAGCCAGGAAGCGTGG - Intronic
1048327734 8:133452017-133452039 CCATCAGCAGCCAGGAGGAGGGG - Intergenic
1048635578 8:136291835-136291857 AGAGCAGGAGCAAGGAGGCAAGG + Intergenic
1048799948 8:138186142-138186164 GCTGCAGGAGCAAGGAGGAGCGG - Intronic
1048912868 8:139152849-139152871 ACAGCAGCAGCACAGAGGGGTGG - Intergenic
1048980910 8:139703140-139703162 GCAGCAGCAGCGGGGAGGCGGGG + Intergenic
1049291122 8:141802590-141802612 CCAGGAGCAGCAAGCAGGCAGGG - Intergenic
1049409026 8:142464237-142464259 GCAGCAGTAGCAGCGGGGCGAGG - Exonic
1050130355 9:2406310-2406332 CCTGCAGCAGCAGGGAGGCATGG + Intergenic
1051371096 9:16359865-16359887 GCAGCAGAAGGAAGGAGGAAAGG + Intergenic
1052271759 9:26634813-26634835 GCAGCCGCATCAGGGAGTCGGGG - Intergenic
1052864340 9:33455962-33455984 AGATCAGCAGCAAGGAGGCGAGG + Intergenic
1052970747 9:34376071-34376093 GCAGTAGCAGAAAGGAGCCCTGG + Intronic
1053119943 9:35538892-35538914 GCGGCAGCAGCACGGAGACTGGG + Exonic
1053128019 9:35598794-35598816 CCAGCTGCAGCAGGGAGGCATGG + Intergenic
1053455049 9:38227224-38227246 GCAGCTACAGCCAGGAGGTGAGG + Intergenic
1053573755 9:39336758-39336780 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1053838376 9:42165315-42165337 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1054095321 9:60895442-60895464 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1054116783 9:61171366-61171388 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1054123389 9:61282251-61282273 CCAGCAGCAGCAACCAGGTGGGG + Intergenic
1054160923 9:61671717-61671739 GCAGCAGGAGCATCGCGGCGCGG - Intergenic
1054452770 9:65412232-65412254 GCAGCATCTGCAAAGAGGCTGGG + Intergenic
1054590970 9:67011195-67011217 CCAGCAGCAGCAACCAGGTGGGG + Intergenic
1054789890 9:69246748-69246770 TCAGCATCAGCAAGGAGAAGCGG + Exonic
1056266900 9:84906242-84906264 TCAGGAGCAGCAAGGAGATGAGG + Intronic
1056468218 9:86879620-86879642 GCAGCAGCAGGAAGCAGGGGTGG + Intergenic
1056781560 9:89554816-89554838 CCAGAAGCTGCAGGGAGGCGAGG + Intergenic
1056781732 9:89555785-89555807 GCAACAGCAGCCTGGAGGAGTGG - Intergenic
1056782048 9:89557769-89557791 GGAGCTGCAGCAAGAAGGTGGGG - Intergenic
1057043179 9:91862368-91862390 GGAGCAGCAGCCAGGAGTGGTGG + Intronic
1057818530 9:98313921-98313943 GCAGGAGGAGCTAGGAGGGGTGG + Intronic
1057881576 9:98796449-98796471 GCAGCAGCAGCTGGAAGGCCGGG + Exonic
1058486662 9:105448340-105448362 GCAGCAGCAGCCCGGACGCCCGG - Intronic
1059215235 9:112555456-112555478 ACAGCAGCAGAAAGGAGCTGAGG - Intronic
1059697029 9:116739327-116739349 GCAGCAGGAGTAAGTAGGCAGGG - Intronic
1059782779 9:117547217-117547239 GGCACAGCAGCAAGGAGGAGAGG + Intergenic
1060147937 9:121268207-121268229 GCCGCAGCAGCAGGTAGGGGAGG + Intronic
1060493241 9:124100201-124100223 GCAGAAGCAGAAGGGAGGCTAGG - Intergenic
1061061566 9:128253237-128253259 GCAGCTGCAGAAGGGAGGGGCGG - Intronic
1061388179 9:130302755-130302777 GCACCAGCAGCCAGGAGGCCAGG - Intronic
1061612394 9:131755820-131755842 GCAGCCGGAGCGAGGAGGTGGGG - Intergenic
1062121625 9:134836848-134836870 GCAGTAGCAGCCGGGAGGAGAGG - Intronic
1062132390 9:134905772-134905794 GCAGCAGCAGCGGCCAGGCGCGG - Intergenic
1062184590 9:135211270-135211292 CCAGCTGCAGCAGGGAGGTGTGG + Intergenic
1062279562 9:135745902-135745924 TCTGCCGCAGCAAGGAGGCTTGG + Intronic
1062372615 9:136247812-136247834 GGAGCAGCAGCGAGGTGGCAGGG + Intergenic
1062538611 9:137031728-137031750 GCAGCAGCACGAGGGAGGGGAGG + Intronic
1203733092 Un_GL000216v2:108863-108885 GCAGCAGCAGCCAGGCGCAGTGG + Intergenic
1203734395 Un_GL000216v2:122028-122050 GCAGCAGCAGCCAGGCGCAGTGG - Intergenic
1185791991 X:2934190-2934212 GCAGCAGCAGCCAGGTGTGGTGG - Intergenic
1185791992 X:2934193-2934215 GCAGCAGCAGCAGCCAGGTGTGG - Intergenic
1186627092 X:11306014-11306036 GATACAGCAGCAAGGAGGCAGGG - Intronic
1186667509 X:11733140-11733162 GAAACAGGAGCAAGGAGGAGGGG - Intergenic
1189175532 X:38953611-38953633 GAAGCAGCAGCAGGAAGGCCAGG - Intergenic
1189546438 X:42047088-42047110 GAAGCAGCAGCAAGAAGGGACGG - Intergenic
1189888805 X:45577441-45577463 CCAGCAGTAGCAAGGAGGGCAGG + Intergenic
1190739283 X:53278797-53278819 ACAGCAGCAGCAAAAAGGCTAGG - Intronic
1191645008 X:63470779-63470801 CCAGCCCCAGCAAGGAGGGGAGG + Intergenic
1192982948 X:76366758-76366780 GCAGCAGCAACAGTGAGGCTGGG + Intergenic
1193952219 X:87813738-87813760 CCAGCAGCAGAAAGGAGAAGAGG + Intergenic
1194064316 X:89242550-89242572 GGAGCAGGAGCAAGGAGTAGGGG - Intergenic
1194085687 X:89524962-89524984 GCAGCTGCAGCAGTGTGGCGGGG + Intergenic
1195586188 X:106567446-106567468 GCAGCAGCAGCAATGTGACAGGG - Intergenic
1196725674 X:118892835-118892857 GCAGCACCAGCAGGGAAGAGTGG + Intergenic
1196950827 X:120874861-120874883 GCGGCAGCAGCGGGGAAGCGGGG - Intronic
1196951671 X:120931263-120931285 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196952355 X:120936124-120936146 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196953040 X:120940985-120941007 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196953725 X:120945845-120945867 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196954410 X:120950706-120950728 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196955093 X:120955566-120955588 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196955781 X:120960449-120960471 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196956462 X:120965310-120965332 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196957144 X:120970170-120970192 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196957826 X:120975030-120975052 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196958508 X:120979890-120979912 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1196959189 X:120984750-120984772 GCGGCAGCAGCGGGGAGGCGGGG - Intronic
1197796157 X:130300134-130300156 TCGGCTGCAGCAGGGAGGCGTGG - Intergenic
1198636979 X:138711626-138711648 GCAGCAACAGCGAAGATGCGAGG - Exonic
1199718461 X:150524758-150524780 GGAGAAGCAACAAGGAGGAGGGG - Intergenic
1200127302 X:153821892-153821914 TCAGAAGCAGAAAGGAGGCCGGG + Intronic
1200204824 X:154308345-154308367 CAAGGAGCAGCAAGGAGGCCAGG + Intronic
1200438333 Y:3180845-3180867 GCAGCTGCAGCAGTGTGGCGGGG + Intergenic
1200718490 Y:6576649-6576671 GGAGCAGGAGCAAGGAGTAGGGG - Intergenic
1201717232 Y:17058903-17058925 GAAGAAGCAGCGTGGAGGCGAGG - Intergenic