ID: 1073535093

View in Genome Browser
Species Human (GRCh38)
Location 10:104269180-104269202
Sequence CGGCAGCAGCAGCAAGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 579}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535093_1073535102 11 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535093_1073535104 14 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535093_1073535096 -10 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535093_1073535107 24 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535093_1073535097 -5 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535093_1073535108 25 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535093 Original CRISPR CGGCAGCAGCAGCAAGGAGG CGG (reversed) Exonic
900148930 1:1169849-1169871 AGGCGGCAGCAGCATGGGGGTGG - Intergenic
901025018 1:6274566-6274588 GGGCAGCAGCAGAAGCGAGGTGG + Intronic
901128954 1:6950165-6950187 GGGCGGAGGCAGCAAGGAGGGGG + Intronic
901668098 1:10837888-10837910 GGGTAGCAGCTGGAAGGAGGTGG + Intergenic
901812626 1:11776529-11776551 GGGCAGCAGGAGCAAGGCCGGGG + Exonic
902255238 1:15184645-15184667 TGGCAGAAGCAGGAAGTAGGTGG + Intronic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902614230 1:17615204-17615226 CAGCAGCACCAGCAAAGAGAAGG - Intronic
902652806 1:17847496-17847518 AGGCAGAGGCAGCAAGGAGGAGG - Intergenic
903044257 1:20553750-20553772 CCTCAGCAGCATCCAGGAGGAGG + Exonic
903057199 1:20644558-20644580 TGGCAGCAGCGGCACGGAAGAGG - Exonic
903162224 1:21497244-21497266 CTGCTGCAACAACAAGGAGGAGG + Intergenic
903606717 1:24580319-24580341 CTGCAGAGGCAGCCAGGAGGAGG - Intronic
903664095 1:24996159-24996181 AGGGAGGAGCAGCATGGAGGGGG - Intergenic
903665314 1:25003539-25003561 CACCAGCAGCAGTGAGGAGGGGG - Intergenic
903770137 1:25758616-25758638 CGGCAGCAGCAGCATCTTGGCGG + Exonic
904475596 1:30762701-30762723 GGTCAGCAGCAGGGAGGAGGGGG - Intergenic
905441316 1:37997956-37997978 CGCCCGCTGCAGCAAGGTGGGGG - Exonic
905805730 1:40875904-40875926 CAGCAGCAGCAGCAATGTGGAGG - Intergenic
906126211 1:43428421-43428443 CTTCAGCAGCAGCATGGAGGAGG + Exonic
906261921 1:44399096-44399118 CTGAAGGAGGAGCAAGGAGGAGG - Intergenic
907414247 1:54303261-54303283 TAGCAGGAGCACCAAGGAGGAGG - Intronic
908070532 1:60455086-60455108 TGGCAGCAGTTGCATGGAGGTGG - Intergenic
908539647 1:65110736-65110758 CGAGAGAAGAAGCAAGGAGGTGG + Intergenic
908657678 1:66405256-66405278 TGGCAGCAGGAACAAGAAGGGGG - Intergenic
909352692 1:74673416-74673438 CCGCAGCAGGAGGGAGGAGGAGG + Intronic
911089721 1:94008949-94008971 AGGAAGCAGAAGCAAGGAAGTGG - Intronic
912187328 1:107294022-107294044 CAGCAGCAGTAGCCAGGAGCTGG + Intronic
912996416 1:114536369-114536391 GGGCAGCAGCACCATGGAGGTGG + Intergenic
913063760 1:115231170-115231192 CAGCAACAGCAGCAAGGAAGGGG + Intergenic
914898417 1:151697524-151697546 ACCCAGCTGCAGCAAGGAGGTGG + Exonic
914899877 1:151706223-151706245 CAGCAGCAGCAGCAAAGAGAAGG - Exonic
915325303 1:155078857-155078879 CGGCGGCGGCAGCAGGGAGCTGG + Exonic
915393156 1:155562439-155562461 CGGCGGCAGCAGCAGAGTGGCGG + Exonic
915393157 1:155562442-155562464 CGGCAGCAGCAGAGTGGCGGCGG + Exonic
915453798 1:156025508-156025530 AGGCAGCAGCAGGAAGAAGTAGG + Intergenic
915517177 1:156420427-156420449 CGGCGACAGCAGCCAGGAGGCGG - Intronic
915690901 1:157689834-157689856 CAGCAGCAGCAGCAAGGACGAGG + Exonic
917112693 1:171566380-171566402 CGGCAGAAGCAGCCACGAGCAGG + Exonic
919767938 1:201139371-201139393 CAGCAACAGCAGCAAGGACTTGG - Intronic
919817596 1:201451219-201451241 AGGCGCCAGCAGAAAGGAGGGGG + Intergenic
920199241 1:204249363-204249385 CCTCAGCAGGAGAAAGGAGGGGG - Intronic
920613353 1:207464426-207464448 TGACAGCAGCAGCAGGGAGAGGG + Intronic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922534817 1:226372035-226372057 CCCCAGCTGCAGCCAGGAGGAGG + Intronic
922872321 1:228912839-228912861 CAGCAGCAGCAGCTATGTGGAGG - Intergenic
923141060 1:231162090-231162112 CGGCAGCGGCGGGAGGGAGGCGG + Intronic
923270650 1:232352394-232352416 CCAGAGCGGCAGCAAGGAGGTGG + Intergenic
923732927 1:236570477-236570499 CGGTGGCAGCGGCAGGGAGGAGG + Intronic
924776025 1:247114839-247114861 GGGCTCCAGGAGCAAGGAGGAGG + Intergenic
1063463605 10:6229518-6229540 GGGAAGCAGCTGCAAGGGGGTGG - Intronic
1063602371 10:7493947-7493969 TGGATGCAGGAGCAAGGAGGGGG + Intergenic
1063662972 10:8046521-8046543 CGGCAGCAGCCGCTAGGCAGAGG - Intergenic
1063847329 10:10145219-10145241 GGGGAGCAGTAGGAAGGAGGAGG - Intergenic
1063969816 10:11373788-11373810 CTGGAGGAGCAGCAAGGACGGGG - Intergenic
1064103039 10:12479519-12479541 CGGCAGCAGCAGCACTGCTGGGG - Intronic
1064380580 10:14838367-14838389 CGGCAGCGGCAGGAATGAGGGGG - Exonic
1064545880 10:16449520-16449542 GGACAGCAGAAGCAAAGAGGCGG - Intronic
1065133142 10:22643033-22643055 AGGCTCCAGCACCAAGGAGGAGG + Intronic
1066290139 10:34006640-34006662 CAGCAGCAGCATCAAAGAGCTGG + Intergenic
1066752733 10:38675672-38675694 CAGCAGCAGCAGCACAGAGCAGG - Intergenic
1067008659 10:42690398-42690420 TGGCAGCAGCAGCAAGTCTGGGG - Intergenic
1067024878 10:42836244-42836266 CAGAAGGAGCAGCGAGGAGGTGG - Intergenic
1067095856 10:43299213-43299235 GGGTAACAACAGCAAGGAGGAGG + Intergenic
1067770101 10:49116518-49116540 GGGTAGCAGCAGCTAGCAGGTGG + Intergenic
1067774946 10:49156685-49156707 GGGCAGCAACAGCAGGAAGGCGG + Intronic
1067899889 10:50228798-50228820 CGGGATGAGGAGCAAGGAGGAGG + Intronic
1068910525 10:62374436-62374458 CAGCAGCAGCAGCAACAAGTCGG + Exonic
1069962324 10:72086545-72086567 CGGCCACAGCAGCGAGGGGGCGG - Intronic
1070803407 10:79256430-79256452 CTGCAGCTGCAGGAGGGAGGGGG - Intronic
1071414002 10:85424091-85424113 CAGCAGCAGCAGCAATGAAAGGG + Intergenic
1071462410 10:85911502-85911524 GGTCAGCAGCGGCCAGGAGGAGG - Intronic
1071695407 10:87863990-87864012 CGGCTGCAGCTCCAGGGAGGGGG + Exonic
1072544585 10:96426237-96426259 CGGCAGCAGAAGAAAAGAAGAGG - Intronic
1073340775 10:102742906-102742928 CAGAAGAAGCAGCAAGGAGATGG + Exonic
1073535093 10:104269180-104269202 CGGCAGCAGCAGCAAGGAGGCGG - Exonic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1074804070 10:117029678-117029700 CTGGAGCAGGAGCAAGAAGGTGG - Intronic
1075007309 10:118840249-118840271 AGGAAGCAGCAGGAAGGCGGGGG + Intergenic
1076351647 10:129819271-129819293 GGCCAGCAGCAGGAATGAGGGGG - Intergenic
1076681726 10:132175697-132175719 CTCCAGCAGCAGCATGGAGGCGG - Intronic
1077265736 11:1648621-1648643 GGGCATCAGCAGCAGGCAGGAGG - Intergenic
1077370761 11:2180562-2180584 GAGCAGGAGCAGGAAGGAGGAGG + Intergenic
1077441365 11:2570684-2570706 CGGCTGCCGCAGCAAGTACGTGG + Exonic
1077758244 11:5059574-5059596 CCCCAGCAACAGGAAGGAGGAGG + Exonic
1077760618 11:5092707-5092729 CCCCAGCAACAGGAAGGAGGAGG - Intergenic
1078390482 11:10931810-10931832 CGGGAGCCTCAGCAAAGAGGAGG + Intergenic
1078405999 11:11070401-11070423 TGGCAGCAACAGGGAGGAGGAGG - Intergenic
1078439440 11:11351875-11351897 CGCAAGCTGCATCAAGGAGGGGG + Intronic
1080383135 11:31794761-31794783 TGCCAGCAACAGGAAGGAGGGGG - Exonic
1080639886 11:34152464-34152486 CGGCCGCAGCAGCAAAGTGCAGG - Exonic
1080800135 11:35602793-35602815 CGGCAGCAGCAGACATGTGGAGG - Intergenic
1081883266 11:46472145-46472167 TCACAGCAGCAGTAAGGAGGAGG - Intronic
1082023358 11:47553052-47553074 CGGCCTCAGCAGCGAGGCGGCGG - Intronic
1082680167 11:56157837-56157859 GGGTAGAAACAGCAAGGAGGAGG + Intergenic
1083591027 11:63895006-63895028 TGGCAGCAGAAGAAAGGAGAGGG - Intronic
1083593119 11:63906778-63906800 CTGCAGGAGCTGCCAGGAGGGGG - Intronic
1083668835 11:64289318-64289340 TGACAGGAGCAGCAAGGAGCCGG - Exonic
1083674541 11:64318169-64318191 CGGTGGCACCAGCCAGGAGGCGG + Exonic
1083882093 11:65553782-65553804 CGGCAGCAGGTGCTGGGAGGGGG + Exonic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084564523 11:69921505-69921527 AGGCAGCAGGACCAAGGGGGAGG + Intergenic
1085327047 11:75614230-75614252 CTGGAGCAGCCGCAGGGAGGTGG - Intronic
1085527326 11:77172044-77172066 CGGCAGCAGCAGGCTGGGGGCGG - Intronic
1085579420 11:77637526-77637548 CGCCTGCTCCAGCAAGGAGGAGG + Intronic
1085950045 11:81319440-81319462 CTGAAGCAACTGCAAGGAGGAGG - Intergenic
1089298385 11:117483121-117483143 CGGCAGCAGCAGGAGGCAAGGGG + Intronic
1089816760 11:121182987-121183009 TGGCAGCAGCTGCAGGCAGGTGG + Intronic
1091169350 11:133506635-133506657 CGGCAGAAGAAACAATGAGGTGG + Intronic
1091495079 12:965495-965517 AGGCAGCATTAGCAGGGAGGAGG - Intronic
1091835932 12:3585795-3585817 GGGCAGGAGCAGCCAGGAGGGGG + Intronic
1091846111 12:3657424-3657446 CAGCAGCAGCAGCGCGGTGGGGG + Intronic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1093465045 12:19440134-19440156 CAGCAGCAGCAGCGGGGATGGGG + Exonic
1093677326 12:21958719-21958741 AGGCAGCAGCATCAGGGATGGGG - Intergenic
1094297814 12:28927708-28927730 GGGCAGCTGCAACAAGGAGATGG + Intergenic
1094322902 12:29204846-29204868 CGGGAACAGCACCAAGGAGATGG + Intronic
1094332870 12:29315308-29315330 CTGCAGCAGAAGCACTGAGGGGG + Intronic
1094523407 12:31216163-31216185 AAGCAGCAGCAGCAGTGAGGTGG - Intergenic
1096472151 12:51886088-51886110 TGGCAGCAGCAGCAAGGCTCTGG - Intergenic
1097053066 12:56235205-56235227 CCGCAGCAGCAGCAGGGATAGGG - Exonic
1097664917 12:62467213-62467235 CGGCACCAGCAGCCCCGAGGCGG + Exonic
1097872173 12:64610641-64610663 CGGCTACAGCAGCCTGGAGGAGG + Exonic
1098975172 12:76895138-76895160 CTGCAAAAGGAGCAAGGAGGAGG + Intergenic
1099280227 12:80634949-80634971 CGACAGAAGCAGAAAGAAGGTGG + Exonic
1100699752 12:97134674-97134696 CACCACCAGCAGCTAGGAGGAGG + Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102487154 12:113266283-113266305 CAGCAGCAGCAGCAGGGCCGTGG - Exonic
1103564047 12:121806565-121806587 GGGAAGGGGCAGCAAGGAGGTGG - Intronic
1103851912 12:123938889-123938911 CGGCTGGAGGAGCAGGGAGGGGG - Intronic
1103877157 12:124137070-124137092 TGGCACCAACAGGAAGGAGGTGG - Intronic
1103914976 12:124371571-124371593 CGCCAGCAGCGGCCAGGAGCTGG + Intronic
1104774162 12:131382438-131382460 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1104774298 12:131382887-131382909 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1104827240 12:131721142-131721164 CGGGAGCAGCACCGAGGAGATGG + Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104918946 12:132280627-132280649 CGGCAGCTGTGGAAAGGAGGCGG + Intronic
1105547147 13:21359260-21359282 TGGCAGCAGCAACAGGGTGGTGG + Intergenic
1106041379 13:26096972-26096994 CGGAGGCAGCACGAAGGAGGAGG + Intergenic
1106250291 13:27977543-27977565 GGGAAGCCGCAGGAAGGAGGCGG - Intergenic
1106298370 13:28439362-28439384 AGGCAGGACCAGCAAGCAGGTGG - Intronic
1106383870 13:29265713-29265735 CAAAAGCAGGAGCAAGGAGGGGG + Intronic
1106597798 13:31161633-31161655 CGGCAGGAGAAGCAGGCAGGGGG - Exonic
1107605940 13:42056867-42056889 AGGCAGGAGCAGGAAGAAGGGGG - Intronic
1107994983 13:45850805-45850827 CGGCGGCAGCAGCTAGAAGCTGG + Intronic
1108017142 13:46087229-46087251 AGCCAGCAGAAGCCAGGAGGAGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1110291559 13:73813619-73813641 TGGCAGCAGAAGCAAGGAGGAGG - Intronic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1110669040 13:78154622-78154644 CAGAAGCAGGAGCAAGAAGGCGG + Intergenic
1111215152 13:85132029-85132051 CGGCAGCATCAGAAATGTGGAGG + Intergenic
1111268691 13:85853200-85853222 CGTCTGCTGCAGCAAGGGGGTGG + Intergenic
1112314679 13:98350850-98350872 CAGAACCAGCAGGAAGGAGGTGG - Intronic
1112830548 13:103444750-103444772 TGGCAGCTGCAGCAATGAAGTGG - Intergenic
1114259118 14:21025018-21025040 CGGCGGCAGCAGGTAGGGGGAGG - Intronic
1114392082 14:22320524-22320546 CTGCAACAGCATCCAGGAGGAGG + Intergenic
1115399379 14:32939706-32939728 CGGGAGCAGCAGCGAGGGTGGGG + Intronic
1116441781 14:44962432-44962454 CAGCAGAAGCAGCGCGGAGGGGG - Exonic
1116441784 14:44962435-44962457 CGGCAGCAGAAGCAGCGCGGAGG - Exonic
1118053744 14:62056905-62056927 CAGCGGCAGCAGCGAGCAGGGGG + Intronic
1119574987 14:75711935-75711957 CTGCCACAGCAGCAAGTAGGGGG + Intronic
1119703475 14:76770279-76770301 CGGCAGGAGCGGGAAGGGGGTGG - Intronic
1120388518 14:83876296-83876318 CAGAAGCAGAAGCAAGGTGGTGG - Intergenic
1120791750 14:88590393-88590415 CAGGAGCAGCAGCAAGCACGGGG - Intronic
1121273517 14:92652699-92652721 CTCCACCAGCAGCACGGAGGAGG + Exonic
1122198999 14:100110702-100110724 TGGCAGCAGCAGGATGCAGGTGG - Intronic
1122201823 14:100127480-100127502 GGCCAGCAGCAGCTAGGTGGGGG - Intronic
1122230249 14:100303403-100303425 CAGCAACAGCAGCAAGGCGTGGG + Intronic
1122257110 14:100486583-100486605 CGGCAGGAGGACCAGGGAGGAGG + Intronic
1122737964 14:103854788-103854810 AGGCTGCAGGAGCAGGGAGGGGG + Intergenic
1122811208 14:104290242-104290264 AAGCAGCAGCAGGAAGCAGGAGG - Intergenic
1123425512 15:20167701-20167723 CCGAAGGAGCAGCGAGGAGGTGG - Intergenic
1123534734 15:21174219-21174241 CCGAAGGAGCAGCGAGGAGGTGG - Intergenic
1125516473 15:40323880-40323902 CGGCGGCTGCAGCAACGCGGTGG + Intergenic
1125882157 15:43204321-43204343 CAGCAGCAGCAGCATTTAGGGGG - Intronic
1125893158 15:43280938-43280960 GGGTAGCAAGAGCAAGGAGGAGG + Intronic
1126374857 15:47987337-47987359 AGGCAGCAGCTGAAAAGAGGGGG + Intergenic
1126587945 15:50308478-50308500 GGGCAGGAGCAGACAGGAGGAGG + Intronic
1126668433 15:51094730-51094752 CGGCGGCAGCGGCCAGGGGGCGG + Intronic
1126757603 15:51939853-51939875 GGACAGCAGCAGCCAGGAGATGG + Intronic
1126814594 15:52442271-52442293 CTCCTGGAGCAGCAAGGAGGGGG + Intronic
1127057870 15:55150948-55150970 CAGCAGCTGCAGCAAGGCCGAGG - Intergenic
1127698189 15:61472081-61472103 AGGCAACAGCAGCAGGGAGTGGG - Intergenic
1127846963 15:62878413-62878435 GGGCAGCAGTTGCCAGGAGGAGG + Intergenic
1127997636 15:64162903-64162925 CGGCAGCAGCAGGAAGAAGACGG + Exonic
1128367952 15:67018075-67018097 TGTCATTAGCAGCAAGGAGGTGG - Intergenic
1129079528 15:73026745-73026767 CGCCAGCATGAGAAAGGAGGGGG + Intergenic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129238021 15:74235315-74235337 AGAGAGCAGCAGCAAGGATGTGG - Intergenic
1129919911 15:79311272-79311294 CAGCAGAAGCAGCACGGAGGCGG - Exonic
1130669155 15:85895119-85895141 AGAAAGCAGCAGCAAAGAGGAGG - Intergenic
1131117564 15:89804288-89804310 CTCCAGCAGCAACAAGGAGCGGG - Exonic
1131154068 15:90064052-90064074 AGGCAGGACCAGCAAGAAGGAGG - Intronic
1131437541 15:92435407-92435429 CTGCAGGAGCAGGAAGCAGGAGG + Intronic
1132038113 15:98503201-98503223 CGTCTGCAGCAGAAAGAAGGCGG + Intronic
1132621453 16:870050-870072 CGGCAGCATCACCAAGGAGCGGG - Exonic
1132659809 16:1056236-1056258 AGGCAGCAGGAGCACGCAGGTGG + Intergenic
1132831502 16:1930383-1930405 CGGGGGCAGCCGCAAGGATGGGG + Intergenic
1132908226 16:2295137-2295159 CGGCAGAACCAGCAAGGGGAGGG - Intronic
1133117775 16:3587931-3587953 TGGGAGCAGCAGCACCGAGGGGG + Intronic
1134163979 16:11915642-11915664 CGGCAGCAGCAGCAGCGACTCGG - Exonic
1134438890 16:14285789-14285811 CGCCGGCCGCAGCAGGGAGGGGG + Intergenic
1135498187 16:22970776-22970798 CAGCAGCTGCTGCAGGGAGGGGG + Intergenic
1136000324 16:27287530-27287552 GGGCAGAAGCAGCAAGGAGTGGG + Intronic
1136019336 16:27430088-27430110 CAGCAGCAGGAGCAAGGGGGCGG - Exonic
1136033869 16:27523815-27523837 CAGCCGCAGCAGCAGAGAGGTGG + Intronic
1136140969 16:28288494-28288516 CGATAACTGCAGCAAGGAGGCGG - Intergenic
1136318028 16:29465585-29465607 GGGCAGCAGCTGCGAGGAAGGGG - Intronic
1136432603 16:30204934-30204956 GGGCAGCAGCTGCGAGGAAGGGG - Intronic
1136515221 16:30764246-30764268 TGCCAGCAGCAGTGAGGAGGTGG + Exonic
1136524531 16:30820683-30820705 AGGCAGCAGCAGCAGTGATGGGG + Intergenic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136550465 16:30979923-30979945 CAGCAGCAGCAGCGATGGGGAGG + Exonic
1137004093 16:35256012-35256034 CAGGAACAGCAGCAAGGAGAGGG - Intergenic
1137714812 16:50592214-50592236 CGGCGGCAGCAGCAACGCGCTGG - Intronic
1137867643 16:51917337-51917359 CGGTAGCAGCAAGAAGAAGGAGG - Intergenic
1138143181 16:54586065-54586087 CATCAGCAGCAGGAATGAGGGGG + Intergenic
1138146246 16:54614815-54614837 TGGAAGCAGGAGCAAGAAGGGGG - Intergenic
1138594276 16:58021404-58021426 CTGCAGCTGCAGCAGGCAGGAGG - Exonic
1139519434 16:67472113-67472135 CAGCAGCAGCAGCAAGCTGGAGG + Intronic
1141480240 16:84301572-84301594 CCCCAGCAGCACCCAGGAGGGGG + Intronic
1141611444 16:85183392-85183414 GGGCTGCACCAGGAAGGAGGTGG + Intronic
1141620516 16:85234757-85234779 CCGCAGCAGCAGGGAGGAGCCGG + Intergenic
1141639561 16:85333423-85333445 CGGCAGGAGAGACAAGGAGGAGG - Intergenic
1141712913 16:85710263-85710285 CAGCAGCAGCAGCCACGACGAGG - Exonic
1141950028 16:87334129-87334151 CGCCAGGAGCAGCAGGAAGGCGG - Exonic
1141989611 16:87602570-87602592 CAGCAGCAGCAGCAATGCGGCGG - Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142002648 16:87672190-87672212 GGGAGGCGGCAGCAAGGAGGGGG + Intronic
1142131798 16:88434580-88434602 GGGGACCAGCAGCAAGGAGCCGG + Exonic
1143087458 17:4426780-4426802 GGGCAGCAGCTGCTAGGTGGGGG + Intergenic
1143100931 17:4504338-4504360 AGGAAGCAGGAGCAAGGAAGTGG - Intronic
1143712327 17:8743536-8743558 AGTCAGCAGAAGCAAGGAGGAGG + Intronic
1144254789 17:13456832-13456854 GGGCTGGAGCAGCAAGGAGCCGG + Intergenic
1144464638 17:15487567-15487589 GGGCAGGAGGAGCCAGGAGGGGG - Intronic
1144761140 17:17708142-17708164 TGGCAGCAGGAGGAAGGAGGAGG - Intronic
1144967337 17:19085985-19086007 TGGCAGCAGTAGCAAGGAGAAGG + Intergenic
1144980582 17:19166081-19166103 TGGCAGCAGTAGCAAGGAGAAGG - Intergenic
1144987640 17:19212152-19212174 TGGCAGCAGTAGCAAGGAGAAGG + Intergenic
1145264178 17:21371659-21371681 CGGGAGGAGCAGCTGGGAGGAGG - Intergenic
1146736382 17:35242519-35242541 CGCCAGCAAAAGAAAGGAGGCGG + Intergenic
1146896594 17:36545670-36545692 CGGCGGCGGCAGCTGGGAGGAGG + Exonic
1146896595 17:36545673-36545695 CGGCGGCAGCTGGGAGGAGGTGG + Exonic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147403615 17:40195347-40195369 CATCAGCAGTAGCAGGGAGGGGG - Exonic
1147671874 17:42181060-42181082 CGGCAGCGGCAGTAAGAGGGAGG - Exonic
1147964789 17:44188721-44188743 TAGCAGCAGCAGCAAGGCTGTGG + Intronic
1148021649 17:44557587-44557609 CGGCAGCCGCAGCGAGGAGGCGG + Exonic
1148084782 17:44987540-44987562 CGGGAGCCCCAGCCAGGAGGTGG - Intergenic
1148441452 17:47713658-47713680 CTGCGGCAGGAGCAAGGCGGAGG + Intergenic
1148769256 17:50057414-50057436 CCCCAACAGCTGCAAGGAGGAGG + Intronic
1148770083 17:50061444-50061466 GGGCAGCAGCAGCAACAAGGGGG + Intronic
1149543795 17:57488280-57488302 CCGCAGATGCTGCAAGGAGGCGG - Intronic
1149915039 17:60600670-60600692 CGGCAGCAGCGGCTAGGTGCCGG - Exonic
1150497970 17:65623693-65623715 CAGGTGCAGGAGCAAGGAGGTGG - Intronic
1150636406 17:66916275-66916297 CTCCAGGAGCAGCTAGGAGGCGG + Intergenic
1151367031 17:73624076-73624098 CTGGAGCAGGAGCAGGGAGGAGG + Intronic
1151905262 17:77043911-77043933 CAGGAGCAGGAGCAAGGAGGGGG + Intergenic
1152342876 17:79734907-79734929 CCGCAGCTGCAGCTAGGAGCAGG + Intronic
1152356879 17:79811800-79811822 CCGCAGAAACAGCAAGGAGGAGG - Intergenic
1152383837 17:79957015-79957037 TGGCCACAGCAGCAGGGAGGGGG + Intronic
1152543121 17:80987037-80987059 TGGCAGCTGCAGCAAGGAAGGGG - Intergenic
1152586638 17:81192314-81192336 CGGCCGCACCAGGAAGGAGGTGG - Exonic
1153794384 18:8609429-8609451 CGGCAGCAGCATCCCGGACGAGG - Exonic
1154170240 18:12046224-12046246 CGGCAGCAACAGCAAGTCCGGGG - Intergenic
1155126409 18:22880845-22880867 CGGCAGCAGCAGCAGGCAGCAGG + Intronic
1156412913 18:36852574-36852596 GGGTAGCAACAGCAGGGAGGAGG - Intronic
1157732976 18:50020668-50020690 TGGCAGCAGCAACCAGGTGGAGG + Intronic
1158598726 18:58838914-58838936 GGGCAGCAGCAGTGAGGAAGAGG - Intergenic
1160165364 18:76506776-76506798 CGGGAGCAGCAGTAATGTGGGGG + Intergenic
1160842229 19:1151283-1151305 CTGCAGCTGCAGGAAGGGGGCGG + Intronic
1160994333 19:1875718-1875740 CAGCGGCAGCAGCGAGCAGGGGG + Intergenic
1161059768 19:2209119-2209141 GGGGAGGAGCAGGAAGGAGGCGG - Intronic
1161068914 19:2250921-2250943 CGGCAGCAGGAGCAGGGCCGGGG - Exonic
1161252157 19:3286004-3286026 CTGCAGCAGCAGCAGCGAGAAGG + Exonic
1161507231 19:4650490-4650512 CCGGAGCTGCAGGAAGGAGGTGG + Intronic
1161572419 19:5037830-5037852 CAGCAGCCGCAGCGAGCAGGTGG - Intronic
1162040510 19:7968375-7968397 TGACAGCAGCAGCATGGAGCTGG - Intronic
1162930923 19:13957285-13957307 TGGCAGCAACAGGAGGGAGGGGG + Intronic
1163704374 19:18803786-18803808 TGCAAGCTGCAGCAAGGAGGTGG + Intergenic
1165026984 19:32969453-32969475 TGGCAGCAGGAGGAAGGGGGTGG - Intronic
1165313024 19:35040035-35040057 AGGCAGCAGAAGCAGGGTGGGGG - Intronic
1165396218 19:35565039-35565061 GGGCAGCAGCAGCGAGGGGCTGG + Intergenic
1165935518 19:39386365-39386387 GGGCAGCAGCAGTGAGAAGGAGG - Exonic
1167058855 19:47130954-47130976 CGGCGGCATTAGCGAGGAGGAGG + Exonic
1167240929 19:48342563-48342585 GAGCAGCAGCAGCAGGGAGGTGG + Exonic
1167615587 19:50531148-50531170 CGGGAGCTGCAGGCAGGAGGTGG - Intronic
1167874493 19:52400068-52400090 CATCAGCAGCAGCCAGGAGCAGG - Intronic
1168213670 19:54909661-54909683 CACCAGAAGCAGGAAGGAGGAGG + Intronic
925140118 2:1544327-1544349 GGGCAGCAGCTGGAAGTAGGAGG - Intergenic
925149765 2:1607038-1607060 CGGAAGGAGCAGAAAGGTGGAGG - Intergenic
926115386 2:10209979-10210001 GGGCAGCAGGAGCAGGGATGGGG - Intronic
926206411 2:10837105-10837127 GGGCAGCAGGATCAAGGAGCTGG + Intronic
926907094 2:17816133-17816155 GGGCATCCGCAGCAAGGAGGGGG - Intergenic
927633495 2:24793981-24794003 GGGCAGCAGCAGGAAGGAGGCGG - Intronic
927652244 2:24919890-24919912 CGGCCGCAGGGGGAAGGAGGAGG + Intergenic
927860983 2:26559718-26559740 AGGCAGGAGCAGCACAGAGGAGG - Intergenic
927866973 2:26595325-26595347 CGACAGGAGGAGCAGGGAGGAGG + Intronic
928278820 2:29926075-29926097 GAGCAGCAGCAGCAAGCAGGAGG + Intergenic
928512079 2:32011039-32011061 CGGCAGCAGAGGCTGGGAGGTGG + Intronic
929108853 2:38389505-38389527 TGTCAGCAGCAGCAAGGATATGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929791160 2:45024188-45024210 CGGCAGGAGCAGAAGGTAGGAGG + Intergenic
930716103 2:54595555-54595577 CAGCACCAGCAGCATGGAGCTGG - Intronic
932050931 2:68396785-68396807 CGGCAGCTGCAGCAAGTGGAGGG + Exonic
932362211 2:71118362-71118384 GGGCAGCGGCAGCAAGGAGTGGG - Intronic
934524969 2:95046182-95046204 GGGCAGCAGGTGCAGGGAGGTGG + Intronic
934926554 2:98385845-98385867 CGGCAGGAGCAGGAGGAAGGTGG + Intronic
935122853 2:100197680-100197702 GGGCAGCAGCAGCCTGGGGGAGG + Intergenic
935164138 2:100554962-100554984 CAGCAGCAGCAGCACAGAGAGGG - Intergenic
936111884 2:109671404-109671426 TGGCAGCAGCAGCAAGTCTGGGG + Intergenic
936375351 2:111936709-111936731 TGGCTACAGCACCAAGGAGGAGG - Intronic
937039583 2:118810555-118810577 AGGCAGCAAGAGCAGGGAGGAGG + Intergenic
937221789 2:120346220-120346242 CGCCAGCAGCAGAAGGCAGGCGG - Exonic
937318183 2:120945238-120945260 CGGCAGCAGCAACAAGGAGCAGG - Intronic
937992769 2:127673680-127673702 CCCCAGCAGCAGCATTGAGGTGG - Intronic
938115528 2:128600790-128600812 CGGCAGAGGCAGAAAGGGGGAGG - Intergenic
938548121 2:132353253-132353275 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
940089153 2:149896746-149896768 CAGCAGCAGCACCTGGGAGGAGG + Intergenic
940303332 2:152198853-152198875 CAGCAGAAGATGCAAGGAGGAGG - Intergenic
940446678 2:153785480-153785502 CTGCAGCAGCCCTAAGGAGGTGG + Intergenic
941526299 2:166610662-166610684 CGGCGGCAGTAGCAATGGGGAGG + Intergenic
942057586 2:172199010-172199032 CAACAGCAGCAGCAAGGACTGGG - Intergenic
942072127 2:172325395-172325417 AGGCAGGAGAATCAAGGAGGTGG + Intergenic
942314290 2:174683239-174683261 CGCCAGCAGCCGCAAGAAGGTGG - Intergenic
942329251 2:174804707-174804729 CTTCAGCAGCAGCGAGGACGAGG + Intronic
943367784 2:186982047-186982069 CTGCAGCTGGAGCAAGGAGTTGG - Intergenic
944155339 2:196601697-196601719 CAGCAGCAGCAACTATGAGGAGG - Intergenic
944155340 2:196601700-196601722 CAGCAGCAGCAGCAACTATGAGG - Intergenic
944199535 2:197091203-197091225 CTGCAGCAGCATCCAGGCGGGGG - Intronic
944905157 2:204255028-204255050 CAAAAGCAGGAGCAAGGAGGTGG + Intergenic
946438300 2:219674087-219674109 AGGAAGCACCAGGAAGGAGGAGG - Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
947934387 2:233991015-233991037 CTGCAGCAGCAGCTAGGTGGAGG + Intronic
948345294 2:237291493-237291515 CAGGAGCGGCAGCAAGGAGGGGG - Intergenic
948373450 2:237505164-237505186 CATCAGGACCAGCAAGGAGGTGG - Intronic
948698283 2:239745130-239745152 CGGCAGCAGCAGCTTAGAGGAGG + Intergenic
1169278614 20:4249317-4249339 GGGCAGCGCCAGGAAGGAGGAGG + Intergenic
1170330198 20:15201043-15201065 CAGCAGCAGCACCTGGGAGGTGG - Intronic
1170610789 20:17911180-17911202 AGGCAGCAGTAGCAATGTGGAGG - Intergenic
1170769553 20:19320007-19320029 CAGCAGCTGCAGCATGGATGGGG + Intronic
1171020943 20:21583549-21583571 CAGCAGCAGCAGCTTGGAGCAGG + Intergenic
1171123103 20:22582395-22582417 CGCCGGCAGCGGCAAGAAGGCGG - Exonic
1171876990 20:30586025-30586047 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1172027038 20:31955576-31955598 TGTGAGCAGCAGCAGGGAGGTGG - Intergenic
1172389932 20:34559460-34559482 GGGCAGCCGCCGCCAGGAGGTGG + Intronic
1173479422 20:43387586-43387608 CGGAAGCAGCAGCAAGGAAGAGG + Intergenic
1173565953 20:44038928-44038950 CGGAGGCAGCAGGAACGAGGCGG - Intronic
1173603337 20:44311305-44311327 AGGCAGCAGCGGCCACGAGGGGG - Intergenic
1173970653 20:47149763-47149785 AGGCAGCAGAAACCAGGAGGCGG + Intronic
1174369453 20:50076779-50076801 GGCCACCAGCAGCAATGAGGTGG + Intergenic
1175252882 20:57620298-57620320 TGACAGCAGCTGCAAGGAGTCGG + Exonic
1175819378 20:61900447-61900469 TGGTAGGAGGAGCAAGGAGGCGG - Intronic
1175830839 20:61964999-61965021 CGGCAGCAGCTCCCAGGAGGAGG - Intronic
1175911539 20:62407446-62407468 CGGACGCAGCAGCAGGGAGTCGG + Intergenic
1175934167 20:62507479-62507501 TGGCGGCAGCAGGAAGGAGAGGG + Intergenic
1175939254 20:62530417-62530439 GGGCAGGGGCAGCAAGGAGCTGG - Intergenic
1175954810 20:62603842-62603864 GGGCAGCAGCAGCGGGGTGGGGG - Intergenic
1176033681 20:63026056-63026078 GGGCAGGAGCAGGAAGGATGCGG + Intergenic
1176142258 20:63549943-63549965 GGGCAGCAGGTGCAAGGAGGGGG - Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176673584 21:9756486-9756508 AGCCAGCATCAGCAAGAAGGAGG - Intergenic
1178535074 21:33403899-33403921 GGGCAGCAGCAGGAAGACGGGGG + Intronic
1179613993 21:42569930-42569952 CAGCAGCAGCAGCGTGGAGCTGG - Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179837929 21:44049749-44049771 AGGCAGCAGCAGCCAGGGGCAGG - Intronic
1181054390 22:20253207-20253229 GGGCAGAAGCAGCGAGGAAGTGG - Intronic
1181463045 22:23096557-23096579 AGGCAGCTCCAGCAAGGTGGGGG + Intronic
1181512409 22:23394803-23394825 CAGCGGCCCCAGCAAGGAGGTGG + Intergenic
1181568159 22:23752085-23752107 TGCCATCAGCAGCAAGGAGGGGG - Intergenic
1181670908 22:24425097-24425119 CGGCAGCAGAGGCAGGGTGGAGG - Intronic
1182686482 22:32124207-32124229 TGGCAGCAGCAGCAAGTCTGGGG + Intergenic
1182715212 22:32352685-32352707 CAGCAGCAGCAGCAAGTTTGGGG - Intergenic
1182833253 22:33320925-33320947 CTGAAGCAGCAGCATGGTGGTGG - Intronic
1183018476 22:35008670-35008692 GGGAAGCTGCAGCAAGGAGTGGG + Intergenic
1183098841 22:35570969-35570991 GGGAAGCAGCAGCAAGGCTGAGG - Intergenic
1183922235 22:41178282-41178304 CAGCAGCAGCAACAGGGAGCAGG + Exonic
1184380577 22:44142849-44142871 CAGCAGAAGCAGCAAGGCCGGGG - Intronic
1184422710 22:44391216-44391238 CAGAAGCAGCCGCAGGGAGGCGG - Intergenic
1184913203 22:47549748-47549770 TGGCAGCAACAGCAGGAAGGTGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
949128284 3:471913-471935 CTGGAGCAGGAGCAAGAAGGAGG - Intergenic
949547501 3:5084465-5084487 CGCCAGCACAACCAAGGAGGTGG - Intergenic
950172099 3:10845894-10845916 TGGAAGAGGCAGCAAGGAGGAGG - Intronic
950866217 3:16191238-16191260 CCGCAGCAGGAGGAAGAAGGAGG - Intronic
950958438 3:17079632-17079654 CGGCAGCACCACGGAGGAGGCGG - Intronic
951112146 3:18816681-18816703 TGACAGCAGCACAAAGGAGGTGG - Intergenic
952408390 3:33025933-33025955 AGGGTGCAGCAGGAAGGAGGTGG + Intronic
952706165 3:36380315-36380337 CCGCAGGAGGAGGAAGGAGGCGG - Intergenic
952884687 3:38005281-38005303 CTGCAGCAGAAGCAGTGAGGGGG - Intronic
953768391 3:45761080-45761102 CGTCAGCAGCAGCAAAGGGCAGG - Intronic
954293857 3:49663493-49663515 CAGCAGCAGCAGCAAGGTCTTGG + Exonic
954409681 3:50365002-50365024 CGGCGGCGGCGGCACGGAGGGGG + Intronic
954658766 3:52215140-52215162 GGGCAGGGGCAGCAAGAAGGGGG - Intergenic
954701284 3:52452184-52452206 CTGCATCAGCACCAAGGAGCTGG - Exonic
954784293 3:53081664-53081686 GGGCAGCACCACCAAGGAGTGGG - Intronic
954991456 3:54844027-54844049 GGGGAGCAGCAGCACAGAGGTGG + Intronic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
957914298 3:86666991-86667013 CAGGAGCAGGAGCAAGGAGTGGG - Intergenic
958529588 3:95309526-95309548 CTGCAGAAGCAGCTAGGTGGGGG - Intergenic
958777973 3:98508316-98508338 TGGCAAAAGCAGCAAGAAGGGGG + Intronic
959826803 3:110806927-110806949 GGGCAGCAGCAGCAATGGTGGGG - Intergenic
960955478 3:123027774-123027796 CGGGAGCAGAAGGAGGGAGGGGG + Intronic
962040761 3:131705256-131705278 CAACAGCAGCAGCAAGGCTGGGG + Intronic
962290760 3:134134589-134134611 CTGCTGCAGCTGAAAGGAGGAGG + Intronic
962370127 3:134814363-134814385 CAGAAGCAGAAGCAAGGAGAAGG + Intronic
962688263 3:137868227-137868249 CAGCAGCAGCAGCATGGTGCAGG + Intergenic
962808430 3:138943065-138943087 CGGCAGGAGCAGGATGGAGAGGG - Intergenic
963926995 3:150961180-150961202 AGGCAGAAGCCACAAGGAGGAGG - Intronic
963973270 3:151452921-151452943 GGGCAGCAGCAGGTACGAGGAGG + Intronic
963986364 3:151599167-151599189 GGGCAGCAGCAGCTATAAGGGGG + Intergenic
964486164 3:157186924-157186946 TGGCAGCAGCAGCAATGCGTGGG - Intergenic
965512413 3:169582761-169582783 AGGAAGCAGCAGCCAGGAGGAGG + Intronic
965550461 3:169959780-169959802 GGGCAGCAGCAGCAGGAAGATGG - Intergenic
965622463 3:170655189-170655211 CACCACCAGCAGCAAGGAGGTGG - Intronic
965816790 3:172644355-172644377 CTGGAGTAGGAGCAAGGAGGTGG + Intronic
966059130 3:175733990-175734012 CGGTAAAAGCAGCCAGGAGGGGG - Intronic
966217442 3:177518103-177518125 TGGCAGCGGCAGCAGGGAGCGGG + Intergenic
967596402 3:191329961-191329983 CAGCAGCCCCAGCAAGTAGGTGG + Intronic
967665553 3:192167860-192167882 AGGCAGGAGAATCAAGGAGGTGG - Intronic
968490680 4:889122-889144 AGGCAGCAGGAGCAGGGAGTGGG + Intronic
968509120 4:987606-987628 CGGCAGCAGCAGTAAGACGAGGG - Intronic
968967852 4:3778345-3778367 CAGCAGCAGCAGCTGGGAGCGGG + Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969540349 4:7784640-7784662 CCAGAGCAGCAGGAAGGAGGAGG + Intronic
976513090 4:85932917-85932939 CTGCAGCAAGAGCAAGGTGGCGG - Intronic
976880861 4:89923242-89923264 CAGCAGCAGCAGCAAGGCTGTGG + Exonic
978075804 4:104528122-104528144 AGGCAGCAGGAGCAGGCAGGTGG + Intergenic
978981647 4:114954900-114954922 TGGGAGCAGTAGCAAGGATGTGG - Intronic
979111467 4:116762497-116762519 CATCAGCAGTAGCAAGGAAGTGG + Intergenic
979501013 4:121439829-121439851 CAGCAGCAGCAGCAATGAGCAGG + Intergenic
981287385 4:143034500-143034522 CGATAGCAGGAGCAAGAAGGAGG + Intergenic
982722261 4:158870740-158870762 CTGCAGGAGCAGTGAGGAGGGGG + Intronic
983684694 4:170394570-170394592 CTGCAGCAGCAGACAGCAGGTGG - Intergenic
984459019 4:180009221-180009243 AGGTAGCAGTGGCAAGGAGGTGG + Intergenic
985401130 4:189595177-189595199 AGCCAGCATCAGCAAGAAGGAGG + Intergenic
985761547 5:1751693-1751715 CAGCAGCAGGAGACAGGAGGAGG - Intergenic
985896305 5:2751596-2751618 CGGCGGCAGCAGCGCGGAGCCGG + Exonic
985965485 5:3336196-3336218 GGGCAGCAGCTGCACGGAGCGGG + Intergenic
985996794 5:3601404-3601426 CAGCAGCAGGAGCGGGGAGGGGG - Intergenic
986466925 5:8035000-8035022 CAGCAGCAGCACCAGGGAGGAGG + Intergenic
986713240 5:10502890-10502912 CGACAGCAGGAGCAAAGATGAGG + Intergenic
986719151 5:10547713-10547735 GGTCAGCAGCAGCATGGTGGGGG - Intergenic
987034566 5:14006886-14006908 AGGCAGCAGCAGGAGGCAGGAGG - Intergenic
987035143 5:14011783-14011805 CGGCAGGAGCAGCAAACAGCCGG - Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
989441390 5:41475956-41475978 GGGTAGCAAGAGCAAGGAGGAGG + Intronic
990293511 5:54378827-54378849 CCGCAGCAGCACCCAGGTGGGGG - Intergenic
990448957 5:55917839-55917861 GGGCAGCAGCAGCTGGGAAGTGG - Intronic
992162320 5:74015453-74015475 AGGCACCAGCAGGAAGGTGGAGG - Intergenic
992716333 5:79514307-79514329 AAGCAGCAGCCGCAAGGCGGCGG + Intergenic
995350825 5:111173465-111173487 CAGCAGCAGAAGGAAGGAGATGG + Intergenic
996862646 5:128083682-128083704 CGGCAGCAGCACGCGGGAGGCGG - Intergenic
997393242 5:133533892-133533914 CTGCAGCAGGAGCAAGGACTCGG - Intronic
997878454 5:137569542-137569564 AGGCTGCAGGAGCAAGGAGTGGG + Intronic
997980221 5:138464198-138464220 CGGGAGGAGGAGCGAGGAGGCGG + Intergenic
998261164 5:140632948-140632970 CAGCAGCAGCAGCAACAAGCAGG + Exonic
998405825 5:141874252-141874274 GGGCAGGAGCAGCAATAAGGAGG + Intronic
998799678 5:145856529-145856551 CTGCCCCAGCAGCAAGGGGGCGG + Intergenic
999223555 5:150001037-150001059 TGACAGCAGCAACAAGGAAGTGG - Exonic
999228906 5:150049913-150049935 CAGCAGCAGCAGCTAAGAGCTGG - Intronic
999229649 5:150054161-150054183 CGGCAGCAGCAGCAGTGAGCTGG - Exonic
999244589 5:150147231-150147253 GGGCAGCAGCAGGATGGTGGAGG - Intronic
999325417 5:150640705-150640727 CGGCAGCAACATGAAGGAGCTGG - Intronic
1000213157 5:159128426-159128448 TGGCAGCAGCAACAAGGCTGTGG + Intergenic
1000338579 5:160260125-160260147 CAGCAGCAGCAGCCAGGGGCTGG + Intronic
1001052436 5:168423917-168423939 AGGCATCACCAGCCAGGAGGGGG - Exonic
1001698439 5:173689859-173689881 CGGCTGCAGCAGCGGGCAGGAGG - Intergenic
1002081008 5:176737446-176737468 TCCCAGCAGCAGCAAGGAGCAGG - Intergenic
1002484960 5:179528898-179528920 CAGAACCAGCAGCAAGGAGCAGG - Intergenic
1003115852 6:3283622-3283644 AGGCAGCAGCAGGAGGAAGGGGG - Intronic
1003404530 6:5817453-5817475 TGGCAGCAGCAACAGGGTGGTGG - Intergenic
1003630776 6:7784858-7784880 CTGCAGCCCCAGCAAGGAGGAGG - Intronic
1004215510 6:13700383-13700405 CGGCTGGAGCAGAAAGGAGGTGG - Intronic
1004474385 6:15957602-15957624 AGGCACCAGCAGCAAAGAAGTGG + Intergenic
1005040312 6:21595047-21595069 CGGCGGGAGCAGCAACGCGGGGG + Exonic
1005390090 6:25324154-25324176 TGGCAGCAGCAGACAGGAGAAGG - Intronic
1005500907 6:26428324-26428346 CAGCAGCAGCAGCAAGGACTTGG + Intergenic
1005948314 6:30611667-30611689 CAGCAGCAGAAGCAGGGAGGAGG + Intronic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1006272695 6:32976416-32976438 CTGCAGTAACAGCAAGGAGCGGG - Exonic
1007224778 6:40305317-40305339 GGGGAGCAGCAGCAGGTAGGGGG + Intergenic
1007342581 6:41200982-41201004 CAGCAGCAGCAGGAAGGCTGGGG + Exonic
1007521374 6:42453304-42453326 CGGGAGCAGCTGCGAGCAGGGGG + Intergenic
1007591000 6:43020965-43020987 CAGGAGCAGCTGAAAGGAGGTGG - Exonic
1007593150 6:43035631-43035653 AGGCAGCAGCAGCAGGCTGGGGG - Intergenic
1007811915 6:44492260-44492282 TGGCAGAAGGAGAAAGGAGGTGG - Intergenic
1008031916 6:46706453-46706475 CAGGAGAAGCAGCAAAGAGGTGG + Intronic
1008628633 6:53343138-53343160 CAGCAGCAGCAGCAAGCTGCTGG - Intronic
1008683672 6:53901139-53901161 AGGAAGCAGCAGCAAGCATGAGG + Intronic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008976848 6:57437124-57437146 CAGGAGCAGGAGCAAGGAGAGGG + Intronic
1010687303 6:78867795-78867817 AGTGAGCAGCACCAAGGAGGCGG + Exonic
1010691043 6:78911078-78911100 TGGCAGCAGAAGGAAGGCGGAGG - Intronic
1011153687 6:84304408-84304430 AGGCTGCAGCAGCATGGAGAAGG + Intergenic
1013196399 6:107848434-107848456 CGGCAGCAGGAGAAATGAGCGGG - Intergenic
1013576071 6:111483926-111483948 CTGCAGCAGCAAAGAGGAGGGGG - Intergenic
1014558050 6:122856820-122856842 CCACAGCAGGAGCAAGGTGGTGG + Intergenic
1014736844 6:125103843-125103865 AGGCTGCAGCACCCAGGAGGAGG - Intergenic
1014773582 6:125484187-125484209 GGTCAGCAGAAGTAAGGAGGAGG - Intergenic
1014918840 6:127188088-127188110 AGGCAGCAGAAGCAATGAGGTGG + Intronic
1015107429 6:129553315-129553337 TGGCAACAGAAGCAAGAAGGTGG - Intergenic
1016153076 6:140768332-140768354 CGGGTGCCGCAGCAAGGAGATGG - Intergenic
1017251626 6:152286279-152286301 CAGCAGTAGCAAGAAGGAGGAGG - Intronic
1017251627 6:152286282-152286304 GGACAGCAGTAGCAAGAAGGAGG - Intronic
1017717776 6:157224332-157224354 CTGCTCCAGCAGCGAGGAGGTGG + Intergenic
1018307909 6:162477677-162477699 AGGCCGCAGCAGAGAGGAGGAGG - Intronic
1018837443 6:167496017-167496039 AGGCAGCAGCCGCCGGGAGGCGG - Intergenic
1019126279 6:169842362-169842384 GGGAAGCAGCCGGAAGGAGGGGG - Intergenic
1019343491 7:519183-519205 AGGCAGCGCCAGCCAGGAGGAGG + Exonic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019496772 7:1344420-1344442 CGGGAGCAGGAGAAAGGAGAGGG + Intergenic
1020006824 7:4787837-4787859 GGTCAGGAGCAGCGAGGAGGGGG - Intronic
1020034939 7:4959088-4959110 CGGCGGCAGCAGCAGGTTGGAGG + Exonic
1020347627 7:7182651-7182673 CGGCAGCGGCAGCACAGCGGCGG - Exonic
1020770500 7:12386598-12386620 CAGCAGCTGCAGCAAGCAGCAGG - Intronic
1021827989 7:24573556-24573578 CGGCAGCGGCGGCGCGGAGGCGG + Exonic
1022207656 7:28179926-28179948 CGGCTGCAGCCGCGGGGAGGTGG - Intronic
1023085071 7:36562276-36562298 CAGCAGCAACAGCAAGCAGCTGG - Intronic
1023801501 7:43838968-43838990 CCGCAGTAGGAGCACGGAGGCGG + Intergenic
1023891329 7:44393973-44393995 TGGCAGCAGGAGCTTGGAGGTGG - Intronic
1024059813 7:45689480-45689502 CGAGAGCAGGAGCAAGGGGGTGG + Intronic
1025777321 7:64570440-64570462 CGGCAGAGGCGGCACGGAGGGGG + Intergenic
1026780837 7:73266147-73266169 GGGCCGCAGCTGCAAGGAGAAGG + Intergenic
1027021691 7:74819589-74819611 GGGCCGCAGCTGCAAGGAGAAGG + Exonic
1027066330 7:75126328-75126350 GGGCCGCAGCTGCAAGGAGAAGG - Exonic
1027220570 7:76211296-76211318 TGGCAGGAGCAGAGAGGAGGAGG + Intronic
1027571266 7:79870262-79870284 CGGCTGGAGCAGAAAGAAGGAGG + Intergenic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1029587798 7:101486534-101486556 CGTCAGCAGCTGCAGGGAAGAGG + Intronic
1030544202 7:110872245-110872267 AGGTAGCAGAAGCATGGAGGTGG - Intronic
1031081981 7:117267151-117267173 AGGCAGCAGCAGTAAGGATGGGG + Intergenic
1031362767 7:120866900-120866922 TGAAAGCAGGAGCAAGGAGGTGG - Intergenic
1032386312 7:131527699-131527721 CGGCAGCAGCTGGAGGGAGCTGG + Intronic
1033831927 7:145265387-145265409 GGTCAGCAGCAGCTGGGAGGAGG - Intergenic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1034487152 7:151373168-151373190 CATCAGCAGCAGCGAGGACGGGG - Intronic
1034524625 7:151649702-151649724 CGGGAGCAGGAGCAAGAAGGAGG - Intronic
1035031095 7:155861216-155861238 CTGCAGAAGCAGCAAAGAGCTGG + Intergenic
1035182229 7:157097734-157097756 AGGCAGCAGGTGCTAGGAGGCGG + Intergenic
1035300431 7:157893808-157893830 CAGCACCGGCAGAAAGGAGGAGG + Intronic
1035743908 8:1947792-1947814 GAGCAGCAGCAGTAGGGAGGCGG - Intronic
1036604389 8:10292986-10293008 GTGGAGAAGCAGCAAGGAGGAGG + Intronic
1037805170 8:22054858-22054880 CAGCCGCGGCAGCAGGGAGGGGG - Intronic
1038058442 8:23884963-23884985 AGGCAGCATCATCAAGGATGAGG - Intergenic
1038445327 8:27599858-27599880 CAGCTGCTCCAGCAAGGAGGAGG + Exonic
1038751770 8:30302726-30302748 GTTCAGCAGCAGCATGGAGGAGG - Intergenic
1039879434 8:41615277-41615299 TGGCGGCAGCAGCATGCAGGCGG - Intronic
1039881384 8:41627395-41627417 CCGCAGCAGCAGCCTGGACGAGG - Intergenic
1039912523 8:41836206-41836228 CGGGATCTGCAGCAAGAAGGAGG - Intronic
1040415768 8:47194130-47194152 AGGCAGCTGCAGCACGGAAGTGG - Intergenic
1040422252 8:47251606-47251628 GGGCAGCAACAGCAAGGACTTGG + Intergenic
1041678907 8:60566257-60566279 CTGCAGTAGAAGCAAGGATGAGG - Intronic
1041981497 8:63866404-63866426 GGGCAGGGGCATCAAGGAGGAGG + Intergenic
1042399608 8:68330895-68330917 CGGCAGCAGCAGGAATCAGGGGG - Exonic
1043735154 8:83731516-83731538 AGCCAGCAGGAGCAAGGAGCAGG - Intergenic
1044072377 8:87778387-87778409 TGGCAGCAGCCGTAAGTAGGTGG - Intergenic
1045152947 8:99429702-99429724 AGACAGCAGAAGCAACGAGGTGG - Intronic
1045259502 8:100559736-100559758 CAGCGGCAGCTTCAAGGAGGCGG + Exonic
1045679778 8:104646288-104646310 CTGGAGCAGGAGGAAGGAGGTGG - Intronic
1046398801 8:113676542-113676564 CTGCAGCAGCAGCCAGGCAGGGG - Intergenic
1047407365 8:124596746-124596768 AGTCACCAGCAGCAAGGAGAAGG - Intronic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1047499232 8:125429651-125429673 CTGCAGCCGGAGGAAGGAGGGGG - Intergenic
1048327737 8:133452019-133452041 AGCCATCAGCAGCCAGGAGGAGG - Intergenic
1048979215 8:139694152-139694174 CGGCGGCAGCAGAAAGGGGGTGG + Intronic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1048980908 8:139703138-139703160 CAGCAGCAGCAGCGGGGAGGCGG + Intergenic
1049275031 8:141716061-141716083 CCCCAGCAGTAGGAAGGAGGAGG - Intergenic
1049463575 8:142741044-142741066 CCACAGCAGCAGGAAGCAGGGGG + Exonic
1049544855 8:143225843-143225865 CAGCCGCAGGAGCAAGGAGGTGG + Intergenic
1049585165 8:143429653-143429675 CCGCGGCTTCAGCAAGGAGGAGG - Exonic
1049586584 8:143435265-143435287 GGGCAGCAGGAGCAGGGTGGGGG - Intergenic
1049744813 8:144258810-144258832 CCGCAGCGGCAGCGAGGATGTGG + Exonic
1049774330 8:144397588-144397610 CTTCAGCCCCAGCAAGGAGGAGG - Exonic
1049791080 8:144473029-144473051 CTGCAGCAGCAGCACCGCGGTGG - Exonic
1050087214 9:1978495-1978517 CGGCTTCTGCAGCAAGGAAGTGG + Intergenic
1050301009 9:4259028-4259050 AGGCAGCAGCAGGCAGGAGATGG - Intronic
1052583267 9:30389868-30389890 CATTAGCAGCAGCAAGGTGGTGG - Intergenic
1052872646 9:33523675-33523697 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1052888860 9:33677113-33677135 CGGCTGCAGCTCCAGGGAGGGGG - Intergenic
1053029195 9:34759610-34759632 CAGCAGCAGCTGCAGGGAGCCGG - Intergenic
1053564736 9:39237133-39237155 AGGCACCAGCAGCTAGGAGATGG - Intronic
1053607823 9:39679020-39679042 CTGCAGCAGCAGCAAAAAGGCGG - Intergenic
1053752314 9:41269178-41269200 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1053752764 9:41273435-41273457 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1053830516 9:42075034-42075056 AGGCACCAGCAGCTAGGAGATGG - Intronic
1054132415 9:61381901-61381923 AGGCACCAGCAGCTAGGAGATGG + Intergenic
1054245712 9:62663389-62663411 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054257841 9:62833510-62833532 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1054258289 9:62837787-62837809 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1054333481 9:63782254-63782276 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1054351589 9:64021300-64021322 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1054559837 9:66697920-66697942 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054600044 9:67112421-67112443 AGGCACCAGCAGCTAGGAGATGG + Intergenic
1055286710 9:74736312-74736334 CACCAGCAGCAGTTAGGAGGAGG - Intronic
1056018423 9:82416590-82416612 AGGAAGCAGCAGCAGGAAGGGGG + Intergenic
1056453349 9:86737833-86737855 AGCCAGCTCCAGCAAGGAGGTGG - Intergenic
1056475057 9:86945757-86945779 AAGCAGCAGCAGCAAGATGGAGG + Exonic
1056475116 9:86946002-86946024 CGGCAGCAGCGGCTCGGACGGGG - Exonic
1056579548 9:87880836-87880858 CAGCAGCAGGAGCAAGGGGCTGG + Intergenic
1056782050 9:89557771-89557793 TGGGAGCTGCAGCAAGAAGGTGG - Intergenic
1056814362 9:89791057-89791079 CTGCAGAACCAGCAAGGAGCAGG + Intergenic
1056841361 9:90000220-90000242 CTGCAGGAGCAGCAGGGAGAGGG - Intergenic
1056845878 9:90037688-90037710 CAGCAGCAGCAGGAAGAATGAGG - Intergenic
1058711366 9:107682127-107682149 AGAAAGCAGCAGCCAGGAGGAGG + Intergenic
1059145530 9:111896599-111896621 CGGCAGCGGGAGCGAGGAGCCGG + Intergenic
1060215001 9:121733621-121733643 AGGCAGCAGTAGCCAGGAGAAGG + Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1061291047 9:129650457-129650479 AGGCAGAGGCAGGAAGGAGGGGG + Intergenic
1061293682 9:129666092-129666114 GGGCAGCAGCGGCAGCGAGGCGG + Exonic
1061612396 9:131755822-131755844 CAGCAGCCGGAGCGAGGAGGTGG - Intergenic
1062013696 9:134280634-134280656 GGGCAGCAGGAGCAAGGGAGGGG + Intergenic
1062064187 9:134517547-134517569 CGGGAGCAGCTGCCAGGCGGGGG - Intergenic
1062149614 9:135010942-135010964 CGGAACCAGGAGCATGGAGGAGG - Intergenic
1062181229 9:135192288-135192310 CGGACGGAGCAGCAGGGAGGTGG - Intergenic
1062209490 9:135356036-135356058 TGGCAGGAGCAGCGAGGGGGTGG - Intergenic
1062259780 9:135655780-135655802 CTGCAGAGGCAGCAATGAGGTGG - Intergenic
1062284932 9:135768637-135768659 CCTCAGCAGCAGGAACGAGGTGG + Exonic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1202800484 9_KI270719v1_random:170588-170610 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1202800930 9_KI270719v1_random:174870-174892 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1186962882 X:14756632-14756654 GGGTAACAGGAGCAAGGAGGAGG - Intergenic
1187556308 X:20355584-20355606 CTGCAGCAGCATTAAGGAAGCGG - Intergenic
1189324599 X:40105106-40105128 CGGCGGCGGCGGCGAGGAGGGGG + Intronic
1189324659 X:40105295-40105317 CGGCGGCAGCAGCCAGGGGAGGG + Intronic
1189656657 X:43251529-43251551 CGGCCACAGCAGCCAGGATGTGG + Intergenic
1190237923 X:48631665-48631687 CAGCAGCAGCAGCAGGGAACAGG - Intergenic
1190797223 X:53757229-53757251 CAGCTGTAGCAGGAAGGAGGGGG - Intergenic
1191779815 X:64853607-64853629 CCCCAGCAGCAGCCAGGAGCTGG - Intergenic
1191813895 X:65222170-65222192 CAGCAGCAGCAGCATAGAAGGGG + Intergenic
1192017473 X:67347072-67347094 TGGCAGCAGCAGCTAGTAGGGGG + Intergenic
1192207799 X:69107599-69107621 AGGCAGCAGCAGGAGGGAGAGGG + Intergenic
1194044224 X:88982285-88982307 CGGCCGCAGCTCCAAGCAGGTGG - Intergenic
1194064318 X:89242552-89242574 TGGGAGCAGGAGCAAGGAGTAGG - Intergenic
1195749473 X:108149826-108149848 GAGCAGCAGTAGCAAAGAGGCGG - Intronic
1198667254 X:139038140-139038162 GGGCAGCAGCTGCATGGAGAAGG - Intronic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic
1199612712 X:149631676-149631698 CGGGAGCAGCAGCGTGGACGCGG - Exonic
1199718463 X:150524760-150524782 AGGGAGAAGCAACAAGGAGGAGG - Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200292642 X:154886934-154886956 CGCCAGCAGCTGGCAGGAGGCGG - Exonic
1200339486 X:155382674-155382696 CGCCAGCAGCTGGCAGGAGGCGG - Exonic
1200346984 X:155458019-155458041 CGCCAGCAGCTGGCAGGAGGCGG + Exonic
1200718492 Y:6576651-6576673 TGGGAGCAGGAGCAAGGAGTAGG - Intergenic