ID: 1073535092

View in Genome Browser
Species Human (GRCh38)
Location 10:104269179-104269201
Sequence GGCAGCAGCAGCAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 960
Summary {0: 1, 1: 0, 2: 7, 3: 106, 4: 846}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535092_1073535096 -9 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535092_1073535102 12 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535092_1073535097 -4 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535092_1073535107 25 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535092_1073535104 15 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535092_1073535108 26 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535092 Original CRISPR GGCAGCAGCAGCAAGGAGGC GGG (reversed) Exonic
900180871 1:1310402-1310424 GGCAGCAGGACCCTGGAGGCTGG - Intronic
900270222 1:1783174-1783196 GGCTCCAGCAGCCGGGAGGCAGG - Intergenic
900900449 1:5512390-5512412 GGCACCTGCAGAGAGGAGGCAGG - Intergenic
900971276 1:5993507-5993529 GGGAGCAGCAGCAGGTAGGGAGG - Intronic
901025019 1:6274567-6274589 GGCAGCAGCAGAAGCGAGGTGGG + Intronic
901434841 1:9241014-9241036 GGAAGCAGCAGGAGGAAGGCTGG - Intronic
901525961 1:9823681-9823703 GCCAGCAGCAGCCGGGCGGCCGG + Exonic
901940377 1:12657261-12657283 GGAAACAGCAGCAGGGAGGCAGG + Intronic
902184113 1:14712241-14712263 GGCAGAAGGAGCAGGGAGACAGG + Intronic
902259602 1:15214783-15214805 GGCAGCAGCACCGAGCACGCCGG - Intronic
902410336 1:16208270-16208292 GGCAGCAGCAGGGAGGAGGTTGG - Intronic
902577355 1:17386702-17386724 GCCAGCAGCAGGACTGAGGCTGG + Intronic
902585849 1:17438348-17438370 GGCAGCAGCGGCGACGAGGACGG - Exonic
902652805 1:17847495-17847517 GGCAGAGGCAGCAAGGAGGAGGG - Intergenic
903306766 1:22418397-22418419 CCCAGCAGGAGTAAGGAGGCTGG - Intergenic
903377754 1:22877064-22877086 TGCAGCAGCAGGAAGGGAGCTGG + Intronic
903664094 1:24996158-24996180 GGGAGGAGCAGCATGGAGGGGGG - Intergenic
903808916 1:26023553-26023575 TGCAGCAGCAGGAGGGAGCCAGG + Intronic
904321967 1:29703693-29703715 AGGAGCAGCAGCAAGGAAGCTGG - Intergenic
904344382 1:29858296-29858318 GGGCACAGCAGCAAGAAGGCAGG + Intergenic
904377070 1:30088350-30088372 GGCAGCATGTGCAAAGAGGCAGG - Intergenic
904576268 1:31507014-31507036 TGCAGCTGCAGCAAGGTGTCTGG + Intergenic
904678760 1:32214636-32214658 GGAAGAGGCAGCAAGGAGGGAGG + Intronic
904799255 1:33081356-33081378 GGCAGAAGGGGCAGGGAGGCAGG - Intronic
904993121 1:34609944-34609966 GACAGGAGCAGAAAGGAGGGAGG + Intergenic
905108345 1:35577143-35577165 CGCAGCAGCAGCAAAGGGGAAGG + Intronic
905915199 1:41679591-41679613 GGCAGCAGCACCTTGTAGGCTGG - Intronic
906126212 1:43428422-43428444 TTCAGCAGCAGCATGGAGGAGGG + Exonic
906156764 1:43618557-43618579 GGCAGAAGCAGGGTGGAGGCTGG - Intronic
906201174 1:43961274-43961296 GGCAGCAGCAGCAGAGACCCCGG - Intronic
906375619 1:45294310-45294332 GAAAGCAGGAGCAAGAAGGCGGG - Intronic
906529156 1:46513256-46513278 GGCCGCAGGTGCAGGGAGGCAGG - Exonic
906885393 1:49640007-49640029 GGCAGAAGAAGGAAGGAGACAGG + Intronic
907414246 1:54303260-54303282 AGCAGGAGCACCAAGGAGGAGGG - Intronic
907706255 1:56835062-56835084 GGTAGAAGGAGCAAGGTGGCAGG - Intergenic
907830602 1:58060947-58060969 GGAGGAAGCAGCAGGGAGGCAGG - Intronic
909134842 1:71785190-71785212 AGCAGCAGCAGCCAGCAGGCTGG + Intronic
909371177 1:74885096-74885118 GGCTGGAGCAGCTGGGAGGCAGG - Intergenic
910035533 1:82783389-82783411 GGCAGCTTCAGGATGGAGGCTGG + Intergenic
910156403 1:84224784-84224806 GCCAGAAGCAGCAAGCAGGGTGG + Intronic
910623711 1:89284362-89284384 GGCTGGAGCAGCTTGGAGGCAGG - Intergenic
911011775 1:93288408-93288430 GGCTGGAGCAGCTGGGAGGCAGG - Intergenic
911048431 1:93648854-93648876 GGAAGCTGCAGCCAGGAGCCAGG - Intronic
912996417 1:114536370-114536392 GGCAGCAGCACCATGGAGGTGGG + Intergenic
913346876 1:117818368-117818390 GGCAGCAGCAGCACCCTGGCTGG + Intergenic
913501611 1:119477207-119477229 GGCAACTGAAGGAAGGAGGCAGG - Intergenic
913552065 1:119925615-119925637 GGCAGGAGTAATAAGGAGGCTGG + Exonic
913957967 1:143320840-143320862 GGCAGGACCAGCAATGGGGCTGG + Intergenic
914052276 1:144146198-144146220 GGCAGGACCAGCAATGGGGCTGG + Intergenic
914126921 1:144820343-144820365 GGCAGGACCAGCAATGGGGCTGG - Intergenic
914234437 1:145795356-145795378 GCCAGCAGCAGCAAGCAGCTTGG - Intronic
914255594 1:145959665-145959687 GACAGCAGCAGAACTGAGGCTGG + Exonic
914699899 1:150122417-150122439 TGGAGGAGCTGCAAGGAGGCTGG + Intronic
914898419 1:151697525-151697547 CCCAGCTGCAGCAAGGAGGTGGG + Exonic
915162247 1:153928994-153929016 GGCAACAGCACCAGGAAGGCAGG - Intergenic
915453799 1:156025509-156025531 GGCAGCAGCAGGAAGAAGTAGGG + Intergenic
915495634 1:156280936-156280958 GGCAGCAGGAGAAAGGAGCCTGG - Intronic
915517176 1:156420426-156420448 GGCGACAGCAGCCAGGAGGCGGG - Intronic
915981239 1:160421095-160421117 TGCAGCGGCAGCTCGGAGGCGGG + Exonic
916252966 1:162756287-162756309 GGTAGCAGAAGAAAGGAAGCAGG + Intronic
916553942 1:165876808-165876830 GGCAGCAGAAGCTGGGAGACAGG - Intronic
916818283 1:168374030-168374052 GCCTGCAGCAGGAGGGAGGCAGG - Intergenic
917345207 1:174022250-174022272 AGCAGCAGCAGGTGGGAGGCCGG - Exonic
917410690 1:174757165-174757187 GGCAGGAGCAGCCAGGTGGCAGG - Intronic
918098951 1:181357097-181357119 GGAAGCAGCAGGCAGGAGGGAGG - Intergenic
918656127 1:187028138-187028160 TGCAGCAGCAGCAAGGACCCAGG - Intergenic
918826982 1:189336884-189336906 AGCAGCAGCAGCAGTGTGGCAGG - Intergenic
919712020 1:200738676-200738698 GGCAGCAGCAGCCAAAAGCCAGG + Intergenic
920365434 1:205445763-205445785 GGCAGCAGCAGCTGGGAACCTGG + Intronic
920613354 1:207464427-207464449 GACAGCAGCAGCAGGGAGAGGGG + Intronic
920682877 1:208085889-208085911 GGCAGCAGCAGGAGGAAGACAGG - Intronic
920758131 1:208755035-208755057 GGAGGCAGCAGCATGGAGTCGGG - Intergenic
921053106 1:211524983-211525005 GGCAGCAGCTGCAATGGGGGAGG + Intergenic
921452400 1:215324111-215324133 GGCTGCAGCAGCTGGGATGCTGG + Intergenic
921702602 1:218284904-218284926 CGCCGCAGCAGCTAGGACGCGGG - Intergenic
921764433 1:218953508-218953530 AGCAGCAGCAGGAGGGAGGGAGG + Intergenic
922719270 1:227892026-227892048 GGCTGCAGCAGTGGGGAGGCTGG + Intergenic
922916302 1:229260385-229260407 GGCACCAGAAGCCAGGAGACAGG + Intergenic
923141061 1:231162091-231162113 GGCAGCGGCGGGAGGGAGGCGGG + Intronic
923506574 1:234610134-234610156 GGCAGCAGCAGCAGCGACGGTGG - Intergenic
923767064 1:236902082-236902104 GGCAGCAGGAGGATTGAGGCGGG - Exonic
924259245 1:242212594-242212616 GGCAGCAGCCGCCAGGCAGCGGG + Intronic
1062905693 10:1178192-1178214 GGCAGCAGAACAAAGGAGCCAGG + Exonic
1063486269 10:6423702-6423724 GGCAGCAGAAGCCAGGAGGTAGG - Intergenic
1063776267 10:9268408-9268430 GGATGCAGCAGCAGGGAGTCAGG - Intergenic
1063847328 10:10145218-10145240 GGGAGCAGTAGGAAGGAGGAGGG - Intergenic
1064266840 10:13832185-13832207 GGGAGCAGCCGAAAGCAGGCAGG - Intronic
1065636668 10:27742228-27742250 GGCAGAGGCAGCCAGGAGCCTGG + Intronic
1066517629 10:36181458-36181480 GGCTGCAACTGCAAGGAGGAAGG + Intergenic
1067008658 10:42690397-42690419 GGCAGCAGCAGCAAGTCTGGGGG - Intergenic
1067044046 10:42974616-42974638 GGAGGCAGCAGCAGGGAGACTGG + Intergenic
1067054774 10:43044190-43044212 GCCAGCAGCTGCACAGAGGCTGG + Intergenic
1067096509 10:43304912-43304934 GGCAGCTGCAGCAAAGAGCCAGG - Intergenic
1067102803 10:43345033-43345055 AGCAGGAGGAGCGAGGAGGCAGG - Intergenic
1067286555 10:44911590-44911612 AGGATCAGCAGCCAGGAGGCAGG - Intronic
1067381107 10:45774242-45774264 AGAAGCAGCAGCAGGGAGCCTGG - Intronic
1067766628 10:49091994-49092016 GGGAGCAGGAGCCAGGATGCAGG + Intronic
1067770102 10:49116519-49116541 GGTAGCAGCAGCTAGCAGGTGGG + Intergenic
1067774947 10:49156686-49156708 GGCAGCAACAGCAGGAAGGCGGG + Intronic
1067888804 10:50114871-50114893 AGAAGCAGCAGCAGGGAGCCTGG - Intronic
1068130493 10:52889815-52889837 TGCAGCAGCACCAGGGAGGACGG - Intergenic
1068910526 10:62374437-62374459 AGCAGCAGCAGCAACAAGTCGGG + Exonic
1069239675 10:66123829-66123851 GGCTGGAGCAGCTGGGAGGCAGG + Intronic
1069958817 10:72067842-72067864 GGCAGCAGCAGAAGGGAAGGTGG + Intronic
1070161308 10:73868262-73868284 GGAAGCAGCAGGAAGAAGGCAGG + Intronic
1071721124 10:88147190-88147212 GGCAGCAGCAGCACAGAGGAAGG + Intergenic
1072189121 10:93066311-93066333 GGCGGCAGGAGGCAGGAGGCTGG - Intronic
1072688071 10:97550494-97550516 TCCTGCAGCAGCAGGGAGGCAGG - Intronic
1072723846 10:97799507-97799529 TGAAGGAGCAGCAAGGTGGCTGG - Intergenic
1073156902 10:101354369-101354391 GGGAGCTCCAGAAAGGAGGCTGG + Intronic
1073458683 10:103653057-103653079 GTCAGCAGCAGGGAGGGGGCAGG - Intronic
1073535092 10:104269179-104269201 GGCAGCAGCAGCAAGGAGGCGGG - Exonic
1073693935 10:105844400-105844422 AGCAGAAACAGCAAGGGGGCAGG - Intergenic
1074298086 10:112209583-112209605 AGCAGCAGCAGGCAGGAGGCTGG - Intronic
1076395738 10:130136409-130136431 GGCGGCGGCAGCATGGCGGCGGG + Exonic
1076487922 10:130836129-130836151 GGAAACAGCAACAAAGAGGCTGG - Intergenic
1076511129 10:131014400-131014422 GGTAGGAGCAAGAAGGAGGCTGG + Intergenic
1076607812 10:131700778-131700800 GGAGGCAGCAGCAAGGATGCAGG - Intergenic
1076673163 10:132134101-132134123 CGGAGCGGCAGCAAGGAAGCGGG - Intronic
1076922603 10:133462577-133462599 GGCAGCAGCAGCAAGGTGTGTGG + Intergenic
1077114219 11:875904-875926 GGCTGGAGGAGCGAGGAGGCTGG + Intronic
1077192602 11:1261722-1261744 GGCAGCAGGAGCACGGAGCGCGG - Exonic
1077265735 11:1648620-1648642 GGCATCAGCAGCAGGCAGGAGGG - Intergenic
1077505470 11:2928122-2928144 GGCAGCAGCAGCTCGGACCCAGG + Intergenic
1078405998 11:11070400-11070422 GGCAGCAACAGGGAGGAGGAGGG - Intergenic
1078523979 11:12086659-12086681 GGAAGCAGGAGGCAGGAGGCTGG - Intergenic
1078910202 11:15723976-15723998 TGAAGCAGCAGGAAGTAGGCAGG - Intergenic
1079479491 11:20864641-20864663 GGCAGCAGCAACAGGCAGACAGG - Intronic
1080666386 11:34339933-34339955 GGAACCAGCAGGAAGGAGGCAGG + Intronic
1080871635 11:36241747-36241769 GGAAGAAGTAGCAAGGAGGGTGG - Intergenic
1081083863 11:38775179-38775201 GGCCGGAGCAGCTAGGATGCAGG + Intergenic
1081617089 11:44597459-44597481 GGCAGAGCCAGAAAGGAGGCTGG - Intronic
1081814031 11:45928772-45928794 GGCAGCAGCCCCATGGTGGCGGG - Exonic
1081977108 11:47242689-47242711 GGCATGACTAGCAAGGAGGCCGG + Intronic
1082762896 11:57144331-57144353 GGCGGGAGCTCCAAGGAGGCCGG - Intergenic
1083006844 11:59355156-59355178 TGCAGCAGCAGCAAGAACTCAGG + Intergenic
1083430354 11:62611144-62611166 GGCAGCAGCAGCAGTGGTGCTGG - Exonic
1083591026 11:63895005-63895027 GGCAGCAGAAGAAAGGAGAGGGG - Intronic
1083635744 11:64120083-64120105 GGCAGAAGCAGCAGCGGGGCAGG + Intronic
1083843476 11:65317372-65317394 GGCGGGAGCAGGAAGGAGGAAGG - Intronic
1084030215 11:66476559-66476581 GGCGGCAGCAGGAAGGATGAAGG - Exonic
1084119343 11:67059841-67059863 GGGGCCAGCAGCCAGGAGGCTGG + Intronic
1084183342 11:67457425-67457447 GCCTGCAGCAGATAGGAGGCTGG - Intronic
1084670170 11:70601885-70601907 GGCAGCTGCAGCATGGAGCCAGG + Intronic
1084811483 11:71614397-71614419 GACAGCGGGAGCAAGGTGGCAGG - Intergenic
1085527325 11:77172043-77172065 GGCAGCAGCAGGCTGGGGGCGGG - Intronic
1085666313 11:78417944-78417966 AGCAGCTGCAGCAGGAAGGCCGG + Intronic
1085752924 11:79177760-79177782 AGGAGGGGCAGCAAGGAGGCAGG + Intronic
1085939799 11:81195455-81195477 TGGAGCAGGAGCAAGGAGACAGG - Intergenic
1085960675 11:81457953-81457975 GGCAGCAGCAAGAAGGCAGCAGG - Intergenic
1087600873 11:100313787-100313809 GGAAGAATCAGCAAGGAGGCTGG + Intronic
1087728506 11:101751788-101751810 GGCTGCAGCTTCAAGGAGGCTGG - Intronic
1088425077 11:109693559-109693581 GGCAGTGGCAGCAGGAAGGCAGG - Intergenic
1088822568 11:113469170-113469192 GGCAGGAGCAGGAGGGAGGCAGG - Intronic
1089062586 11:115637990-115638012 GGCATCTTCAGCAAGGAGACTGG - Intergenic
1089111664 11:116062323-116062345 GGCAGCTCCAGGAAGGAGGGAGG + Intergenic
1089318983 11:117612414-117612436 GGCAGGAGAAGGAAGCAGGCTGG - Intronic
1089392495 11:118111709-118111731 GGCAGAGGCAGGGAGGAGGCAGG - Intronic
1089686138 11:120147936-120147958 GGCAGCTCCAGCAGGGAGGCCGG + Intronic
1089931798 11:122320353-122320375 CCCAGCAGCAGCAAGGCTGCCGG + Intergenic
1090027584 11:123180953-123180975 GCCAGCAGCAGCAAGCAGACTGG + Intronic
1090380235 11:126321403-126321425 GGCAGCAGCTGGATGGGGGCCGG - Intronic
1090396841 11:126424701-126424723 AGCAGCAGCGGCAAGCAGGATGG - Exonic
1090478809 11:127049614-127049636 TGCAGCAGCACCCAGCAGGCAGG - Intergenic
1090809454 11:130223798-130223820 GGGAATGGCAGCAAGGAGGCTGG + Intergenic
1090965033 11:131591006-131591028 GACAGGAGCAGCAAGCAGGCTGG + Intronic
1091236393 11:134025110-134025132 GGCAGGGGCAGAAGGGAGGCAGG - Intergenic
1091243221 11:134069129-134069151 AGCAGCAGCAGGAAGAAGTCAGG - Exonic
1091644477 12:2263327-2263349 GGTAGGAGCAGGGAGGAGGCAGG + Intronic
1091934046 12:4421069-4421091 GGCAGGGACAGCAAGGAGGCAGG - Intergenic
1092465231 12:8725606-8725628 GGCAGAGGCTGCAAGGGGGCAGG + Intronic
1092678711 12:10952820-10952842 GCCAGCAGCAGCAGTGTGGCAGG - Intronic
1092741061 12:11630084-11630106 CACAGAAGCAGGAAGGAGGCAGG - Intergenic
1092908643 12:13125283-13125305 GATAGCAGCAGTAAGGAGACAGG - Intronic
1093144518 12:15549131-15549153 GGCAGTGGCAGGAAGAAGGCTGG - Exonic
1093547718 12:20368514-20368536 GGCAGCCGCAGAAGGGAGGGAGG - Intergenic
1094523406 12:31216162-31216184 AGCAGCAGCAGCAGTGAGGTGGG - Intergenic
1095401357 12:41818077-41818099 AGGAGCAGGAGCAAGGGGGCAGG - Intergenic
1095419976 12:42015350-42015372 GGGAACAGCACCAAGGAGTCTGG - Intergenic
1095538622 12:43281703-43281725 GGCAGCAGTGGCAAGGACTCAGG + Intergenic
1097056446 12:56252785-56252807 GGAAGCAGCAGCATGAAGACAGG + Exonic
1097189272 12:57211797-57211819 GCCAGCAGCAGCCAGGACGTAGG + Exonic
1097694566 12:62764003-62764025 GGCAGCAGCTGGATCGAGGCAGG - Intronic
1098111298 12:67124416-67124438 AGCAGCAACAGCAAGAAGGGTGG + Intergenic
1098541153 12:71659227-71659249 GGCAGCAGCAGTATGAAGGATGG - Intronic
1099693904 12:85994071-85994093 GCCAGCTGCAGCAGGGAGGCTGG - Intronic
1099722533 12:86382705-86382727 GGCTGGAGCAGCTAGGATGCAGG - Intronic
1100528935 12:95446710-95446732 GGCAGTAGCAGCGGGGAGCCAGG - Intergenic
1100608425 12:96170619-96170641 GGCTGCAGGAGGAAAGAGGCTGG + Intergenic
1100981203 12:100164116-100164138 GGCAGCAGTGACAAGGAGCCAGG - Intergenic
1101748450 12:107562494-107562516 GCCAGGACCAGCAAGGAGGCTGG + Intronic
1101860615 12:108479458-108479480 CACAGCAGCAGGAAGGAGGGAGG + Intergenic
1102901976 12:116646086-116646108 GGCGGCAGCAACAGGGAGGCAGG + Intergenic
1103564046 12:121806564-121806586 GGAAGGGGCAGCAAGGAGGTGGG - Intronic
1103739032 12:123078810-123078832 GGCAGCTGCAGCAGTGAGGCTGG - Intronic
1103835430 12:123816245-123816267 GGCAGCTTCAGCATGGGGGCTGG + Intronic
1103925676 12:124422374-124422396 GGCAGCTGGAGCAAGGGGCCAGG + Intronic
1104657940 12:130587890-130587912 GGCAGCACCAGCATCCAGGCAGG - Intronic
1104743656 12:131196397-131196419 GGCAGCAGGAGCAAAGGCGCTGG - Intergenic
1104879473 12:132060521-132060543 GTCAGCAGCAGCAGTGAGGCCGG + Intronic
1104946493 12:132417037-132417059 GGCGGCAGCCCCAAAGAGGCAGG + Intergenic
1105014183 12:132776190-132776212 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014214 12:132776349-132776371 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014231 12:132776426-132776448 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014248 12:132776505-132776527 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105014265 12:132776584-132776606 GGCGGGAGCAGCAGGGAGGAAGG - Intronic
1105723107 13:23135429-23135451 GGGAGGAGCAGAAGGGAGGCTGG - Intergenic
1105759490 13:23500564-23500586 ACCAGAAGCAGCAAGGAGACAGG + Intergenic
1106298369 13:28439361-28439383 GGCAGGACCAGCAAGCAGGTGGG - Intronic
1106541719 13:30696579-30696601 AGCAAGAGCAGGAAGGAGGCAGG + Intergenic
1107298615 13:38941403-38941425 GGCAGCACCAGCGTGGGGGCTGG - Intergenic
1107881585 13:44836852-44836874 CGCAGGAGCAGCAAGGAGGCTGG - Intergenic
1107958821 13:45541825-45541847 GGAAGCAGCAGGAAGGTGGCAGG - Intronic
1108095553 13:46897109-46897131 GGTAGCAACAGCCAGGAGGGCGG + Intergenic
1108214240 13:48168303-48168325 AAAAGCAGCAGCTAGGAGGCTGG + Intergenic
1109134134 13:58625707-58625729 AGCAGCAGCAGCAGGCAGGCAGG - Intergenic
1109676071 13:65676813-65676835 TGAAGCAGCAGCAAGGACACAGG + Intergenic
1110180410 13:72610665-72610687 GGCAGCAGCGGCAGCGAGGCTGG + Intergenic
1110275845 13:73640932-73640954 GGCAGCAGCGGCAGCGAGGCTGG + Intergenic
1110328175 13:74241538-74241560 GGCAGCAGCGGCAGCGAGGCTGG - Intergenic
1111501261 13:89123147-89123169 GTCAGCAGTAGCAAGCAGCCTGG - Intergenic
1111551407 13:89818122-89818144 GGCTGGAGCAGCTAGGATGCAGG - Intergenic
1112286247 13:98107077-98107099 GAAAGCAGGAGCAAGGCGGCGGG + Intergenic
1112432551 13:99363544-99363566 TACAGCAGCAGCAAAGAGCCGGG - Intronic
1113274645 13:108715166-108715188 TGAAGGAGCAGCAAGGTGGCCGG - Intronic
1113335539 13:109372842-109372864 CGCAGCAGGAGCCAGGAGGCTGG - Intergenic
1113547888 13:111168345-111168367 GGCAACAGCTGCTAGGTGGCTGG - Intronic
1113625487 13:111793186-111793208 GGCAGCAGAGGCAGGGAGCCCGG - Intergenic
1113630762 13:111882052-111882074 GTGAGCAGCAGCAAAGAAGCAGG + Intergenic
1113674119 13:112196362-112196384 GGCAGGAGCAGGGAGGAGGGAGG - Intergenic
1113706026 13:112433515-112433537 GGGAGCAGCAGCCAACAGGCTGG - Intronic
1113813824 13:113158432-113158454 GGCAGCAGGTGCAAGGTGGAAGG - Intergenic
1114525655 14:23365788-23365810 GGCAGCAGCAACCAGCACGCAGG + Intergenic
1116553582 14:46274213-46274235 GGCAGGAACAGCATGGTGGCGGG + Intergenic
1116659108 14:47685064-47685086 GTCAGCAGCAGGTAGGGGGCGGG - Intergenic
1118224775 14:63888442-63888464 GGCAGCAGTAACAAGGACCCAGG - Intronic
1118983813 14:70736231-70736253 GGCAGCTGCAGCACGGTTGCAGG + Intronic
1119344488 14:73911399-73911421 TGCAGCAGGAGCAAGGAAGTTGG + Intronic
1121310440 14:92932721-92932743 GGCCGCAGCTGCGACGAGGCTGG + Exonic
1121526738 14:94624402-94624424 AGCTGCAGGAGCAAGGAGTCCGG - Intronic
1121784792 14:96649352-96649374 GGCAGCAGCTGCAGGCAGGCAGG + Intergenic
1122007958 14:98721364-98721386 GGTACCAGCAGAAAGGAGGCAGG - Intergenic
1122064255 14:99160442-99160464 GGAAGCAGGGGCAAAGAGGCTGG + Intergenic
1122198998 14:100110701-100110723 GGCAGCAGCAGGATGCAGGTGGG - Intronic
1122278891 14:100609886-100609908 GGCAGCAGCAGGCCGCAGGCTGG + Intergenic
1122619369 14:103046038-103046060 CGCAGCAGGGGCAACGAGGCTGG + Intronic
1122847156 14:104506292-104506314 GCCAGGAGGAGCAGGGAGGCAGG - Intronic
1123117006 14:105899382-105899404 GGAAGCAGTAGCAGGAAGGCAGG + Intergenic
1123421934 15:20142176-20142198 GGCAGGACCAGCAATGGGGCTGG + Intergenic
1123443147 15:20304459-20304481 GGCAGGACCAGCAACGGGGCTGG - Intergenic
1123531162 15:21148716-21148738 GGCAGGACCAGCAATGGGGCTGG + Intergenic
1123540524 15:21285254-21285276 GCTGGCAGCAGCAGGGAGGCAGG + Intergenic
1123970430 15:25503455-25503477 GCCAGCAGCAGCAAGTGGGTTGG - Intergenic
1125277266 15:38006180-38006202 GGCAGAAGCAGGAAGGAGCATGG + Intergenic
1125331592 15:38588000-38588022 AGCAGAAGCTGCAAGCAGGCTGG - Intergenic
1125520926 15:40347470-40347492 GGCAGCAGCGGCTGGAAGGCTGG + Intergenic
1125729654 15:41886018-41886040 GGCAGAGGCTGCAAGGAGCCAGG - Exonic
1126330492 15:47525932-47525954 GGCAGCAGAAGGAAGGGGGAAGG + Intronic
1126587946 15:50308479-50308501 GGCAGGAGCAGACAGGAGGAGGG + Intronic
1127698188 15:61472080-61472102 GGCAACAGCAGCAGGGAGTGGGG - Intergenic
1128304872 15:66591805-66591827 GGCAGCAGCAGGAAGAGGGATGG - Intronic
1128367951 15:67018074-67018096 GTCATTAGCAGCAAGGAGGTGGG - Intergenic
1128766824 15:70256221-70256243 GGGAACAGCAGCCAAGAGGCAGG + Intergenic
1129029895 15:72610443-72610465 GGCAGCTCCAGCCTGGAGGCAGG + Intergenic
1129038111 15:72663191-72663213 GGCAGCTCCAGCTGGGAGGCAGG + Intronic
1129182379 15:73885412-73885434 GGAAGAAGCAGCGAGGAGGGAGG - Intronic
1129199861 15:73992294-73992316 GGAAGCAGCAGCCAGGAGGGCGG - Exonic
1129211779 15:74074040-74074062 GGCAGCTCCAGCTGGGAGGCAGG - Intronic
1129398624 15:75267044-75267066 GGCAGCTCCAGCTGGGAGGCAGG + Intronic
1129402232 15:75291320-75291342 GGCAGCTCCAGCTGGGAGGCAGG + Intronic
1129408804 15:75337666-75337688 CCCAGCAGCAGCAGGGAAGCTGG + Intronic
1129548066 15:76418899-76418921 GGCAGCAGCCACAACCAGGCTGG - Intronic
1129728902 15:77918312-77918334 GGCAGCTCCAGCTGGGAGGCAGG - Intergenic
1129733127 15:77943121-77943143 CGGAGCAGCAGCAGGGAAGCCGG - Intergenic
1130093421 15:80839500-80839522 CGCAGCAGCAGCAGCGAAGCCGG + Intronic
1130168128 15:81484127-81484149 TGCGGCAGCAGGAAGGTGGCCGG + Intergenic
1130550329 15:84886513-84886535 GGCAGGAGCTGCAGGGAGCCAGG + Intronic
1130669154 15:85895118-85895140 GAAAGCAGCAGCAAAGAGGAGGG - Intergenic
1131032724 15:89199954-89199976 GGCAGCAGCAGCAGAGGGGAAGG - Exonic
1131188101 15:90292552-90292574 GGCAGCTGCAGCCTGGGGGCAGG + Intronic
1131308050 15:91262891-91262913 GGCAGCAGGGGCAGGGTGGCAGG - Intronic
1132090794 15:98946643-98946665 GGCATCAGCTGCAGGGAAGCCGG + Intronic
1202948838 15_KI270727v1_random:12396-12418 GCTGGCAGCAGCAGGGAGGCAGG + Intergenic
1132517538 16:372820-372842 GGCAGCAGCTCCGAGGGGGCAGG - Intronic
1132606095 16:794360-794382 GGGAGCAGGAGCCAGGAGGGTGG + Intronic
1132645498 16:997533-997555 GGCAGGAGCGGCAGGGAGGCTGG + Intergenic
1132659810 16:1056237-1056259 GGCAGCAGGAGCACGCAGGTGGG + Intergenic
1132667699 16:1089672-1089694 GGCTGCAGCAGCAGGGCGCCTGG - Intergenic
1133213019 16:4273469-4273491 TGCAGCGGCAGCAAGGAAGGCGG + Intergenic
1133371410 16:5248464-5248486 GGCCGCAGCTGGAAGGGGGCAGG + Intergenic
1133783622 16:8958345-8958367 ACCGGCAGCACCAAGGAGGCTGG + Intronic
1134041715 16:11073701-11073723 TGGAGCAGGAGGAAGGAGGCTGG - Intronic
1134356532 16:13487442-13487464 GGTGGGAGCAGGAAGGAGGCAGG + Intergenic
1134450146 16:14358327-14358349 GGCTGGAGCAGGAGGGAGGCAGG + Intergenic
1135482600 16:22833396-22833418 GGAAGCAGCAGCAATGACCCAGG + Intronic
1135574018 16:23571233-23571255 GGCAGCAGCAGCACGGCGGGAGG - Exonic
1135657175 16:24260691-24260713 TGCAGCATCAGCAGGGATGCAGG + Intronic
1136140968 16:28288493-28288515 GATAACTGCAGCAAGGAGGCGGG - Intergenic
1136455484 16:30377723-30377745 GGCCGGAGCAGCAAAGGGGCTGG + Intronic
1136631256 16:31490415-31490437 AGCGGCAGCAGCCAGGCGGCTGG + Exonic
1137456203 16:48619872-48619894 GGAGGCAGCTGCAGGGAGGCAGG - Intronic
1137456451 16:48621547-48621569 GGAGGCAGCTGCAGGGAGGCAGG - Intergenic
1137512701 16:49115334-49115356 GCAAGCAGAAGCCAGGAGGCAGG + Intergenic
1137695456 16:50458993-50459015 GCCAGCAGCTGCAGGTAGGCTGG + Intergenic
1138146245 16:54614814-54614836 GGAAGCAGGAGCAAGAAGGGGGG - Intergenic
1138528418 16:57621816-57621838 GGCAAGAGCAGCAAGTAGGATGG + Intronic
1138623438 16:58230440-58230462 GGCTGCAGGAACAAGGAGACAGG + Intergenic
1138810129 16:60139730-60139752 AGCAACAGCAGCAAGGGGGGTGG + Intergenic
1139513266 16:67439239-67439261 GGCACCAGCAGGCAGGAGGGCGG + Intronic
1139519435 16:67472114-67472136 AGCAGCAGCAGCAAGCTGGAGGG + Intronic
1140228258 16:73096169-73096191 GGCAGCCGGAGCAGGCAGGCAGG - Intergenic
1141478979 16:84293710-84293732 AACAGCAGCAGAGAGGAGGCTGG - Intergenic
1141594604 16:85089582-85089604 GGCAGCGACAGGCAGGAGGCAGG - Exonic
1141611445 16:85183393-85183415 GGCTGCACCAGGAAGGAGGTGGG + Intronic
1141699304 16:85635171-85635193 AGCAGCAGCAGAAAGGATCCAGG - Intronic
1141727032 16:85796453-85796475 GCCTGCAGCAGAAAGGATGCTGG - Intronic
1141950027 16:87334128-87334150 GCCAGGAGCAGCAGGAAGGCGGG - Exonic
1142034989 16:87857121-87857143 GCCAGCAGTGGCAGGGAGGCAGG - Intronic
1142153320 16:88522164-88522186 AGTGGCAGCAGCAAGGCGGCAGG + Intronic
1142386838 16:89770676-89770698 GGGAGCAGCAGGAAGGAAGCCGG + Intronic
1142470698 17:161782-161804 GCCAGGAGTAGCCAGGAGGCTGG + Intronic
1142669721 17:1482615-1482637 GGCAGCAGTAGCTACAAGGCGGG - Intronic
1143025930 17:3942020-3942042 GGCCTCAGCAGCAGGGAGGCAGG + Intronic
1143100930 17:4504337-4504359 GGAAGCAGGAGCAAGGAAGTGGG - Intronic
1143361130 17:6372193-6372215 AGAAGCAGCAGGAGGGAGGCGGG + Intergenic
1143492900 17:7294375-7294397 GGGAGCCGCAGAAAGGCGGCGGG - Exonic
1143965092 17:10751363-10751385 GGCCGCAGCCTCAGGGAGGCTGG - Intergenic
1143968066 17:10771164-10771186 GGCACCAGCATCAAGGCTGCAGG - Intergenic
1144078108 17:11737098-11737120 GGCTTCAGCAGCCAGGACGCTGG - Intronic
1144667556 17:17112326-17112348 GGATGCAGGGGCAAGGAGGCCGG - Intronic
1144833303 17:18143638-18143660 GGCAGCAGGGCCAAGGAGGGAGG + Intronic
1145238949 17:21228383-21228405 TGGAGCAGCAGGAAGGAAGCAGG - Intergenic
1145980401 17:29007769-29007791 GGCAGCAGCAGAAGGATGGCAGG + Intronic
1146184376 17:30715446-30715468 GGCAGCTGCATCGAGGAAGCGGG - Intergenic
1146306076 17:31730806-31730828 AGCAGCAGCAGCAAGAAAGAAGG + Intergenic
1146588867 17:34110434-34110456 GGCAGCGGCAGCAGAGAGGCTGG - Intronic
1146646044 17:34578300-34578322 GGCAGCAACAGCCAGCAGCCAGG + Intronic
1147526332 17:41227161-41227183 GTGATCAGCAGCAAGAAGGCTGG - Exonic
1147527363 17:41238513-41238535 GTGATCAGCAGCAAGAAGGCTGG - Exonic
1147964790 17:44188722-44188744 AGCAGCAGCAGCAAGGCTGTGGG + Intronic
1148027796 17:44600397-44600419 GGCATCAGCAGCAAGGAGGGAGG - Intergenic
1148207825 17:45790765-45790787 GGCTGCAGAACCAGGGAGGCAGG + Intronic
1148253500 17:46107191-46107213 TGCAGCAACAGCAAGGGGGATGG + Intronic
1148568492 17:48647589-48647611 GGGAACAGAAGAAAGGAGGCAGG - Intergenic
1148828792 17:50415469-50415491 GATACCAGCAGCAAGGTGGCGGG + Intergenic
1148902383 17:50888140-50888162 AGCAGGAGCAGCCAGAAGGCAGG + Intergenic
1148903732 17:50898285-50898307 GGAAGCAGCAGGAAGAAGCCTGG + Intergenic
1149400265 17:56288885-56288907 GGAAGCAGCAGCAATGACCCAGG - Intronic
1149812784 17:59693677-59693699 GGGGGCAGGGGCAAGGAGGCAGG - Intronic
1150646229 17:66979066-66979088 GGCAGCAGCACAAAGAAGACTGG - Intronic
1151147393 17:72053732-72053754 GGGTTCAGCAACAAGGAGGCTGG - Intergenic
1151313652 17:73309510-73309532 GGCAGCAGCACAGTGGAGGCAGG + Intronic
1151681461 17:75624926-75624948 TGCAGCAGCAGCTCGGAGGCAGG - Intergenic
1151718444 17:75843118-75843140 GGCAGCTGCAGGAAGGGGGGTGG + Intronic
1151849546 17:76682335-76682357 GGCATCAGAGGCATGGAGGCCGG + Intronic
1151951098 17:77354576-77354598 GGCAGCGGCCGCATGCAGGCAGG - Intronic
1152476455 17:80521516-80521538 GGCAGAAGCAGCAGGCAGGGAGG + Intergenic
1152586637 17:81192313-81192335 GGCCGCACCAGGAAGGAGGTGGG - Exonic
1152630319 17:81408076-81408098 GGCAGCAGGAGGAAGGGGGCCGG - Intronic
1152710492 17:81868644-81868666 GGCAGAAGCAGCAACGAGACAGG + Exonic
1153056370 18:950063-950085 GGTAGCAGCCCCAGGGAGGCAGG + Intergenic
1153410111 18:4783257-4783279 GGGTGCAGCAGCAAGGACCCAGG - Intergenic
1153647259 18:7206339-7206361 CGAAGCAGCAGCCAGGAGGCAGG - Intergenic
1154333942 18:13451393-13451415 GGAAGCAGAAGCAAGGAGTGAGG - Intronic
1154399773 18:14025496-14025518 GGAACCAGCAGTTAGGAGGCAGG + Intergenic
1155034941 18:22018262-22018284 GGAAGAGGCAGGAAGGAGGCAGG - Intergenic
1155390402 18:25329636-25329658 GGCAGCGGCAGAGAGCAGGCTGG + Intronic
1157006553 18:43590211-43590233 GGCAGGAGCAGGGAGCAGGCAGG - Intergenic
1158831531 18:61284652-61284674 TGAAGCTGCAGGAAGGAGGCAGG - Intergenic
1159209039 18:65292070-65292092 AGCAGCAGAAGCAAGGAGAGAGG - Intergenic
1159607722 18:70493046-70493068 GCCAGGAGCAGCAGAGAGGCAGG - Intergenic
1159792319 18:72797751-72797773 GGAACCAGCAGCATGGAGCCAGG - Intronic
1160245541 18:77155928-77155950 GGCAGGAGCAGCAACGAGACAGG - Intergenic
1160371830 18:78378539-78378561 GGCAGGAGCTGCAGGAAGGCAGG + Intergenic
1160371834 18:78378556-78378578 GGCAGGAGCGGCAGGAAGGCAGG + Intergenic
1160371838 18:78378573-78378595 GGCAGGAGCGGCAGGAAGGCAGG + Intergenic
1160464865 18:79068604-79068626 GGAAGCAGCAGTGAGGAAGCAGG + Intergenic
1160477870 18:79208982-79209004 GGCAGCAGCATGAAGAAGGCTGG - Intronic
1160585667 18:79912014-79912036 GACAGCAGCAGGAAGGGGACAGG + Intronic
1160801447 19:971949-971971 GGCAGCAGCAGCAACGCAGGCGG + Exonic
1160842230 19:1151284-1151306 TGCAGCTGCAGGAAGGGGGCGGG + Intronic
1160900733 19:1426835-1426857 AGCTGCCGCACCAAGGAGGCCGG - Intronic
1161059767 19:2209118-2209140 GGGAGGAGCAGGAAGGAGGCGGG - Intronic
1161063472 19:2226668-2226690 GGCAGCCGCGGCAAGGAGGCAGG + Exonic
1161120894 19:2525628-2525650 GGCAGCACCGGCAGGGAGGGAGG + Intronic
1161362345 19:3857760-3857782 AGCAGCAGCAGCAAATAGCCTGG - Intronic
1161597218 19:5156688-5156710 GGTGACAGCAGCCAGGAGGCGGG + Intergenic
1161706317 19:5823779-5823801 CCCAGGAACAGCAAGGAGGCCGG - Intergenic
1161769811 19:6225110-6225132 GGCAGCAGCTGCAGGGAGCCAGG - Intronic
1162136410 19:8558037-8558059 GGCAGGGGCAGCAGGGAGGCAGG - Intronic
1162467404 19:10850453-10850475 GGCGGCAGCAGCAAGGCTCCAGG + Exonic
1162818889 19:13211098-13211120 GGGAGCAGCAGCATGCACGCTGG + Intronic
1162974401 19:14200228-14200250 GGCAGCTGCATCGAGGAAGCGGG + Intronic
1163183362 19:15619337-15619359 GGCAGAAGAAGAAAGGAGGGTGG - Intronic
1163369035 19:16891886-16891908 GCCACCAGCAGCCAGGAGACAGG + Exonic
1163704375 19:18803787-18803809 GCAAGCTGCAGCAAGGAGGTGGG + Intergenic
1163846864 19:19643092-19643114 GGCAGCAGTAGAAATGTGGCGGG - Intronic
1163847597 19:19646346-19646368 GGCTGCAGCAGCAAGGCGGGTGG + Exonic
1163908289 19:20167168-20167190 GGCAGCTGGAGCAAAGAGGACGG + Intergenic
1163961525 19:20700009-20700031 GGAAGCAACATCCAGGAGGCAGG - Intronic
1164161432 19:22627832-22627854 AGCAGCAGCAGCTTGGAGGAAGG + Intergenic
1164537733 19:29098957-29098979 GCCAGCAGCATCATGGGGGCAGG - Intergenic
1164537852 19:29099588-29099610 GAAAGCAGCAGCATGGAGGCAGG - Intergenic
1164630793 19:29760288-29760310 GGCAGCAGGAGGCAGGCGGCGGG + Intergenic
1164754425 19:30679391-30679413 TGCAGCAGAAACAAGGTGGCTGG + Intronic
1164905968 19:31968300-31968322 GGCATCTGTAGGAAGGAGGCTGG - Intergenic
1164958605 19:32407226-32407248 GGCAGCAGCAAGTGGGAGGCGGG - Intronic
1165026983 19:32969452-32969474 GGCAGCAGGAGGAAGGGGGTGGG - Intronic
1165396219 19:35565040-35565062 GGCAGCAGCAGCGAGGGGCTGGG + Intergenic
1165761925 19:38326664-38326686 GTCAGCAGCAGCATGGTGGTCGG - Exonic
1165826610 19:38709326-38709348 TGCAGGAGCAGGAGGGAGGCAGG - Intronic
1165861629 19:38912121-38912143 AGCAGCAGCAGCTCAGAGGCTGG + Exonic
1165935517 19:39386364-39386386 GGCAGCAGCAGTGAGAAGGAGGG - Exonic
1166102650 19:40580363-40580385 GGCCTCAGCAGCTAGGAGGACGG + Exonic
1166644339 19:44520035-44520057 GGAGGCAGCTGCAGGGAGGCTGG - Intronic
1166695741 19:44850720-44850742 GGCTGCAGCAGCCAGGATGTAGG - Intronic
1166895336 19:46018926-46018948 GGAATCAGCACCAAGGCGGCCGG - Intronic
1167108569 19:47445761-47445783 TGCAGCAGCAGGAGGGAAGCAGG + Intronic
1167124457 19:47539667-47539689 GGCAGTGGCAGGAAGGAGGCAGG + Intronic
1167369567 19:49072549-49072571 CGCAGCAGCCGCACGGCGGCGGG + Exonic
1167698103 19:51026591-51026613 GGCAGCTACAGCAGGTAGGCTGG + Intronic
1168148023 19:54430378-54430400 GGCAGGAGCAGAAGGGACGCGGG + Intronic
1202691673 1_KI270712v1_random:98622-98644 GGCAGGACCAGCAATGGGGCTGG + Intergenic
925039457 2:719897-719919 GTCAGCATCAGCATGGAGGCAGG - Intergenic
925085040 2:1101200-1101222 GGCAGCAGGGGCAGGCAGGCAGG - Intronic
925087257 2:1117782-1117804 TGCAGCAGCAGCAAAGACCCGGG - Intronic
925182057 2:1823729-1823751 GGCACGAGCAGCGATGAGGCTGG + Intronic
925354388 2:3227763-3227785 AGCAGCAGCAGCTGGGATGCAGG - Intronic
925540342 2:4959932-4959954 GGATGCAGCAGAAAGGAAGCTGG + Intergenic
925780623 2:7378537-7378559 GGCAGACGCACCAGGGAGGCCGG - Intergenic
926188440 2:10709406-10709428 GGCAGCAGCAGCCTGGAGGGCGG + Intergenic
926243570 2:11105637-11105659 GCCAGGCGCAGCAGGGAGGCAGG + Intergenic
926251073 2:11155718-11155740 GGCAGCAGCTGCGAGGGGGCAGG - Intronic
926927733 2:18004691-18004713 GGGAGCAGCAGCAAGAATGAAGG - Intronic
927096230 2:19749623-19749645 GGAAGCAGGAGGCAGGAGGCAGG - Intergenic
927209590 2:20630874-20630896 GGCAGCAGGTGCATGGAGGGAGG + Intronic
927212757 2:20648737-20648759 AGCTGCAGCTGGAAGGAGGCTGG - Intronic
927859266 2:26550449-26550471 CCCAGCAGCAGCATGGAGCCTGG - Intronic
927979664 2:27366784-27366806 GGAATCAGCAGGTAGGAGGCTGG + Exonic
928201223 2:29248943-29248965 TGCAGCAGCAGGCAGCAGGCAGG - Intronic
928217585 2:29375131-29375153 AACAGCAGCAGCAAGGAAGCAGG + Intronic
928278821 2:29926076-29926098 AGCAGCAGCAGCAAGCAGGAGGG + Intergenic
928306057 2:30171326-30171348 GGCACCATCTGTAAGGAGGCAGG - Intergenic
928485728 2:31729177-31729199 AACAGCAGCAGCAGGCAGGCAGG + Intergenic
929265944 2:39919832-39919854 AGCAGCAGCAGCAAGGGGCCAGG + Intergenic
929419691 2:41777990-41778012 GCCAGCAGGGGCAAGGAGGCAGG + Intergenic
929671910 2:43882693-43882715 GGCAGCTTCAGCAGGTAGGCAGG + Intergenic
929900162 2:45993751-45993773 GGCAGCTGATGCAATGAGGCAGG + Intronic
930020704 2:47000495-47000517 CGCAGCAGGAGCTCGGAGGCTGG + Intronic
931224884 2:60321019-60321041 GGCAGCAGCAGCACACAGGGAGG + Intergenic
931462261 2:62459264-62459286 AGCTGCAGCTGCAAAGAGGCAGG + Intergenic
932030241 2:68176524-68176546 GGCAACAGCAGCATGGAGCAAGG + Intronic
932086214 2:68764705-68764727 AACAGCAGCAGCATGGAGGCAGG - Intronic
932093853 2:68829621-68829643 GCCAGCAGCAGCAGAGAGGCTGG + Intergenic
932284534 2:70521003-70521025 GGCAGTAACAGCAGGGATGCAGG - Intronic
932612466 2:73210039-73210061 GGCAGCAGAAGCAGGAAGACAGG - Intronic
933129078 2:78650862-78650884 GGGAGCAGCATCAAGGGGCCAGG - Intergenic
933180628 2:79222636-79222658 GGCAGGAGGAGGAAGGAGGGAGG - Intronic
933182562 2:79243822-79243844 GGGAGCAAAAGAAAGGAGGCAGG + Intronic
933354897 2:81198069-81198091 GGCGGCAGCAGGAAGGACACCGG - Intergenic
933954715 2:87355328-87355350 GGCAGGACCAGCAATGGGGCTGG - Intergenic
934037528 2:88100738-88100760 GGCAGCAGCTGGTAGCAGGCAGG + Intronic
934238912 2:90251554-90251576 GGCAGGACCAGCAATGGGGCTGG - Intergenic
934274283 2:91565156-91565178 GGCAGGACCAGCAATGGGGCTGG + Intergenic
934517828 2:94999757-94999779 CACAGCAGCAGCCAGGTGGCAGG + Intergenic
934524970 2:95046183-95046205 GGCAGCAGGTGCAGGGAGGTGGG + Intronic
935060767 2:99605584-99605606 GGCAGCTGCAGCAGTGAGGGTGG + Intronic
935122854 2:100197681-100197703 GGCAGCAGCAGCCTGGGGGAGGG + Intergenic
935223517 2:101034874-101034896 AGCTGCAGAAGCCAGGAGGCAGG + Intronic
936111885 2:109671405-109671427 GGCAGCAGCAGCAAGTCTGGGGG + Intergenic
936147164 2:109987648-109987670 AGCAGCAGCAGTGAGGAAGCCGG + Intergenic
936159894 2:110076988-110077010 AGCAGCAGTAGGAAGGAGACAGG - Intergenic
936197528 2:110383835-110383857 AGCAGCAGCAGTGAGGAAGCCGG - Intergenic
936483263 2:112905401-112905423 GGCTGCAGGAGGCAGGAGGCAGG + Intergenic
936806392 2:116337373-116337395 GGCAGCAGCAGGAGGCAGCCTGG - Intergenic
937024072 2:118682869-118682891 AGCAGCAGCAGCACAGAGGCAGG - Intergenic
937033804 2:118763992-118764014 GGCAGGAGAAGCAGGGAGTCGGG - Intergenic
937039584 2:118810556-118810578 GGCAGCAAGAGCAGGGAGGAGGG + Intergenic
937280840 2:120716250-120716272 GACAGCAGCCCCCAGGAGGCTGG - Intergenic
937311712 2:120906884-120906906 GGCAGAGGCGGCAAGGAGGGAGG - Intronic
937313390 2:120915844-120915866 AGCAGCAGCTGCAAGGGGTCTGG - Intronic
937592204 2:123628429-123628451 GGCGGCAGGTGCAAGGAGGGAGG + Intergenic
938094284 2:128451534-128451556 GGCAGGAGGGGCAAGGAGGCAGG + Intergenic
938138808 2:128780372-128780394 GGCAGCAGTTCCCAGGAGGCCGG + Intergenic
938163540 2:129007462-129007484 CTCAGCACCAGCTAGGAGGCAGG + Intergenic
938365003 2:130727481-130727503 GGCAGCTGGGGCAGGGAGGCGGG + Intergenic
938548122 2:132353254-132353276 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
940680563 2:156780033-156780055 GGAAGGAGCAGCAAAGAGGAAGG - Intergenic
941397725 2:164993706-164993728 GCGGGCAGCAGCAGGGAGGCAGG + Intergenic
942219420 2:173754962-173754984 GGAGGCAGCATCAGGGAGGCAGG - Intergenic
942571831 2:177322906-177322928 TTCAGCAGGAGGAAGGAGGCTGG + Intronic
942695856 2:178644480-178644502 GGCAGAAAGAGCAAGGAGTCAGG + Intronic
944442116 2:199753305-199753327 GGCAGCAGCAGGTGTGAGGCTGG + Intergenic
944479891 2:200145659-200145681 GGCCAAAGCAGGAAGGAGGCAGG + Intergenic
944811239 2:203328871-203328893 GGCGGGAGCGGCGAGGAGGCGGG - Intronic
944905478 2:204257542-204257564 GGCTGCAGCTGCAGAGAGGCAGG - Intergenic
945484435 2:210378181-210378203 GGCAGGAGAAGCAATGAGACAGG - Intergenic
946181443 2:217951541-217951563 AGCAGCTGCAGCAAGCCGGCAGG + Intronic
946438299 2:219674086-219674108 GGAAGCACCAGGAAGGAGGAGGG - Intergenic
947398970 2:229714068-229714090 GGCAGCAGCAGCAGGGCCGGCGG + Intronic
948027527 2:234789911-234789933 GGCAGGTGCAGCATGCAGGCAGG + Intergenic
948107668 2:235428164-235428186 GGCAGGATCAGCAGGGAGGATGG + Intergenic
948270509 2:236670004-236670026 GGCAGCCCCAGCAGGGAGGGAGG - Intergenic
948674156 2:239587376-239587398 GGCAATAGCAGAGAGGAGGCGGG + Intergenic
948992759 2:241563147-241563169 AGCAGCAGGAGCAGGGAGGCAGG - Intronic
948993121 2:241564604-241564626 GGCAGCGGAAGCATGGTGGCAGG + Intronic
1168916335 20:1491295-1491317 GCCAGCAGCAGGAAGCAGGGAGG + Exonic
1169016933 20:2299664-2299686 GGCAGCTATAGGAAGGAGGCAGG - Intronic
1169277738 20:4244762-4244784 GGCAGAAGCAGCAGAGAGGGAGG - Intronic
1169278615 20:4249318-4249340 GGCAGCGCCAGGAAGGAGGAGGG + Intergenic
1170627862 20:18043144-18043166 GGGAGGAGCAGAAAGGAGTCTGG + Intronic
1171334861 20:24374488-24374510 TGGAGCAGGAGCCAGGAGGCTGG - Intergenic
1171876991 20:30586026-30586048 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
1172027037 20:31955575-31955597 GTGAGCAGCAGCAGGGAGGTGGG - Intergenic
1172095131 20:32456797-32456819 GGCAGCAGGAGCAGGGTGGGTGG - Intronic
1172097626 20:32468007-32468029 GGCAGCAGGGGCCAGGAGGTAGG + Intronic
1172134748 20:32679462-32679484 GGAAGGAGCAGCAAGGTTGCTGG - Intergenic
1172688615 20:36775264-36775286 GGCTGCTGCAGCCAGCAGGCTGG - Intergenic
1172698696 20:36839476-36839498 CACAGTAGCAGCTAGGAGGCCGG + Intronic
1173331917 20:42082397-42082419 GCAAGCATCAGCAAGGATGCAGG - Intronic
1173464288 20:43268759-43268781 GGCAGCAGAAGTCAGGAGTCAGG + Intergenic
1173479423 20:43387587-43387609 GGAAGCAGCAGCAAGGAAGAGGG + Intergenic
1173848516 20:46203005-46203027 AGCAGCAGCAGCATGGAGGGAGG - Intronic
1174201347 20:48808717-48808739 GGCAGTAGGAGTAGGGAGGCTGG - Intronic
1174412373 20:50344342-50344364 TGCAAGAGCAGCCAGGAGGCTGG + Intergenic
1174658981 20:52194145-52194167 AGCAACAACAGCAAGGAGCCTGG - Intronic
1174898288 20:54473508-54473530 GGCAGCAAGAGCAAAGAGACTGG - Intergenic
1175427214 20:58875895-58875917 GGGGGAAGGAGCAAGGAGGCAGG + Intronic
1175501057 20:59451153-59451175 AGCAGCAGCAGCAAGGGGAAAGG - Intergenic
1175598194 20:60252422-60252444 TGCAGCAGATGCAGGGAGGCAGG + Intergenic
1175770174 20:61618505-61618527 GGCAGCAACACCAAGGTGGAAGG - Intronic
1175819377 20:61900446-61900468 GGTAGGAGGAGCAAGGAGGCGGG - Intronic
1175830838 20:61964998-61965020 GGCAGCAGCTCCCAGGAGGAGGG - Intronic
1175847150 20:62065125-62065147 GGCAGCGGCAGCAGCGCGGCGGG + Exonic
1175911540 20:62407447-62407469 GGACGCAGCAGCAGGGAGTCGGG + Intergenic
1175934168 20:62507480-62507502 GGCGGCAGCAGGAAGGAGAGGGG + Intergenic
1175939253 20:62530416-62530438 GGCAGGGGCAGCAAGGAGCTGGG - Intergenic
1175954809 20:62603841-62603863 GGCAGCAGCAGCGGGGTGGGGGG - Intergenic
1175956734 20:62614478-62614500 GGCAGAAGCAGCAGGGTGGCAGG + Intergenic
1176070643 20:63224556-63224578 GGAAGCTGCAGGAAGGAGCCAGG + Intergenic
1176113310 20:63420467-63420489 GGAAGCAGTGGCAAGGAGGTTGG - Intronic
1178398141 21:32260616-32260638 CAAAGCAGCAGCAAGGAGGCAGG + Intergenic
1178493823 21:33070838-33070860 GGCGCCAGCAGCACGGAGCCGGG - Exonic
1178521114 21:33289201-33289223 GACAGCAGCAGCCAGGAGCTAGG + Intronic
1178535075 21:33403900-33403922 GGCAGCAGCAGGAAGACGGGGGG + Intronic
1179482232 21:41685654-41685676 GGCAGGCCCAGCTAGGAGGCAGG - Intergenic
1179837928 21:44049748-44049770 GGCAGCAGCAGCCAGGGGCAGGG - Intronic
1179896333 21:44365687-44365709 GGCAGCTGCAGGGAGGGGGCTGG - Intronic
1179982922 21:44905811-44905833 GCCAGCAGCAGCCGGGAGGGAGG - Intronic
1180762254 22:18219793-18219815 GGCAGCTGCTGCGGGGAGGCGGG + Intergenic
1180773413 22:18404815-18404837 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
1180804764 22:18654364-18654386 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
1180805980 22:18715046-18715068 GGCAGCTGCTGCGGGGAGGCGGG + Intergenic
1181033916 22:20160936-20160958 GGCTGCACCAGGGAGGAGGCTGG + Intergenic
1181192509 22:21151748-21151770 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
1181216930 22:21340827-21340849 GGCAGCTGCTGCGGGGAGGCGGG + Intergenic
1181324067 22:22031333-22031355 GGCAGCCACAGCAAGGGGGACGG + Intergenic
1181354899 22:22291860-22291882 GGCAGGACCAGCAACGGGGCTGG + Intergenic
1181429740 22:22871881-22871903 GGCAGCCACAGCAAGGGGGACGG + Intronic
1181512062 22:23393591-23393613 GGCAGCATCAGCAGGGTGGCCGG - Intergenic
1182037583 22:27211263-27211285 GTGAGCAGAATCAAGGAGGCTGG + Intergenic
1182697664 22:32207450-32207472 GGCAGCAGCAGCAAGTCTGGAGG + Intergenic
1183018477 22:35008671-35008693 GGAAGCTGCAGCAAGGAGTGGGG + Intergenic
1183098834 22:35570937-35570959 GCCGGCACCAGCCAGGAGGCAGG - Intergenic
1183178209 22:36239660-36239682 AAGTGCAGCAGCAAGGAGGCTGG - Intronic
1183187422 22:36300030-36300052 AGCAGCAGCAGCGGGGAGCCAGG + Intronic
1183415819 22:37681285-37681307 GACTGCAGCAGCAAGCAGGAAGG - Intergenic
1183785689 22:40027926-40027948 GGCAGCAGCATTTTGGAGGCAGG - Intronic
1184301544 22:43563655-43563677 AGCAGCAGCAGCAGCGCGGCAGG - Intronic
1184381416 22:44147105-44147127 AGCAGGAGCAGCTGGGAGGCCGG + Intronic
1184488605 22:44796234-44796256 GGCAGCAGAAGCAGGGACGGCGG - Intronic
1184669071 22:46003418-46003440 GTGAGCAGCACCCAGGAGGCCGG + Intergenic
1184677195 22:46050181-46050203 GGCAGCAGCAGCAGGAGGGAAGG + Exonic
1184715621 22:46280207-46280229 GGCAGGAGCAGGCAGGCGGCAGG + Intronic
1184742062 22:46434328-46434350 AGCAGCAGCAGCTGGGAGGAAGG + Intronic
1184757205 22:46523791-46523813 GGCACCAGGTGCAGGGAGGCAGG - Intronic
1184841645 22:47055687-47055709 GGCAGGCGCACCTAGGAGGCTGG + Intronic
1184913204 22:47549749-47549771 GGCAGCAACAGCAGGAAGGTGGG + Intergenic
1184987577 22:48146045-48146067 GTGAGCAACAGAAAGGAGGCAGG - Intergenic
1185409961 22:50676731-50676753 GACAGCAGCCACAGGGAGGCAGG - Intergenic
1185415105 22:50705410-50705432 GCCAGCAGCTGCCTGGAGGCCGG + Intergenic
1203235243 22_KI270731v1_random:145797-145819 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
949628413 3:5894115-5894137 TGCACTAGCAGCAAGCAGGCTGG - Intergenic
950096982 3:10336133-10336155 GGCTGCAGCAGGAGGAAGGCTGG + Intronic
950351414 3:12357316-12357338 GGAAGGAACAGCAAGGAGGCCGG - Intronic
950424747 3:12919110-12919132 CCAAGCAGCAGCCAGGAGGCCGG - Intronic
950569167 3:13789362-13789384 GTCAACAGCATTAAGGAGGCAGG - Intergenic
951112145 3:18816680-18816702 GACAGCAGCACAAAGGAGGTGGG - Intergenic
952003917 3:28820459-28820481 GCCACCAGAAGCTAGGAGGCAGG - Intergenic
952698683 3:36302432-36302454 GTCAGCTGCAGGAAGCAGGCTGG - Intergenic
952706164 3:36380314-36380336 CGCAGGAGGAGGAAGGAGGCGGG - Intergenic
953239352 3:41134843-41134865 AAAAGCAGCAGCAAGAAGGCTGG + Intergenic
953450230 3:42999424-42999446 GGGAGAAACAGCAGGGAGGCAGG - Intronic
953708267 3:45247493-45247515 GGGAGCAGCTGGAAGGAGGCAGG - Intergenic
953793013 3:45962729-45962751 GGCAGGAGGAGAAAGGAGTCAGG + Intronic
954039053 3:47870637-47870659 TGCCCCAGCAGCAGGGAGGCGGG - Intronic
954381538 3:50221550-50221572 GGCAGGGGCTGCAAGGAAGCAGG + Intergenic
954426654 3:50446958-50446980 GTAAGCAGCAGCAAAGAGCCAGG + Intronic
954677653 3:52324589-52324611 GACAGCGGCAGGAAGGAGCCAGG - Intronic
956070719 3:65447993-65448015 TGCAGCAGCAGCAGGCAGGGAGG + Intronic
956733455 3:72217715-72217737 TCCAGGAACAGCAAGGAGGCCGG - Intergenic
957427146 3:80052459-80052481 GGCTGCTGCAGCAAGGTGGGCGG - Intergenic
958600326 3:96288809-96288831 GGCTGGAGCAGCTAGGATGCAGG - Intergenic
959037334 3:101383316-101383338 AGCAGCTGCTGCAAAGAGGCCGG + Intronic
959826802 3:110806926-110806948 GGCAGCAGCAGCAATGGTGGGGG - Intergenic
959872189 3:111341281-111341303 GGCTGGAGCAGCTAGGATGCAGG - Intronic
961185423 3:124910805-124910827 GGCAGCAGAGGTAAGGAGGGAGG - Intronic
961365235 3:126395268-126395290 GGCTGCAGCAGGAATGCGGCAGG + Intronic
961619470 3:128212369-128212391 GCCAGCAGAAGCATGGTGGCTGG - Intronic
961652554 3:128424167-128424189 AGCAGCAGAAGCCAGGAGGCTGG - Intergenic
961670110 3:128522915-128522937 GGTTGCAGGAACAAGGAGGCAGG + Intergenic
962438506 3:135389510-135389532 GCCAGCAGGAGCCAGGAGGGAGG + Intergenic
962967329 3:140366939-140366961 GGCAGCATCTGCAGGAAGGCAGG + Intronic
963009486 3:140755833-140755855 GGCAGCAGCTGCCAGAAGCCAGG - Intergenic
963338127 3:144000934-144000956 AGGAGCAGTAGCAAGGAGCCCGG + Intronic
963824174 3:149933130-149933152 GGCTGGAGCAGCCAGGATGCAGG + Intronic
963926994 3:150961179-150961201 GGCAGAAGCCACAAGGAGGAGGG - Intronic
964401772 3:156306957-156306979 AGCAGCATCAGCATGGAGGGAGG + Intronic
964486163 3:157186923-157186945 GGCAGCAGCAGCAATGCGTGGGG - Intergenic
964695016 3:159497637-159497659 AGCAGAAGCAGAAAGAAGGCAGG + Intronic
965660694 3:171038980-171039002 GGCAGCTTCACCAAGGAGCCAGG + Intergenic
966217443 3:177518104-177518126 GGCAGCGGCAGCAGGGAGCGGGG + Intergenic
966710400 3:182966666-182966688 GGCTGCAGTTGCTAGGAGGCCGG - Intronic
966921873 3:184617477-184617499 AGCAGCAGCAGCAAGATGGAAGG + Intronic
967131341 3:186473522-186473544 GGCAGCAGCAGGAAGGAAAAAGG - Intergenic
967170100 3:186816478-186816500 GAAAGCAGCAGCAAGGGGGTTGG + Intergenic
967838208 3:193981826-193981848 GGGAGCAGCTGGAAGGAGCCAGG + Intergenic
967982111 3:195071926-195071948 GGCACGAGAAGCAGGGAGGCAGG + Intronic
968082134 3:195853926-195853948 GGCAGCAGCATCAAGGGTTCTGG - Intergenic
968541222 4:1169373-1169395 GGCAGGGGCAGCACCGAGGCTGG + Intronic
968874232 4:3256865-3256887 CCCAGGAGCAGCTAGGAGGCTGG + Intronic
968938446 4:3625577-3625599 AGCAGCATCTGCAAAGAGGCTGG - Intergenic
968946886 4:3669528-3669550 TGCAGCAGCTGCCAGGAAGCTGG - Intergenic
969308421 4:6338651-6338673 GGCAGCAGCAGCAGGCTGGTTGG - Intronic
969390082 4:6886162-6886184 GGCAGCAGCAGCAGGCACACAGG - Intergenic
969448616 4:7260003-7260025 GGCAGCAGCAGCGCAGATGCAGG - Intronic
969699650 4:8761193-8761215 GGGAGCAGCAGCAGGGACTCAGG - Intergenic
969705140 4:8787618-8787640 GGGACCAGCAGTAAAGAGGCTGG + Intergenic
969714817 4:8863378-8863400 GTGAGCAGCACCAGGGAGGCGGG - Intronic
969734166 4:8975845-8975867 GACAGCGGGAGCAAGGTGGCAGG - Intergenic
970432790 4:16004270-16004292 CTCAGCAGCAGGAAGAAGGCTGG - Intronic
970487718 4:16541316-16541338 GAATGCAGGAGCAAGGAGGCAGG - Intronic
970543319 4:17101299-17101321 GCAAGGGGCAGCAAGGAGGCTGG + Intergenic
971459572 4:26880173-26880195 TCCAGCAGCAGAAAGGAAGCTGG - Intronic
971516241 4:27490493-27490515 TGCAGCGGCAGCAGGGAGCCAGG - Intergenic
972161682 4:36235348-36235370 GGAAGGAACAGAAAGGAGGCTGG - Intronic
972675742 4:41257696-41257718 AGCAGCAGCAGCGCGCAGGCAGG - Exonic
972774172 4:42226297-42226319 GGGAGAAATAGCAAGGAGGCCGG - Intergenic
973041028 4:45471290-45471312 GCCGGCTGCAGCAGGGAGGCAGG + Intergenic
973267519 4:48225919-48225941 GGCAGCAGCAGCCAGAAAGGAGG + Intronic
973786447 4:54337037-54337059 GGCCACAGCAGCAGGGAGTCGGG + Intergenic
974145093 4:57937090-57937112 GGCTGGAGCAGCTAGGATGCAGG - Intergenic
974974042 4:68867313-68867335 GGCTGGAGCAGCATGAAGGCTGG - Intergenic
975221220 4:71814621-71814643 GACAGCAGCAGGAAGCAGACAGG - Intergenic
975636874 4:76458994-76459016 GTCAACAGCAGCAGGGGGGCGGG + Intronic
975646339 4:76549767-76549789 GCCAGCAGCAACAAAGAGGGAGG + Intronic
975762569 4:77633536-77633558 GGCAGCAGCAGCACCTTGGCTGG + Intergenic
976140999 4:81991495-81991517 GGCAGCAGCAGCAGTGGGGGTGG + Intronic
976226465 4:82798558-82798580 CGCAGCAGCGGCAGGCAGGCAGG + Exonic
976445667 4:85127860-85127882 GGCAGTAGCAACAGGGAGCCAGG - Intergenic
977244743 4:94618105-94618127 GGCAGCTGCAGCTGTGAGGCTGG - Exonic
978166965 4:105621071-105621093 GGCAGGAACAGCTGGGAGGCTGG - Intronic
978226216 4:106338418-106338440 GGCTGCAGCAGCTGGGAAGCAGG - Intronic
978283879 4:107051715-107051737 TTCAGAAGCAGCAAGAAGGCTGG - Intronic
978819348 4:112947599-112947621 GGAAGCAGCAGAAAGCATGCAGG + Intronic
978981646 4:114954899-114954921 GGGAGCAGTAGCAAGGATGTGGG - Intronic
979501014 4:121439830-121439852 AGCAGCAGCAGCAATGAGCAGGG + Intergenic
979649535 4:123114352-123114374 GGCAGCAGCAGGATGCAGACAGG - Intronic
980450033 4:132958767-132958789 GGCAGGAGCTGGGAGGAGGCAGG + Intergenic
981483400 4:145260166-145260188 AGCTGGAGCAGCAGGGAGGCAGG + Intergenic
981600359 4:146481393-146481415 AGCAGCAGCAGCAAGGACCCAGG - Intronic
981625306 4:146747998-146748020 TGCAGAAGCAGCAAGGACCCAGG - Intronic
982271340 4:153592511-153592533 GGCAGGAGCTGCAAGGAGACCGG - Exonic
982346595 4:154367106-154367128 CTCAGCCGCAGCAAGGAAGCAGG + Intronic
983568956 4:169184028-169184050 GGATGTAGCAGTAAGGAGGCTGG + Intronic
983997910 4:174207793-174207815 GGAAGCAGCAACAAGGTGGGTGG - Intergenic
984227235 4:177050242-177050264 GGAACCAGCAGGAATGAGGCCGG - Intergenic
985125400 4:186688810-186688832 GGCAGCAGCCACAATGTGGCAGG + Intronic
985543954 5:500010-500032 GGCAGGAGCTGCAGGGTGGCTGG + Intronic
985723331 5:1502118-1502140 GGCAGCTCCAGTAAGGAGGCAGG - Intronic
985900241 5:2783051-2783073 GGCAGAAGCAGCAAGGGGCACGG + Intergenic
986283615 5:6344086-6344108 GGCAGCAGAAGCCAGCAGCCAGG + Intergenic
986304726 5:6506723-6506745 GGCAAGAGAAGAAAGGAGGCGGG + Intergenic
986337398 5:6765921-6765943 GCCGGCTGCAGCAGGGAGGCTGG - Intergenic
986466926 5:8035001-8035023 AGCAGCAGCACCAGGGAGGAGGG + Intergenic
987160536 5:15137179-15137201 GGCAGCAGGAGCAGAGAGGGTGG + Intergenic
987608799 5:20175329-20175351 GGCAGCAGGAGAGAGGTGGCTGG - Intronic
987709066 5:21486126-21486148 GGCAGGAGCAGCTGGGATGCAGG + Intergenic
988750546 5:34188027-34188049 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991585453 5:68197044-68197066 GTCAGCAGCAGGAAGGAGTGTGG + Intronic
991607693 5:68420044-68420066 GGCAGCTGCAGCAAGAAAGGAGG + Intergenic
991735687 5:69629941-69629963 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991738812 5:69651225-69651247 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991759385 5:69905202-69905224 GGCAGGAGCAGCTGGGATGCAGG + Intergenic
991787950 5:70212916-70212938 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991790387 5:70230966-70230988 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991812178 5:70485580-70485602 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991815136 5:70506057-70506079 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991818272 5:70527342-70527364 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991838613 5:70780268-70780290 GGCAGGAGCAGCTGGGATGCAGG + Intergenic
991880396 5:71213280-71213302 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991882835 5:71231306-71231328 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
991952729 5:71962497-71962519 CCAAGAAGCAGCAAGGAGGCTGG + Intergenic
992162319 5:74015452-74015474 GGCACCAGCAGGAAGGTGGAGGG - Intergenic
992411545 5:76510461-76510483 GGCAGCAGCACACAGGTGGCAGG + Intronic
993852074 5:93023173-93023195 GAGAGCAGCAGGAAGGAGGCAGG - Intergenic
994421192 5:99527469-99527491 GGCAGGAGCAGCTGGGATGCAGG + Intergenic
994485851 5:100386845-100386867 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
995969604 5:117952300-117952322 GCCAGTAGCAGCATGGAGGCTGG + Intergenic
996122921 5:119691582-119691604 GGCTGTAGCAGCTAGGATGCAGG + Intergenic
996249952 5:121317369-121317391 AGCAGCAGCAGCAAGGTGGCAGG + Intergenic
996291051 5:121852358-121852380 TGCAGAACCAGCGAGGAGGCCGG + Exonic
996710915 5:126542818-126542840 GGCTGCAGCAGTGAGGAGGCAGG - Exonic
996749662 5:126875759-126875781 GGAAGCCGCAGGAAGGAGCCTGG + Intronic
996862645 5:128083681-128083703 GGCAGCAGCACGCGGGAGGCGGG - Intergenic
997011436 5:129883243-129883265 GCCAGAAGCAGCAAGGAGGCTGG - Intergenic
997393241 5:133533891-133533913 TGCAGCAGGAGCAAGGACTCGGG - Intronic
997870905 5:137504380-137504402 TGGAGCAGGGGCAAGGAGGCTGG + Intronic
997878455 5:137569543-137569565 GGCTGCAGGAGCAAGGAGTGGGG + Intronic
998133163 5:139661150-139661172 GGCAGCCGCGGCGGGGAGGCTGG - Intronic
998754430 5:145360350-145360372 AGCATAAGCAGTAAGGAGGCAGG + Intergenic
998799679 5:145856530-145856552 TGCCCCAGCAGCAAGGGGGCGGG + Intergenic
999073394 5:148771752-148771774 GGCAGCATCAACAATGAAGCAGG - Intergenic
999269491 5:150288601-150288623 GGCAGCAGGAGCACGGGGGGAGG - Intronic
999383415 5:151137689-151137711 GGGAGCAGGAGCAAGGCGGGAGG - Intronic
999393889 5:151214304-151214326 GGTAGAGGCAGGAAGGAGGCGGG + Intronic
999962089 5:156766838-156766860 GGCCACAGCAGCAAAGAGGTTGG + Intronic
1000213158 5:159128427-159128449 GGCAGCAGCAACAAGGCTGTGGG + Intergenic
1001322461 5:170693858-170693880 GACAGCAGCAAGAAGCAGGCTGG + Intronic
1001931037 5:175673124-175673146 AGCGCCAGCAGCAGGGAGGCTGG + Intronic
1002087698 5:176786033-176786055 GGCATGAGAAGCAATGAGGCTGG + Intergenic
1002190662 5:177475808-177475830 AACAGCAGCTGAAAGGAGGCAGG - Intergenic
1002644463 5:180646345-180646367 AGTGCCAGCAGCAAGGAGGCTGG - Intronic
1003067563 6:2916734-2916756 GGCAGCAGCTGCTAGAAGGTTGG + Intergenic
1003256326 6:4478147-4478169 GGCAGCAGCAGGAATAAGGTAGG + Intergenic
1003294456 6:4811993-4812015 GGCAGCAGCATCAAGCTTGCTGG + Intronic
1005136031 6:22570355-22570377 GGCCGCAGCAGGAACGGGGCAGG - Exonic
1005548618 6:26894332-26894354 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
1006297749 6:33177558-33177580 GGCAAGAGCAGGAAGCAGGCAGG + Intronic
1006425189 6:33959150-33959172 GGCAGCAGCAGAGAGGGAGCGGG + Intergenic
1006514720 6:34539484-34539506 GGCAGCGGCAGGGTGGAGGCGGG - Intronic
1006517084 6:34551132-34551154 AGCACCAGCAGAAAGGAGGGTGG - Intronic
1006779663 6:36623677-36623699 GGCAGGGGCAGGAAGGAGGGTGG + Intergenic
1007113881 6:39329697-39329719 TGCAGCAGCAGCAAGAAGCCTGG + Intergenic
1007212407 6:40206053-40206075 TGCAGCATCAGCAAGGACCCAGG + Intergenic
1007218996 6:40263699-40263721 GTCAGCAGCAGCAAGCATCCTGG - Intergenic
1007342579 6:41200980-41201002 AGCAGCAGCAGCAGGAAGGCTGG + Exonic
1007421150 6:41720520-41720542 GGCATCACCACCCAGGAGGCTGG + Intronic
1007740769 6:44008266-44008288 GGCACCAGCAGCAGTGAGACTGG + Intergenic
1007811914 6:44492259-44492281 GGCAGAAGGAGAAAGGAGGTGGG - Intergenic
1008123650 6:47645398-47645420 GATACCAGCAGCAAGGTGGCAGG - Intergenic
1009019373 6:57935439-57935461 GGCAGGAGCAGCTGGGATGCAGG - Intergenic
1009588509 6:65637391-65637413 AGCAGCTGCTGCAAGGATGCTGG + Intronic
1010175275 6:73020675-73020697 GGCAGCTTCAGGATGGAGGCTGG - Intronic
1010669079 6:78665379-78665401 TGCTTCAGCAGCAAGAAGGCCGG - Intergenic
1011361176 6:86526699-86526721 GGCAGGAGCAGCTAGCAGGCAGG + Intergenic
1012585479 6:100916332-100916354 TTCAGCAACAGCAAGGAGGCAGG - Intergenic
1013138673 6:107308775-107308797 AGCAGCAGCAGCAAGCTGACTGG - Intronic
1013422520 6:109979184-109979206 GGCCACAGCAGCAGGGGGGCCGG + Exonic
1013479778 6:110543741-110543763 GGAAGCAGGAGCATGGAGGCAGG + Intergenic
1014221924 6:118806501-118806523 TACAGCACCAGCAAGGAGGCTGG + Intergenic
1015065627 6:129023081-129023103 GGCAGCAGGAACATGGATGCAGG - Intronic
1015618601 6:135105909-135105931 GGCAGTAGCAGAAAGGGAGCCGG - Intergenic
1015626326 6:135183043-135183065 GGCAGCAGGAGGAGGGAGTCGGG + Intronic
1017708998 6:157148904-157148926 GGCAGCCGCAGCAGTGATGCAGG + Exonic
1017764931 6:157599212-157599234 GGTAGAATCAACAAGGAGGCTGG + Intronic
1017956102 6:159179067-159179089 TGCAGAACCAGCCAGGAGGCCGG - Intronic
1019102378 6:169641594-169641616 GACATAAGCAGCATGGAGGCCGG + Intronic
1019430189 7:995518-995540 GGCAGCAGCCTCCAGAAGGCAGG - Intergenic
1019442983 7:1056687-1056709 GGCAAGAGCAGTGAGGAGGCCGG - Intronic
1019450970 7:1097755-1097777 GGCAGCACCAACAAGGAGGCCGG + Intronic
1019543239 7:1560755-1560777 GGCAGCAGAGGCCAGGAGGCCGG - Intronic
1019739537 7:2665843-2665865 TCCAGAAGCAGCATGGAGGCGGG + Intergenic
1019820757 7:3241059-3241081 TTCAGCAGCTGCATGGAGGCAGG - Intergenic
1019937811 7:4267820-4267842 TCCAGCAGCAGCCAGGAGGCCGG - Exonic
1020131790 7:5562935-5562957 GGCACCAGCGGCGACGAGGCGGG + Intronic
1020446493 7:8274309-8274331 GGCAGCGGCAGCAAGAGGGGAGG - Intergenic
1021931562 7:25585999-25586021 TGCAGGAGAACCAAGGAGGCTGG + Intergenic
1022247591 7:28575564-28575586 GTCTCCAGCAGGAAGGAGGCTGG - Intronic
1022499963 7:30876628-30876650 GGCAGCTGGAACAAGAAGGCAGG - Intronic
1022663101 7:32384970-32384992 GGGAGAAGAACCAAGGAGGCGGG + Intergenic
1022860572 7:34362671-34362693 GGCTGCAGCAGGAGAGAGGCAGG + Intergenic
1023619920 7:42060196-42060218 GGCAGCAGCAGCAGGAATGAAGG - Intronic
1023891328 7:44393972-44393994 GGCAGCAGGAGCTTGGAGGTGGG - Intronic
1024054826 7:45653332-45653354 GGCTGCAGCAGCTGGGAGGTTGG - Intronic
1024123340 7:46267169-46267191 GGGAGCAGGAACAAGAAGGCAGG - Intergenic
1024740161 7:52344816-52344838 GGCAGCAGCAGCCCTGATGCAGG + Intergenic
1024971768 7:55078179-55078201 GGGAGAAGGAGCAAGGCGGCAGG + Intronic
1025945386 7:66100414-66100436 GGGGGCAGCAGTAAGGAGGAAGG + Intronic
1026061693 7:67032294-67032316 GGGAGCAGCTGCGGGGAGGCAGG + Intronic
1026780838 7:73266148-73266170 GGCCGCAGCTGCAAGGAGAAGGG + Intergenic
1026950655 7:74344263-74344285 GTTGGCAGCAGCAAGGGGGCTGG + Intronic
1026977121 7:74505647-74505669 GGCCTCAGCAGCTGGGAGGCTGG + Intronic
1027021692 7:74819590-74819612 GGCCGCAGCTGCAAGGAGAAGGG + Exonic
1027066329 7:75126327-75126349 GGCCGCAGCTGCAAGGAGAAGGG - Exonic
1027233744 7:76286123-76286145 GGCATCAGCAGGAAGGGGGATGG - Exonic
1027320383 7:77006602-77006624 GGCAGCAGTAGCCGGGGGGCAGG - Intergenic
1028415661 7:90577972-90577994 GGTAGAAGCAGAAATGAGGCTGG + Intronic
1029205999 7:98869737-98869759 GGCTGCGGCTGCAGGGAGGCCGG + Intronic
1029973948 7:104815246-104815268 GCCGGCTGCAGCAGGGAGGCGGG - Intronic
1031362766 7:120866899-120866921 GAAAGCAGGAGCAAGGAGGTGGG - Intergenic
1031375327 7:121017611-121017633 AGTAGCAGCAACAAGAAGGCAGG - Intronic
1031774643 7:125892339-125892361 AGCAGAAGCGTCAAGGAGGCAGG - Intergenic
1031991312 7:128201070-128201092 GGCAGGAGCAGCCAGGAGGATGG + Intergenic
1032085184 7:128880049-128880071 GGCAGCAGCTGCCAGGACTCAGG + Exonic
1032152375 7:129440447-129440469 GGCAGCAGAAAGAAGTAGGCAGG - Intronic
1032905101 7:136355624-136355646 GTCTGCAGTAGCAAGGAGGGTGG - Intergenic
1032987546 7:137355223-137355245 GGCAGCAGCTGCTAGGAAGTTGG + Intergenic
1033153368 7:138935860-138935882 GGAAGCAGCAGCAAGGACAAAGG + Intronic
1033599644 7:142879706-142879728 GTTAGCAGGAGCAAGGAGGTAGG - Intronic
1033685923 7:143641418-143641440 GGCAGCAGTGGCACGGATGCTGG + Intronic
1033689820 7:143725897-143725919 GGCAGCAGTGGCACGGATGCTGG - Intronic
1033698690 7:143816203-143816225 GGCAGCAGTGGCACGGATGCTGG - Intergenic
1033831926 7:145265386-145265408 GTCAGCAGCAGCTGGGAGGAGGG - Intergenic
1034204342 7:149302580-149302602 GGCCCCAGCAGCAAGTAGGGTGG - Intergenic
1034257629 7:149733307-149733329 GGCGGCTGCAGGGAGGAGGCTGG - Exonic
1034265329 7:149777871-149777893 GGCAGCCACAGGGAGGAGGCTGG + Intergenic
1034398505 7:150846094-150846116 GGCAGGAGCAGAGAGCAGGCCGG - Intronic
1034456361 7:151173142-151173164 GGGACCAACAGCCAGGAGGCTGG + Intronic
1034520304 7:151614315-151614337 GGGAGCAGCAGCAGGGTGGCAGG + Intronic
1034524624 7:151649701-151649723 GGGAGCAGGAGCAAGAAGGAGGG - Intronic
1034891446 7:154842900-154842922 GGCTGCACCAGCCACGAGGCAGG + Intronic
1035135088 7:156695600-156695622 GACAGCAGCACCAAGGGGGATGG + Intronic
1035339459 7:158151164-158151186 GGCAGGAGCAGAAAGGCGGGCGG - Intronic
1035339486 7:158151274-158151296 GGCAGGAGCAGAAAGGCGGGCGG - Intronic
1035339506 7:158151347-158151369 GGCAGGAGCAGAAAGGCGGGCGG - Intronic
1035652356 8:1277696-1277718 GGCAGCAGCTGCACCGAGGTCGG + Intergenic
1035724208 8:1814416-1814438 AGAAGCAGCAGAGAGGAGGCTGG - Intergenic
1035743907 8:1947791-1947813 AGCAGCAGCAGTAGGGAGGCGGG - Intronic
1035983691 8:4401991-4402013 GGTAGCAGCAGGAATGTGGCAGG - Intronic
1036604390 8:10292987-10293009 TGGAGAAGCAGCAAGGAGGAGGG + Intronic
1036723768 8:11201245-11201267 GGCAGCGGCGGCGAGGAGGACGG - Exonic
1037538640 8:19851228-19851250 AGAGGCAGCAGCAAGGAGGGAGG - Intronic
1037961620 8:23102425-23102447 GGTCACAGCAGCAAGGAGGCTGG + Intronic
1037969906 8:23164496-23164518 GGTCACAGCAGCAAGGAGGCTGG - Intergenic
1038045754 8:23764364-23764386 GGCAGATGCAGGAGGGAGGCTGG + Intergenic
1038271919 8:26082115-26082137 CTCAGCTGCAGGAAGGAGGCAGG - Intergenic
1038751769 8:30302725-30302747 TTCAGCAGCAGCATGGAGGAGGG - Intergenic
1038852615 8:31294949-31294971 AGCAGCAGCACCTAGGAAGCTGG + Intergenic
1039423616 8:37466813-37466835 GGCCCCAGCAGGAAGGAGGAAGG + Intergenic
1039789955 8:40867579-40867601 GTGAGAGGCAGCAAGGAGGCTGG - Intronic
1039879433 8:41615276-41615298 GGCGGCAGCAGCATGCAGGCGGG - Intronic
1040289672 8:46117852-46117874 GGGAGAAGCAGCAAGAAAGCAGG - Intergenic
1040296028 8:46149528-46149550 GAAAGAAGCAGCAAGAAGGCAGG - Intergenic
1041783719 8:61607960-61607982 AGCAGGAGCAGGAAGGAGGATGG + Intronic
1043012584 8:74899891-74899913 GGGAACTGCTGCAAGGAGGCTGG - Intergenic
1045130002 8:99140564-99140586 AGCAGCAGCAGCAAGAAGAAAGG - Intronic
1045308029 8:100975550-100975572 GGCAAAGGCAGCAAAGAGGCTGG + Intergenic
1045844672 8:106619905-106619927 GGCAGAAGCAGCAAGGGGAAAGG - Intronic
1046285770 8:112091833-112091855 AACAGCTGCAGCAAGGAGGTAGG + Intergenic
1046871316 8:119208461-119208483 GGCAGCGGCAGCATGTCGGCCGG + Exonic
1047104811 8:121720453-121720475 GCCAGCTGCAGCGGGGAGGCGGG - Intergenic
1047504367 8:125467093-125467115 CTCAGAAGCAGGAAGGAGGCTGG - Intergenic
1048327736 8:133452018-133452040 GCCATCAGCAGCCAGGAGGAGGG - Intergenic
1048980909 8:139703139-139703161 AGCAGCAGCAGCGGGGAGGCGGG + Intergenic
1049217383 8:141414497-141414519 GGGAGCAGCAGCCTGGTGGCAGG + Intronic
1049236727 8:141515835-141515857 GGCTTCAGCAGCAAGGAGGCCGG + Intronic
1049291124 8:141802591-141802613 TCCAGGAGCAGCAAGCAGGCAGG - Intergenic
1049356761 8:142192916-142192938 GGGAGGAGCAGAAAGGAGGGAGG + Intergenic
1049386546 8:142345636-142345658 GGGAGCTGCAGGGAGGAGGCTGG - Intronic
1049411136 8:142474508-142474530 GGCAGCAGCACCAGGGGGCCGGG - Intronic
1049443420 8:142619397-142619419 GGCTGCAGCAGCTATGAGGCTGG - Intergenic
1051068551 9:13134925-13134947 GGTAGCAACAGTAAGGAGGAAGG - Intronic
1051258936 9:15243034-15243056 GGCAGAGGCAGCAAGGAGAGAGG + Intronic
1051557101 9:18396166-18396188 GGCAGGAGCACCTAAGAGGCAGG - Intergenic
1051710735 9:19927998-19928020 CCTGGCAGCAGCAAGGAGGCAGG + Intergenic
1052704707 9:31981300-31981322 TGCAGTAGCAGCAAGGACCCAGG + Intergenic
1052706299 9:31997428-31997450 AGCAGCAGCTGCAATGGGGCTGG + Intergenic
1052791388 9:32878314-32878336 GGCAGCAGGGGCAGGGAGCCTGG - Intergenic
1052872647 9:33523676-33523698 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
1053053539 9:34980215-34980237 GGCAGCAGCTCCAAAGAGGTAGG - Exonic
1053119942 9:35538891-35538913 CGCGGCAGCAGCACGGAGACTGG + Exonic
1053164567 9:35835320-35835342 GGCAGCAGCACAAGGGTGGCTGG + Intronic
1053316846 9:37059293-37059315 GGGAGCAGAGGCAAGGAGACCGG - Intergenic
1053564735 9:39237132-39237154 GGCACCAGCAGCTAGGAGATGGG - Intronic
1053752313 9:41269177-41269199 TGCAGCAGCTGCACGGGGGCGGG - Intergenic
1053752763 9:41273434-41273456 TGCAGCAGCTGCACGGGGGCGGG - Intergenic
1053830515 9:42075033-42075055 GGCACCAGCAGCTAGGAGATGGG - Intronic
1054132416 9:61381902-61381924 GGCACCAGCAGCTAGGAGATGGG + Intergenic
1054257840 9:62833509-62833531 TGCAGCAGCTGCACGGGGGCGGG - Intergenic
1054258288 9:62837786-62837808 TGCAGCAGCTGCACGGGGGCGGG - Intergenic
1054333482 9:63782255-63782277 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
1054351590 9:64021301-64021323 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
1054452769 9:65412231-65412253 AGCAGCATCTGCAAAGAGGCTGG + Intergenic
1054600045 9:67112422-67112444 GGCACCAGCAGCTAGGAGATGGG + Intergenic
1054803325 9:69374741-69374763 GGCAGTAGCACCAAGAATGCAGG + Intronic
1054942072 9:70754142-70754164 GGCAGCAGCAGAAAAGGAGCTGG + Intronic
1055693521 9:78858685-78858707 GTCAGAAGCAGCCAGGAGACTGG + Intergenic
1056453348 9:86737832-86737854 GCCAGCTCCAGCAAGGAGGTGGG - Intergenic
1056782049 9:89557770-89557792 GGGAGCTGCAGCAAGAAGGTGGG - Intergenic
1057305315 9:93908951-93908973 GGCAGCCTGAGCAAAGAGGCTGG + Intergenic
1057881575 9:98796448-98796470 CGCAGCAGCAGCTGGAAGGCCGG + Exonic
1057910391 9:99015690-99015712 GGCAGCTGCTGGAGGGAGGCAGG + Intronic
1059387263 9:113974345-113974367 TGGAGTAGCAGCAAGGAGGCCGG + Intronic
1059697030 9:116739328-116739350 GGCAGCAGGAGTAAGTAGGCAGG - Intronic
1060215002 9:121733622-121733644 GGCAGCAGTAGCCAGGAGAAGGG + Intronic
1060471929 9:123955274-123955296 GGCTGGGGGAGCAAGGAGGCAGG + Intergenic
1060549862 9:124479799-124479821 TGAAGGGGCAGCAAGGAGGCAGG + Intergenic
1060583098 9:124770170-124770192 GGCAGAAGCCGGGAGGAGGCAGG + Intronic
1060769346 9:126320066-126320088 GGTAGGAGCAGAAAGCAGGCAGG - Intergenic
1061389093 9:130307327-130307349 TCCAGGGGCAGCAAGGAGGCCGG + Intronic
1061642448 9:131969938-131969960 AGCATCAGCAGCCATGAGGCTGG + Intronic
1062209489 9:135356035-135356057 GGCAGGAGCAGCGAGGGGGTGGG - Intergenic
1062316222 9:135968361-135968383 GGCAGCAGGAGGGAGGAGGTTGG + Intergenic
1062372614 9:136247811-136247833 AGGAGCAGCAGCGAGGTGGCAGG + Intergenic
1202800485 9_KI270719v1_random:170589-170611 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
1202800931 9_KI270719v1_random:174871-174893 TGCAGCAGCTGCACGGGGGCGGG + Intergenic
1186546924 X:10459663-10459685 GGCAGCCGCAGCAGTGAGCCTGG - Exonic
1186557059 X:10570949-10570971 GGCAACAGCAGCAAGGATGGCGG + Intronic
1186627093 X:11306015-11306037 GGATACAGCAGCAAGGAGGCAGG - Intronic
1186788535 X:12975184-12975206 GACGGCAGGAGGAAGGAGGCAGG - Exonic
1186848215 X:13552764-13552786 GGCAGCAGCTTCATGGAGGATGG - Intergenic
1186977360 X:14922686-14922708 GACAGCAGCAAGCAGGAGGCAGG + Intergenic
1187525477 X:20050255-20050277 GGCAGCAGCATCTAGGAGCTTGG - Intronic
1188418648 X:29969980-29970002 GTCAACAGAAGCAAGGAGTCAGG + Intergenic
1188466200 X:30484271-30484293 GAAAGCAGCAGTAAAGAGGCAGG + Intergenic
1188962257 X:36507146-36507168 GACAACAGCACCAAGGAGGATGG + Intergenic
1189247536 X:39575382-39575404 GGCAGCAGCAGTGAGGAGCTTGG - Intergenic
1189381808 X:40507480-40507502 GGAAGCAGTAGCCATGAGGCTGG + Intergenic
1190023827 X:46903941-46903963 CCCAGCAGCAGCAGGTAGGCAGG + Intergenic
1191600209 X:62995300-62995322 GGCAGCAGGAGAAAGAAAGCAGG - Intergenic
1191659543 X:63635687-63635709 GGCAGAAGCCCCAAGGAGGGAGG + Exonic
1191706979 X:64104058-64104080 GGTAGCAGCAGCAAGGATAGAGG + Intergenic
1192159347 X:68771296-68771318 GGCAGCAGAAGCAGGCAAGCAGG + Intergenic
1192190244 X:68986868-68986890 GGCAGCAGCAAAATGGAGGATGG - Intergenic
1192191778 X:68995525-68995547 GGTAGCAGCAGGAAGGGGTCTGG - Intergenic
1192207800 X:69107600-69107622 GGCAGCAGCAGGAGGGAGAGGGG + Intergenic
1192265383 X:69533962-69533984 GCCAGCAGCAGGGAGAAGGCAGG + Intergenic
1192448728 X:71229451-71229473 GCCAGCAGCTGCATGGAGACTGG + Intergenic
1192808194 X:74528257-74528279 GGCAGCAGCGGGATGGGGGCAGG + Intronic
1192982947 X:76366757-76366779 AGCAGCAGCAACAGTGAGGCTGG + Intergenic
1193021816 X:76800114-76800136 GGCAGCAGTAGCAACTTGGCTGG - Intergenic
1193717507 X:84949698-84949720 GATACCAGCAGCAAGGTGGCAGG - Intergenic
1194064317 X:89242551-89242573 GGGAGCAGGAGCAAGGAGTAGGG - Intergenic
1194212047 X:91081930-91081952 AGCAGGAGCAGCTAGGATGCAGG + Intergenic
1195355288 X:104033704-104033726 GGAAGGGGCAGGAAGGAGGCAGG + Intergenic
1195586189 X:106567447-106567469 AGCAGCAGCAGCAATGTGACAGG - Intergenic
1196838394 X:119834919-119834941 TTCAGCAGCAGAAAGGAAGCAGG - Exonic
1196951672 X:120931264-120931286 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196952356 X:120936125-120936147 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196953041 X:120940986-120941008 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196953726 X:120945846-120945868 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196954411 X:120950707-120950729 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196955094 X:120955567-120955589 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196955782 X:120960450-120960472 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196956463 X:120965311-120965333 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196957145 X:120970171-120970193 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196957827 X:120975031-120975053 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196958509 X:120979891-120979913 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196959190 X:120984751-120984773 AGCGGCAGCAGCGGGGAGGCGGG - Intronic
1196973894 X:121138079-121138101 GGCTGGAGCAGCTAGGATGCAGG + Intergenic
1197796019 X:130299478-130299500 GGCAGCAGCAGGAAGCAGACAGG - Intergenic
1199718462 X:150524759-150524781 GGGAGAAGCAACAAGGAGGAGGG - Intergenic
1199772512 X:150983784-150983806 GGCGGCAGCGGGAAGGGGGCCGG + Intronic
1199846652 X:151696339-151696361 GGCAGCAGCAGCAGTGAAGGTGG + Intronic
1199976332 X:152897073-152897095 GGGGACACCAGCAAGGAGGCTGG + Intergenic
1200127301 X:153821891-153821913 CTCAGAAGCAGAAAGGAGGCCGG + Intronic
1200718491 Y:6576650-6576672 GGGAGCAGGAGCAAGGAGTAGGG - Intergenic
1202381049 Y:24276759-24276781 TGCAGAGGCAGCCAGGAGGCTGG - Intergenic
1202489736 Y:25393367-25393389 TGCAGAGGCAGCCAGGAGGCTGG + Intergenic