ID: 1073535094

View in Genome Browser
Species Human (GRCh38)
Location 10:104269183-104269205
Sequence CGGCGGCAGCAGCAGCAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 7, 3: 87, 4: 550}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535094_1073535107 21 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535094_1073535108 22 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1073535094_1073535104 11 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535094_1073535097 -8 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535094_1073535102 8 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535094 Original CRISPR CGGCGGCAGCAGCAGCAAGG AGG (reversed) Exonic
900408780 1:2503720-2503742 GGGCCCCAGCAGCAGCAGGGTGG + Intronic
900431613 1:2605554-2605576 CGGCGGCAGCAACCGGAAGGTGG - Exonic
901025018 1:6274566-6274588 GGGCAGCAGCAGAAGCGAGGTGG + Intronic
901223238 1:7596010-7596032 CGGCTTCAGCAACAGCAAGCTGG + Intronic
901668097 1:10837885-10837907 CGGGGGTAGCAGCTGGAAGGAGG + Intergenic
901683541 1:10930278-10930300 GGGCGGCAGCAGCAGCAGAAGGG + Intergenic
902091885 1:13910159-13910181 TCGCCGCAGCAGCATCAAGGAGG - Intergenic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902585850 1:17438352-17438374 CGGCGGCAGCAGCGGCGACGAGG - Exonic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902950985 1:19882645-19882667 CGGCGGCGGCGGCTGCGAGGAGG + Exonic
903057384 1:20645616-20645638 CAGCTGCAGCAGCATCATGGCGG - Exonic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903398299 1:23019634-23019656 CGGCTGCAGCGGCAGCAACCGGG + Exonic
903652323 1:24929781-24929803 CGGCGGCGGCGGCGGCAAGATGG - Exonic
903770137 1:25758616-25758638 CGGCAGCAGCAGCATCTTGGCGG + Exonic
903907489 1:26696775-26696797 CGGTGGCGGCAGCAGCGATGGGG + Exonic
904365824 1:30010427-30010449 TGGCTGCAGCAGCACCCAGGAGG + Intergenic
904642018 1:31938178-31938200 CCGCAGCAGCAGCAGCAAGACGG - Exonic
904720067 1:32500838-32500860 CGGCGGCGGCGGCGGGAAGGCGG + Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905172090 1:36115367-36115389 CGGCAGCAGCGGCAGCAGGAGGG + Intronic
905264837 1:36744467-36744489 CGGCAGAAGCAGCAGAAAGTTGG + Intergenic
905433811 1:37943450-37943472 AGACGGAAACAGCAGCAAGGAGG + Intronic
905441319 1:37997959-37997981 CTGCGCCCGCTGCAGCAAGGTGG - Exonic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906476626 1:46173637-46173659 CAGAGGCAGCAGCAGCCAGAGGG - Intronic
906961415 1:50421468-50421490 CGGCGGCGGCAACAGCGACGGGG - Exonic
907761706 1:57367919-57367941 CGGCTGCAGCTGCACCCAGGAGG - Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
910351437 1:86303401-86303423 CAGCTGCAGCAGCAGGAAGCTGG - Intergenic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
912264017 1:108137247-108137269 AGGAGGCAGCAGCAGCACTGTGG - Intronic
915030398 1:152875288-152875310 CTGCTGCAGGAACAGCAAGGAGG + Intergenic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915200117 1:154221012-154221034 CGGCGGCAGCGGCAGCGCGGCGG + Intronic
915325303 1:155078857-155078879 CGGCGGCGGCAGCAGGGAGCTGG + Exonic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915393156 1:155562439-155562461 CGGCGGCAGCAGCAGAGTGGCGG + Exonic
915517178 1:156420430-156420452 AGGCGGCGACAGCAGCCAGGAGG - Intronic
915528902 1:156492178-156492200 GGGCGGCAGCAGCAGGAGGGAGG + Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
919678382 1:200409588-200409610 CGGCGGCAGCAGCGGCAGGAGGG - Exonic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920631435 1:207656663-207656685 TGGCAGGAGCAGGAGCAAGGTGG + Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921934895 1:220787089-220787111 CGGCGGCTGCTGCAGCAGGTGGG + Exonic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923318577 1:232805790-232805812 GGGCAGCTGCAGCAGCAAGGTGG - Exonic
923732927 1:236570477-236570499 CGGTGGCAGCGGCAGGGAGGAGG + Intronic
924579369 1:245310721-245310743 TGCAGGCAGCAGCAGCAACGCGG + Intronic
1062816713 10:506354-506376 TTGGGACAGCAGCAGCAAGGGGG + Intronic
1064229064 10:13513806-13513828 GGGCTGGAGCAACAGCAAGGAGG - Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067421725 10:46158030-46158052 CTGCTGCAGCACCAGCTAGGTGG - Intergenic
1067507031 10:46864119-46864141 CTGCTGCAGCACCAGCTAGGTGG - Intergenic
1067774946 10:49156685-49156707 GGGCAGCAACAGCAGGAAGGCGG + Intronic
1067849580 10:49746162-49746184 CGGCAGCAGCACCAGCCGGGTGG + Intronic
1068090794 10:52430215-52430237 CGGCAGCATCAGCAGCAAGTGGG + Intergenic
1068130494 10:52889819-52889841 TGGCTGCAGCAGCACCAGGGAGG - Intergenic
1068393228 10:56425926-56425948 CTGCTGCAGCACCAGCTAGGTGG + Intergenic
1068910525 10:62374436-62374458 CAGCAGCAGCAGCAACAAGTCGG + Exonic
1070570642 10:77637722-77637744 CGGCAGCAGTAGCAGCAATATGG - Intronic
1070859203 10:79637172-79637194 CTGCTGCAGCACCAGCTAGGTGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071695404 10:87863987-87864009 CGGCGGCTGCAGCTCCAGGGAGG + Exonic
1072577020 10:96709730-96709752 CTGCAGCAGGGGCAGCAAGGCGG + Exonic
1073535093 10:104269180-104269202 CGGCAGCAGCAGCAAGGAGGCGG - Exonic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1073579887 10:104655782-104655804 CGGAAGAAGCAGGAGCAAGGCGG - Intronic
1074731356 10:116379869-116379891 CGGTGGCAGCAGGAGCAAAGTGG - Exonic
1074854500 10:117463467-117463489 AGGTGGCAGCAGCTGCATGGGGG + Intergenic
1075768900 10:124917086-124917108 CGGAGGCGGCAGCAGCGGGGCGG + Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1076948608 10:133667042-133667064 CTGCGGCAGGTGCAGCCAGGAGG - Exonic
1076949592 10:133670341-133670363 CTGCGGCAGGTGCAGCCAGGAGG - Intronic
1076950576 10:133673640-133673662 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076951566 10:133676950-133676972 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076952556 10:133680260-133680282 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076953539 10:133683559-133683581 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076955512 10:133743221-133743243 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076956502 10:133746531-133746553 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076957490 10:133749840-133749862 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076958474 10:133753139-133753161 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076959463 10:133756449-133756471 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076960447 10:133759748-133759770 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1077103683 11:832976-832998 CGGCGGCGGCAGCAGCTGCGGGG - Exonic
1077251922 11:1564529-1564551 CGGAGGCAGCAGCTGGAAGCTGG + Intronic
1077342864 11:2033713-2033735 TGGGGGCAGCACCAGCAGGGTGG + Intergenic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1081000476 11:37664234-37664256 AGGAGGCAGCAGAGGCAAGGTGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081883267 11:46472148-46472170 CGGTCACAGCAGCAGTAAGGAGG - Intronic
1083329626 11:61891496-61891518 CGGCGGCCGCGGCGGCAGGGCGG - Exonic
1083674568 11:64318289-64318311 CTGCGGCAGCGGCAGCAAGACGG + Exonic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084891722 11:72240016-72240038 AGGCGGCGGCGGCAGCGAGGCGG + Exonic
1085857197 11:80188499-80188521 TGGAGGCAGCAGCAGCACTGAGG - Intergenic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1088822569 11:113469174-113469196 GGGCGGCAGGAGCAGGAGGGAGG - Intronic
1090396842 11:126424705-126424727 CGTCAGCAGCAGCGGCAAGCAGG - Exonic
1090914832 11:131154240-131154262 CAGCGGCACCAGCAGCACCGGGG - Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091248882 11:134124930-134124952 CGGCGGTGGCAGGAGCGAGGAGG + Intronic
1202825850 11_KI270721v1_random:88902-88924 TGGGGGCAGCACCAGCAGGGTGG + Intergenic
1091558602 12:1594208-1594230 CGGCGGCCGGAGCCGGAAGGCGG - Intronic
1092418308 12:8308801-8308823 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
1092537402 12:9402951-9402973 CGGAGGCACCCGCAGCGAGGCGG + Intergenic
1092821513 12:12357418-12357440 CGGTGGCAGCAGAAGAACGGCGG - Exonic
1093465040 12:19440128-19440150 CGCCGCCAGCAGCAGCAGCGGGG + Exonic
1094514046 12:31117769-31117791 CGGAGGCACCCGCAGCGAGGCGG + Intergenic
1095401358 12:41818081-41818103 GGGCAGGAGCAGGAGCAAGGGGG - Intergenic
1097794072 12:63844025-63844047 TGGGGGCAGCAGCGGAAAGGGGG + Intergenic
1098597989 12:72295228-72295250 GGGCGGCTGCAGCAGCACTGGGG + Intronic
1098991215 12:77066011-77066033 TGGCGGCAGCAGCATCCAGAGGG - Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101981008 12:109406893-109406915 GGGAGGCAGCAGCAGCAGGGAGG - Intronic
1102471939 12:113164155-113164177 GGGCGGCAGGAGCAGCAGGAGGG - Exonic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103308952 12:119989476-119989498 CAGCGGCAGCGGCAACAGGGCGG + Intergenic
1103800357 12:123533738-123533760 CGGCGGCGGCGGCAGCGGGGAGG + Intergenic
1104001663 12:124864059-124864081 TGGGGGCAGCGGCAGCATGGCGG - Intronic
1104639843 12:130460299-130460321 TGCCGTCAGCAGCAGCAAAGCGG + Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1106597801 13:31161636-31161658 CGGCGGCAGGAGAAGCAGGCAGG - Exonic
1106623815 13:31398014-31398036 TGGTGGAAGCAGGAGCAAGGCGG - Intergenic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107881586 13:44836856-44836878 CTGACGCAGGAGCAGCAAGGAGG - Intergenic
1107994983 13:45850805-45850827 CGGCGGCAGCAGCTAGAAGCTGG + Intronic
1108017143 13:46087232-46087254 CGGAGCCAGCAGAAGCCAGGAGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1109274628 13:60290254-60290276 CAGCGTCAGCAGCAGCAACCAGG - Intergenic
1109419750 13:62096066-62096088 CGGAGCCAGCAGCAGCAACCTGG - Intergenic
1110291560 13:73813622-73813644 CTCTGGCAGCAGAAGCAAGGAGG - Intronic
1112091797 13:96090809-96090831 CGGCGGCGGCGGCGGCAGGGCGG - Intergenic
1113378628 13:109784805-109784827 CGGCGGCCGCGGGAGCAAGGTGG - Exonic
1113803272 13:113097135-113097157 CAGAGGCAGAAGCAGCACGGTGG - Intronic
1114259119 14:21025021-21025043 CCGCGGCGGCAGCAGGTAGGGGG - Intronic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1115399311 14:32939394-32939416 CGGCGGGAGCAGCGGCCCGGCGG - Intronic
1116441784 14:44962435-44962457 CGGCAGCAGAAGCAGCGCGGAGG - Exonic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117602713 14:57391107-57391129 CGGCGGCAGCAGGAGCCCGGCGG + Exonic
1119821054 14:77616545-77616567 CGGCGGCAGCAGCAGCCTCCGGG + Exonic
1120388519 14:83876299-83876321 TGGCAGAAGCAGAAGCAAGGTGG - Intergenic
1120746172 14:88153845-88153867 AGGAGGCAGGAGCAGGAAGGAGG + Intergenic
1120758327 14:88264867-88264889 CGGCATCAACAGGAGCAAGGGGG - Intronic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121464993 14:94110083-94110105 GTGTGGCAGGAGCAGCAAGGGGG - Intronic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1121758679 14:96424268-96424290 CGGCGGCAGCGGCGACACGGGGG + Intronic
1122618859 14:103041679-103041701 CGGCCGCAGCTGCAGCTTGGAGG + Intronic
1122672856 14:103385448-103385470 CGGCGGCAGCGGCGGCCAGCAGG + Intronic
1122794902 14:104201220-104201242 CCTCGGCAGCACCAGCCAGGAGG - Intergenic
1122871326 14:104640409-104640431 CGGGGGCAGCTGCAGCAGAGGGG - Intergenic
1123014474 14:105367251-105367273 CCTCTGCAGCAGCATCAAGGAGG + Exonic
1123017662 14:105383083-105383105 GGGCGGGAGCAGCAGCCTGGTGG + Intronic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1202851517 14_GL000225v1_random:23256-23278 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1202852401 14_GL000225v1_random:29959-29981 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1202859691 14_GL000225v1_random:73314-73336 TTGCGGCAGGAGCAGCCAGGAGG + Intergenic
1123970431 15:25503459-25503481 CCGAGCCAGCAGCAGCAAGTGGG - Intergenic
1125434326 15:39629017-39629039 CAGCAGCAGCAGCAGCCAGATGG + Intronic
1125516472 15:40323877-40323899 CGGCGGCGGCTGCAGCAACGCGG + Intergenic
1125516473 15:40323880-40323902 CGGCGGCTGCAGCAACGCGGTGG + Intergenic
1127003157 15:54534072-54534094 TGGTGGCAGCAGCAGCACAGTGG - Intronic
1127294819 15:57599878-57599900 CTGCTTCAGGAGCAGCAAGGGGG - Intronic
1129199864 15:73992298-73992320 AGCCGGAAGCAGCAGCCAGGAGG - Exonic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129539883 15:76340863-76340885 CGTCGGCAGCTGCAGAAAGGTGG + Intronic
1129572172 15:76699906-76699928 CGGTGCCAGTAGCAGCATGGTGG + Intronic
1129799869 15:78405796-78405818 CGGCTGCAGCTGCACCCAGGAGG - Intergenic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1130224237 15:82045633-82045655 CGGCGGCGGCAGCAGCGGAGGGG - Exonic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131589566 15:93733726-93733748 TGGCTGCAGCAGCAGGAAGCTGG + Intergenic
1132087576 15:98920990-98921012 GCGCGGCAGCAGCAGCAGAGAGG - Intronic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1132645497 16:997529-997551 CAGCGGCAGGAGCGGCAGGGAGG + Intergenic
1132845723 16:2000003-2000025 CAGCAGCAGTAGCAGCAAGAAGG - Exonic
1132885644 16:2180929-2180951 CGGCGGCAGCAGCTGCGGGGTGG + Exonic
1133002408 16:2858027-2858049 CGACGCCAGCAGCAGCAGGGAGG + Exonic
1133784313 16:8963248-8963270 CAGCAGCAGCAGCAGAAAGCGGG - Exonic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134163979 16:11915642-11915664 CGGCAGCAGCAGCAGCGACTCGG - Exonic
1134438890 16:14285789-14285811 CGCCGGCCGCAGCAGGGAGGGGG + Intergenic
1134783190 16:16917357-16917379 CCGGGTCAGCAGCACCAAGGTGG - Intergenic
1135574020 16:23571237-23571259 CACAGGCAGCAGCAGCACGGCGG - Exonic
1135979770 16:27138804-27138826 CGGCGGCAGCAGCGGTGTGGTGG + Intergenic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136033869 16:27523815-27523837 CAGCCGCAGCAGCAGAGAGGTGG + Intronic
1136153020 16:28364637-28364659 CGGCGGCGGCCGGAGCAGGGTGG + Intergenic
1136210063 16:28750636-28750658 CGGCGGCGGCCGGAGCAGGGTGG - Intergenic
1136269418 16:29139680-29139702 CCGCAGCAGCAGCAGCACGTTGG - Intergenic
1136381600 16:29898645-29898667 CGGAGGCGGCAGAAGCATGGAGG - Intronic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136631255 16:31490411-31490433 AGGCAGCGGCAGCAGCCAGGCGG + Exonic
1137426569 16:48385374-48385396 CGGCGGCGGCGGCGGCCAGGGGG - Intronic
1137714812 16:50592214-50592236 CGGCGGCAGCAGCAACGCGCTGG - Intronic
1139519433 16:67472110-67472132 AGGCAGCAGCAGCAGCAAGCTGG + Intronic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1141700682 16:85640694-85640716 CCGAGGCAGCGGCAGAAAGGGGG - Intronic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141950028 16:87334129-87334151 CGCCAGGAGCAGCAGGAAGGCGG - Exonic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142605504 17:1078940-1078962 GTGCGGCAGCATCAGCAAGGTGG - Intronic
1142814736 17:2416247-2416269 CCGCGGCTTCAGCAGAAAGGAGG + Exonic
1142849384 17:2696897-2696919 CTGCTGCATCAGCTGCAAGGCGG + Exonic
1143097723 17:4487383-4487405 TGGCTGCAGCAGAAGCAAGAGGG + Intronic
1143452138 17:7042636-7042658 GGGCGCCAGGAGCAGCGAGGAGG + Exonic
1143498421 17:7325297-7325319 GGGCGGCAGGGGCAGCACGGCGG + Exonic
1143712326 17:8743533-8743555 AGGAGTCAGCAGAAGCAAGGAGG + Intronic
1143739566 17:8942384-8942406 TGGGGGCAGGAGCTGCAAGGAGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144460995 17:15458525-15458547 GGGCGGCAGCAGAGGCAAGTCGG + Intronic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144646874 17:16981111-16981133 GGGCAGCAGCAGGGGCAAGGCGG - Intergenic
1144714612 17:17425245-17425267 CGCCGGCTGCTGCAGCAGGGCGG - Intergenic
1144761141 17:17708145-17708167 GGGTGGCAGCAGGAGGAAGGAGG - Intronic
1144840505 17:18183098-18183120 CGGCGGCAGCGGCGGCAGGCTGG + Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145243627 17:21253420-21253442 CGGCGGCGGCAGCAACAAAAAGG + Intergenic
1145266720 17:21383203-21383225 CGGCTGCAGCTGGAGCAAGCGGG - Intronic
1146896593 17:36545667-36545689 CGGCGGCGGCGGCAGCTGGGAGG + Exonic
1146896594 17:36545670-36545692 CGGCGGCGGCAGCTGGGAGGAGG + Exonic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147425443 17:40343937-40343959 GGGCGGGAGCAGGCGCAAGGGGG + Intronic
1147671875 17:42181063-42181085 CAGCGGCAGCGGCAGTAAGAGGG - Exonic
1147719799 17:42532093-42532115 CGGCCGCAGCAGCAGCAAAACGG + Intergenic
1147719836 17:42532248-42532270 CGGCGGCGGCGGGAGCGAGGAGG - Intergenic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1147988597 17:44320233-44320255 CCTCCGCAGCAGCAGCCAGGTGG + Exonic
1148021648 17:44557584-44557606 AGGCGGCAGCCGCAGCGAGGAGG + Exonic
1148027798 17:44600401-44600423 ATGGGGCATCAGCAGCAAGGAGG - Intergenic
1148770083 17:50061444-50061466 GGGCAGCAGCAGCAACAAGGGGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1148850761 17:50553990-50554012 CAGAGGCATCAGCAGCGAGGAGG + Intronic
1149661278 17:58335266-58335288 CGGGGGCGGCAGGAACAAGGTGG + Intergenic
1150423166 17:65056590-65056612 CGGCGGCGGCGGCGGCAAGATGG - Exonic
1151878156 17:76879024-76879046 AGGCTGCAGCAGCAGCATGGTGG - Intronic
1151905259 17:77043908-77043930 TGGCAGGAGCAGGAGCAAGGAGG + Intergenic
1152070465 17:78131581-78131603 CCGCGGCAGCAGCATCTCGGCGG - Exonic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152759061 17:82098799-82098821 CGGCGGCAGCAGCAACCAATCGG + Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153988257 18:10372490-10372512 AGGTGGCAGCAGAAGCCAGGGGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1155054564 18:22172026-22172048 CGGCGGCGGCAGTAGCCTGGCGG + Exonic
1155126409 18:22880845-22880867 CGGCAGCAGCAGCAGGCAGCAGG + Intronic
1155248026 18:23929180-23929202 CAGCAGCAGCAGCAGCTAGTTGG + Intronic
1157732975 18:50020665-50020687 AGGTGGCAGCAGCAACCAGGTGG + Intronic
1158570928 18:58596475-58596497 CGGCTGCTGCAGCAGCCAGATGG - Intronic
1159040577 18:63320040-63320062 CGGCGGCGGCGGCAGCGCGGCGG + Exonic
1159079692 18:63723251-63723273 CGGAGGCAGCAGCAGCCACTGGG + Exonic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160427871 18:78790689-78790711 CGCCGGGAGCACCAGAAAGGTGG + Intergenic
1160844054 19:1158958-1158980 CGGCGGTTGCAGCTGCAAGTGGG - Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161063471 19:2226664-2226686 CGAGGGCAGCCGCGGCAAGGAGG + Exonic
1161252157 19:3286004-3286026 CTGCAGCAGCAGCAGCGAGAAGG + Exonic
1161487559 19:4544003-4544025 GGGCGCCAGCAGCAGGAGGGAGG + Exonic
1162461765 19:10817838-10817860 TGCCGGCAGCACCAGGAAGGCGG + Intronic
1163847595 19:19646342-19646364 GAGGGGCTGCAGCAGCAAGGCGG + Exonic
1163864181 19:19758366-19758388 TGGCTGCAGCAGCAGCTAGAGGG + Intergenic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164754424 19:30679387-30679409 TGGCTGCAGCAGAAACAAGGTGG + Intronic
1164758037 19:30704839-30704861 TGAAGGCAGCAGCAGCAAGAGGG - Intronic
1165129270 19:33622022-33622044 CGGCGGCGGCAGCAGGAGGTGGG + Intronic
1166081196 19:40444830-40444852 GGGCGGGAGGGGCAGCAAGGGGG - Intergenic
1166218854 19:41353015-41353037 CGGCAGCAGCCGCAGCCCGGAGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166996668 19:46722801-46722823 CCGGGGCAGCAGCGGTAAGGGGG - Exonic
1167258239 19:48443477-48443499 CGGCGGCAGCAGCTCCAGGCTGG - Exonic
1167384987 19:49157851-49157873 CGGCGGCCGCGGCAGCATGGTGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167447170 19:49544405-49544427 GTGTGGCAGCATCAGCAAGGAGG + Intronic
1167468395 19:49662334-49662356 CAGCGGCAGCAGCGGCATGAAGG + Intronic
1167995099 19:53395559-53395581 CGGCGGCCCCAGCCCCAAGGAGG + Intronic
1168346231 19:55651423-55651445 AGGCGGCAGAAGCAGAAGGGAGG + Exonic
925128897 2:1480789-1480811 CGGATGCAGCAGGAGGAAGGTGG - Intronic
925195867 2:1925302-1925324 TGGCTGTAGAAGCAGCAAGGAGG - Intronic
926189954 2:10721283-10721305 CGGCGGCCGCAGCGGGAGGGCGG + Intergenic
926251075 2:11155722-11155744 AGCCGGCAGCAGCTGCGAGGGGG - Intronic
926907097 2:17816136-17816158 CTGGGGCATCCGCAGCAAGGAGG - Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931243215 2:60471007-60471029 CCACGGCAGGAGCAGCAGGGGGG - Intronic
932827932 2:74958687-74958709 CGGCGGCGGCGGCAGGAAGCGGG + Exonic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
934564649 2:95331579-95331601 CGCAGGCAGCGGGAGCAAGGAGG - Intronic
934926554 2:98385845-98385867 CGGCAGGAGCAGGAGGAAGGTGG + Intronic
935112313 2:100104783-100104805 CGGCGGCTGCAGCAGCGGGCCGG - Intronic
936047890 2:109200995-109201017 GGGCAGCAGCAGCAGCTAAGTGG + Intronic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937844085 2:126558232-126558254 CGGCGGCGGCAGCAGCGGCGAGG + Intergenic
937922133 2:127138124-127138146 CGGGGGCAGGGGCAGCAGGGTGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
940421004 2:153478872-153478894 CGGCGGCTGCAGCGGCGGGGTGG + Intergenic
940775003 2:157876071-157876093 CGGCGGCAGCGGCAGCCACCCGG + Intergenic
941588503 2:167389490-167389512 CAGCGGTAGCATCAGCAAGTTGG - Intergenic
942241409 2:173965827-173965849 CGGCCGCAGCAGCAGCCCCGGGG - Intergenic
942450903 2:176107589-176107611 CGGCGGCGGCGGCAGCGCGGGGG + Exonic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943211469 2:184972982-184973004 CGGGGCCAGCAGCAGCAACCTGG - Intergenic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945270245 2:207930994-207931016 CTGCCGCAGCCGCAGCACGGCGG + Exonic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946664828 2:222037569-222037591 CTGAGGCAGAAACAGCAAGGAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947452256 2:230219788-230219810 TCGCGGCAGCAGCTGCAGGGTGG - Intronic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
948107667 2:235428160-235428182 CGGGGGCAGGATCAGCAGGGAGG + Intergenic
948433503 2:237936033-237936055 CGACTGCAGCACCAGCAAGCAGG - Intergenic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
949037267 2:241821591-241821613 TGGCGAAAGCAGCAGCAAGGTGG - Intergenic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1169139425 20:3218641-3218663 CGGCGGGAACTGCATCAAGGTGG - Intronic
1169276465 20:4236542-4236564 CGAGGGCAGAAGCAGAAAGGTGG + Intronic
1170629726 20:18056788-18056810 CAGCGGCAGCAGCAGCGCGGGGG - Exonic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1171123103 20:22582395-22582417 CGCCGGCAGCGGCAAGAAGGCGG - Exonic
1171237039 20:23535404-23535426 CGCCGGCTGCAGCAGGAAAGTGG - Intergenic
1171847145 20:30284084-30284106 CGGCGGCAGCAGGAGCATCGCGG + Intergenic
1173565953 20:44038928-44038950 CGGAGGCAGCAGGAACGAGGCGG - Intronic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1175215895 20:57391577-57391599 CGCGGGCTGCAGCAGCATGGGGG - Exonic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1175954813 20:62603845-62603867 GGGGGGCAGCAGCAGCGGGGTGG - Intergenic
1175956733 20:62614474-62614496 AGGAGGCAGAAGCAGCAGGGTGG + Intergenic
1176093404 20:63328865-63328887 CGGAGGAAGCAGCAGCCAGGAGG - Intronic
1176145556 20:63563846-63563868 CGGGGCCACCAGCAGCAGGGCGG - Exonic
1176281533 20:64316491-64316513 CGGCGGCAGGAGCGGCATCGCGG + Intergenic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176679400 21:9811376-9811398 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176679684 21:9812783-9812805 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176679974 21:9814193-9814215 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176680256 21:9815602-9815624 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176680538 21:9817011-9817033 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176681108 21:9819823-9819845 TGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176681390 21:9821242-9821264 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176681679 21:9822651-9822673 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176681955 21:9824060-9824082 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176682236 21:9825461-9825483 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176682515 21:9826870-9826892 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176682793 21:9828289-9828311 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176683073 21:9829686-9829708 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176683352 21:9831096-9831118 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176683632 21:9832505-9832527 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176683911 21:9833908-9833930 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176684189 21:9835317-9835339 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176684469 21:9836718-9836740 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176684753 21:9838120-9838142 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1178319994 21:31597904-31597926 CGGCGGCAGCAGCAGCTGCAAGG + Intergenic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180014715 21:45074616-45074638 CGGCGGCAGCGGCGGCCAAGCGG + Intronic
1180045400 21:45302833-45302855 GGGCTCCAGCAGCAGCCAGGCGG - Intergenic
1180064342 21:45405144-45405166 CGGCGGCGGCTGCAGCGCGGCGG + Intronic
1180614872 22:17120598-17120620 CAGCCGCAGCAGCAGCAACACGG + Exonic
1180625767 22:17192424-17192446 CAGGTGCAGCAGCTGCAAGGCGG + Intronic
1181171931 22:21014838-21014860 TGAGGGCAGCAGCAGCAGGGCGG - Intronic
1181175490 22:21032526-21032548 CGGCTGCGGCAGCAGCAGGTGGG - Exonic
1181463042 22:23096554-23096576 CTGAGGCAGCTCCAGCAAGGTGG + Intronic
1181478026 22:23180576-23180598 CGGCGGCGGCGGCGGCACGGCGG + Exonic
1181490952 22:23260537-23260559 TGGCTGCAGCAGAAGCCAGGTGG + Intronic
1181725136 22:24806237-24806259 CGGCTGCAGCAGCAGCGCCGCGG + Intronic
1182786427 22:32911547-32911569 GGGGGGCAGCAGGAGCATGGAGG + Intronic
1183015876 22:34986175-34986197 CAGATGCAGGAGCAGCAAGGTGG - Intergenic
1183247220 22:36703249-36703271 CGGCGGCGGCGGCGGCAGGGCGG + Exonic
1183359015 22:37373773-37373795 AGGCGGCAGCAGCTGCAGGGAGG + Exonic
1183581464 22:38728999-38729021 CGGGGGCAGCAGCAGCGTGCTGG + Intronic
1183982428 22:41549469-41549491 CGGAGGCAGGACCAGGAAGGAGG + Intergenic
1184379955 22:44139062-44139084 AGGCGGCAGCGGAAGCAATGGGG - Intronic
1184547894 22:45184684-45184706 CGGTGGAAGCAGCAGCAACTTGG - Exonic
1184650941 22:45919228-45919250 CGGCGGCAGCAGCGGCACGCCGG - Intergenic
1184662580 22:45972220-45972242 CGGCGACAGTAGAAGCATGGTGG + Intronic
1184913203 22:47549748-47549770 TGGCAGCAACAGCAGGAAGGTGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1184937610 22:47736444-47736466 AGGCCCCAGCAGCAGCAGGGAGG + Intergenic
1185173218 22:49305345-49305367 AGGCGGCAGCAGCCACCAGGGGG - Intergenic
949892802 3:8745825-8745847 GGTCTGCAGCAGCATCAAGGTGG + Exonic
950695945 3:14701267-14701289 AGGCTTCACCAGCAGCAAGGAGG + Intronic
952420026 3:33122269-33122291 GGGCAGCAGCAGCAGCAAGAAGG - Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953993037 3:47498544-47498566 TGGCTGTAGCAGCAGCAGGGAGG - Intronic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954540878 3:51392260-51392282 CGGCGGCAGCAGCGGCATCCAGG - Exonic
954615556 3:51967347-51967369 CGGCGGCGGCGGCGGCACGGCGG + Exonic
954781838 3:53067701-53067723 GGGAGGGAGCAGCTGCAAGGAGG + Intronic
954868847 3:53751586-53751608 TGGTGCCAGCAGCAGGAAGGGGG + Intronic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956417863 3:69052107-69052129 TGGCGGCGGCAGCACCAAGCGGG + Exonic
957427149 3:80052463-80052485 CGCCGGCTGCTGCAGCAAGGTGG - Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960868929 3:122230343-122230365 TGGCGGCAGCGTCAGCAAGGAGG - Intronic
961028877 3:123584992-123585014 CGGCGACTGCAGCAGCGAAGGGG - Exonic
961895992 3:130168015-130168037 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962722319 3:138187521-138187543 CGGCGCCTGCAGCAGCCGGGTGG + Exonic
963040487 3:141066356-141066378 CGACGGCATCCGCGGCAAGGTGG + Exonic
963150863 3:142044204-142044226 CGGCGGCGGCAGCAGCAAAAGGG + Intronic
963312596 3:143725002-143725024 TGGGGGCAGGAGCAGGAAGGAGG - Intronic
965550461 3:169959780-169959802 GGGCAGCAGCAGCAGGAAGATGG - Intergenic
965757224 3:172039658-172039680 CGGCGGCGGGAGCAGCGAAGGGG + Intronic
966852069 3:184170595-184170617 CGGGGGCATCATCAGCATGGGGG - Exonic
966905783 3:184525326-184525348 CCGCGCCCTCAGCAGCAAGGCGG - Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967170099 3:186816474-186816496 TGGCGAAAGCAGCAGCAAGGGGG + Intergenic
967170578 3:186820203-186820225 AGGCAGCAGCAGTAGCATGGTGG + Intergenic
967610461 3:191499851-191499873 CTGCAGCAGCAGCTCCAAGGAGG - Intergenic
968006884 3:195249155-195249177 GTGCGGCACCAGCAGCCAGGGGG + Intronic
968515126 4:1012499-1012521 CGGCAGCAGGAGCAGCAACAGGG - Exonic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969396702 4:6926316-6926338 CGGCGGCAGAAAGAGCAACGTGG - Intronic
969532973 4:7739890-7739912 CCCCGGCATCGGCAGCAAGGGGG - Intronic
969746776 4:9078951-9078973 CGGCGGCAGCAGCAGCTGGAGGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
976734636 4:88297073-88297095 CAGCAGCGGCTGCAGCAAGGAGG - Intergenic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
979565742 4:122152480-122152502 CGACGGCAGCAGCACCGAGCCGG - Exonic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984734824 4:183099230-183099252 CGGAGGCAGCGGCGGCGAGGGGG + Intergenic
985446313 4:190022752-190022774 CTGCGGCAGGTGCAGCCAGGAGG + Intergenic
985452060 4:190067826-190067848 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985453045 4:190071123-190071145 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985454034 4:190074416-190074438 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985455022 4:190077709-190077731 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985456011 4:190081009-190081031 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985456994 4:190084303-190084325 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985457981 4:190087596-190087618 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985458970 4:190090896-190090918 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985463223 4:190173665-190173687 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985629985 5:1009165-1009187 CGGCGGCGGCTGCGGCACGGCGG - Exonic
985674651 5:1224736-1224758 TGGCGGGAGCATCTGCAAGGAGG + Exonic
986027545 5:3865013-3865035 CGGCTGCAACAGCAGCATGACGG + Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
990529277 5:56657696-56657718 AGGCAGAAGCAGGAGCAAGGAGG + Intergenic
992162321 5:74015456-74015478 GGGAGGCACCAGCAGGAAGGTGG - Intergenic
992826507 5:80554656-80554678 GGGAGGCAGGAGGAGCAAGGGGG + Intergenic
994072821 5:95620835-95620857 CGGCGGCGGCAGCGGCGAGGGGG - Exonic
995052747 5:107724809-107724831 CAGCAGCAGCAGCAGAAAGTGGG + Intergenic
995224710 5:109689806-109689828 CGGCGGCGGCAGCAGCACGAAGG + Exonic
995375786 5:111472786-111472808 CGGTTGCAGCAGGAGCTAGGAGG - Intronic
996249951 5:121317365-121317387 TGCTAGCAGCAGCAGCAAGGTGG + Intergenic
997118278 5:131149044-131149066 CAGTGGCAGCAGCATCAAGTTGG - Intergenic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998261164 5:140632948-140632970 CAGCAGCAGCAGCAACAAGCAGG + Exonic
999229649 5:150054161-150054183 CGGCAGCAGCAGCAGTGAGCTGG - Exonic
999269493 5:150288605-150288627 CTGAGGCAGCAGGAGCACGGGGG - Intronic
999383417 5:151137693-151137715 TGGTGGGAGCAGGAGCAAGGCGG - Intronic
1001698439 5:173689859-173689881 CGGCTGCAGCAGCGGGCAGGAGG - Intergenic
1001707392 5:173751335-173751357 CGGGGGCAGAACCAGCCAGGGGG - Intergenic
1001906731 5:175479008-175479030 CGGGGGCAGCGGCAGCCAGGTGG + Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002632703 5:180591610-180591632 CGCCGGCCGCAGCAGGAAGTTGG - Intergenic
1002644464 5:180646349-180646371 CGGCAGTGCCAGCAGCAAGGAGG - Intronic
1003115852 6:3283622-3283644 AGGCAGCAGCAGGAGGAAGGGGG - Intronic
1003202832 6:3978055-3978077 CGGTGGCAGGGGCAGCAAGGCGG + Intergenic
1004004460 6:11626411-11626433 TGGCGGGAGCAGAAGCAAGAGGG + Intergenic
1004069783 6:12288056-12288078 CAGGGGCAGCCTCAGCAAGGTGG + Intergenic
1005040309 6:21595044-21595066 CGGCGGCGGGAGCAGCAACGCGG + Exonic
1005040312 6:21595047-21595069 CGGCGGGAGCAGCAACGCGGGGG + Exonic
1006304661 6:33211802-33211824 CGGAGGCAACAGCAGGAAGCAGG + Exonic
1006833116 6:36980901-36980923 GGGCAGCAGAGGCAGCAAGGTGG + Intronic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007497260 6:42268755-42268777 CCGCAGCAACAGCAGCAAGCCGG - Exonic
1007625339 6:43243496-43243518 CGGCGGCGGCAGCGGCAGAGCGG - Intergenic
1008071832 6:47105984-47106006 CAGAGGCAGCAGCAACAATGAGG + Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1010734709 6:79431070-79431092 ATGCGGCAGCAGCAGCGTGGAGG + Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012939656 6:105403135-105403157 CGGCGGCGGCGGCGGCAAGAGGG + Intergenic
1013273012 6:108560183-108560205 TGGCAGCAGCGGGAGCAAGGAGG + Intronic
1013422519 6:109979180-109979202 CGGCGGCCACAGCAGCAGGGGGG + Exonic
1014494177 6:122100140-122100162 CGGAGCCAGCAGCAGCAATGTGG + Intergenic
1014558048 6:122856817-122856839 TGGCCACAGCAGGAGCAAGGTGG + Intergenic
1018734656 6:166678669-166678691 CGCCTGGAGAAGCAGCAAGGTGG + Intronic
1018795217 6:167180054-167180076 AGGGGGCAGCAGAAACAAGGTGG - Intronic
1018821103 6:167375008-167375030 AGGGGGCAGCAGAAACAAGGTGG + Intronic
1019298851 7:293054-293076 CGGCGGGAGCACCAGGAACGTGG - Intergenic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019543240 7:1560759-1560781 AGGCGGCAGCAGAGGCCAGGAGG - Intronic
1020034938 7:4959085-4959107 CGGCGGCGGCAGCAGCAGGTTGG + Exonic
1020034939 7:4959088-4959110 CGGCGGCAGCAGCAGGTTGGAGG + Exonic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1020210279 7:6153855-6153877 CGGCCTCAGCAGCACCAAGAAGG + Exonic
1020326680 7:6979626-6979648 CGGCGGCAGCAGCAGCTGGAGGG + Intergenic
1020690919 7:11353599-11353621 CTGAGGAGGCAGCAGCAAGGTGG + Intergenic
1021827988 7:24573553-24573575 CGGCGGCAGCGGCGGCGCGGAGG + Exonic
1021970873 7:25964805-25964827 CTGCCTCACCAGCAGCAAGGCGG + Intergenic
1022207657 7:28179929-28179951 CGGCGGCTGCAGCCGCGGGGAGG - Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023054986 7:36283990-36284012 CGGCGGCAGCAGCGCAAAGCAGG + Intronic
1023801499 7:43838965-43838987 CGGCCGCAGTAGGAGCACGGAGG + Intergenic
1024059812 7:45689477-45689499 TGGCGAGAGCAGGAGCAAGGGGG + Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026822176 7:73557255-73557277 CGGCAGCAGCCGCAGCAGGTGGG + Intronic
1026878161 7:73891602-73891624 CGACACCAGCAGCAGCCAGGAGG - Intergenic
1027218912 7:76201914-76201936 CGGCGGCAGCACCCGCGGGGAGG + Exonic
1029159293 7:98540485-98540507 GGAGGGCAGCAGCTGCAAGGTGG + Intergenic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029491903 7:100875310-100875332 CGGCCGCGGCCGCACCAAGGTGG + Exonic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1029706591 7:102279749-102279771 CGGGCGCAGCTGCAGGAAGGTGG - Intronic
1030216135 7:107045105-107045127 GGGCGGCACCCCCAGCAAGGGGG + Exonic
1031362768 7:120866903-120866925 CGGTGAAAGCAGGAGCAAGGAGG - Intergenic
1031899306 7:127392364-127392386 CGGCGGCAGCTGCTGCCGGGCGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1031991311 7:128201066-128201088 CGGTGGCAGGAGCAGCCAGGAGG + Intergenic
1032298964 7:130668917-130668939 CGCCCGCAGCAGCAGGAATGTGG + Exonic
1032306221 7:130734152-130734174 CGGCGGCAGCAGGCGGCAGGCGG - Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1034441146 7:151086657-151086679 CGGCGGCGGCAGCGGCGAGCGGG - Intronic
1034524626 7:151649705-151649727 TGGCGGGAGCAGGAGCAAGAAGG - Intronic
1034539647 7:151748796-151748818 CGTCATCAGCAGCGGCAAGGAGG + Intronic
1034840418 7:154390672-154390694 AGGTGGAAGAAGCAGCAAGGAGG + Intronic
1036220339 8:6915911-6915933 AGGAGGCAGCAGCAGGAAGAGGG - Intergenic
1036369940 8:8154301-8154323 CGGTGGCAGCAGCAGCTGGAGGG - Intergenic
1036793222 8:11737292-11737314 TGGCAGCAGCAGCAGCCAGCTGG - Intronic
1036880952 8:12511329-12511351 CGGTGGCAGCAGCAGCTGGAGGG + Intergenic
1036946571 8:13100095-13100117 CAGCAGCAGCAGCAGCCAGTCGG - Exonic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037900998 8:22689709-22689731 CGGCGGCAGCAGCACCGCGTCGG + Exonic
1038319518 8:26514223-26514245 CAGCCGCGGCAGCAGCTAGGGGG + Intergenic
1038727611 8:30095452-30095474 CGGCGGCAGCAGCGGCAGCCGGG - Intronic
1039879434 8:41615277-41615299 TGGCGGCAGCAGCATGCAGGCGG - Intronic
1040516984 8:48143531-48143553 TGGCGGGAGCAGGAGCAAGCGGG - Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041280993 8:56211288-56211310 CGGCGGCGGCAGCTGCAAGTTGG - Intronic
1042399611 8:68330898-68330920 GGGCGGCAGCAGCAGGAATCAGG - Exonic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1043800549 8:84604493-84604515 TGCCGGCAGCAGCAGCGAGATGG - Intronic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1045305228 8:100951985-100952007 CGGCGGCGGCAGCAGCGGCGAGG + Exonic
1046285769 8:112091829-112091851 AGGCAACAGCTGCAGCAAGGAGG + Intergenic
1046556507 8:115779694-115779716 CGGCGGCAGCAGGAGCCCTGGGG - Intronic
1046871315 8:119208457-119208479 CAGCGGCAGCGGCAGCATGTCGG + Exonic
1047094604 8:121610424-121610446 CGGCAGCATCAGCAGCATGTGGG - Intergenic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1047493071 8:125390222-125390244 CAGCGGCAGCAGCAGCGTGGGGG - Intergenic
1047499235 8:125429654-125429676 CGGCTGCAGCCGGAGGAAGGAGG - Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049480836 8:142821737-142821759 CTGCGGCAGAATCAGCAAGGTGG - Intergenic
1049717260 8:144098880-144098902 AGGTGGAAGCTGCAGCAAGGGGG + Exonic
1049852537 8:144840769-144840791 AGTTGGCAGCAGCAGCCAGGAGG + Intronic
1050151392 9:2622162-2622184 CGGCGGCGGCACCATCCAGGCGG + Exonic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1052888863 9:33677116-33677138 CGGCGGCTGCAGCTCCAGGGAGG - Intergenic
1052947390 9:34179219-34179241 CGGCGGCAGCAGCGGCATTCAGG + Exonic
1053607823 9:39679020-39679042 CTGCAGCAGCAGCAAAAAGGCGG - Intergenic
1053607824 9:39679023-39679045 GGGCTGCAGCAGCAGCAAAAAGG - Intergenic
1053865671 9:42435383-42435405 GGGCTGCAGCAGCAGCAAAAAGG - Intergenic
1054160924 9:61671722-61671744 TGGCGGCAGCAGGAGCATCGCGG - Intergenic
1054173107 9:61857838-61857860 TGGCGGCAGCAGGAGCATCGCGG + Intergenic
1054245711 9:62663386-62663408 GGGCTGCAGCAGCAGCAAAAAGG + Intergenic
1054245712 9:62663389-62663411 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054447960 9:65386880-65386902 TGGCGGCAGCAGGAGCATCGCGG + Intergenic
1054559836 9:66697917-66697939 GGGCTGCAGCAGCAGCAAAAAGG + Intergenic
1054559837 9:66697920-66697942 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054664435 9:67722943-67722965 TGGCGGCAGCAGGAGCATCGCGG - Intergenic
1054790418 9:69251437-69251459 CATCTGCAGCAGCAGCAAAGGGG - Intronic
1055391506 9:75826775-75826797 CAGCAGCATCAGTAGCAAGGAGG + Intergenic
1056018423 9:82416590-82416612 AGGAAGCAGCAGCAGGAAGGGGG + Intergenic
1056468215 9:86879615-86879637 TGGCTGCAGCAGCAGGAAGCAGG + Intergenic
1057772784 9:97983190-97983212 CGGCCGCGGCTGCACCAAGGCGG - Intergenic
1057890583 9:98867035-98867057 CAGCCGAAGTAGCAGCAAGGTGG - Intergenic
1058545907 9:106059972-106059994 GGTCTGCAGCAGCAGCCAGGTGG + Intergenic
1059565387 9:115379454-115379476 CTGCTGCAGCAGGAGCAAGTGGG + Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061293681 9:129666089-129666111 CGGGGGCAGCAGCGGCAGCGAGG + Exonic
1061293682 9:129666092-129666114 GGGCAGCAGCGGCAGCGAGGCGG + Exonic
1061867429 9:133500066-133500088 CGCCGGCAGCAGCAGCCAAGGGG - Intergenic
1062064190 9:134517550-134517572 CTGCGGGAGCAGCTGCCAGGCGG - Intergenic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062095026 9:134698717-134698739 CGGCAGCAGCGCCTGCAAGGCGG - Intronic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062584140 9:137241484-137241506 TGGCGGCAGCAGCGGCCGGGCGG + Intronic
1203664569 Un_KI270754v1:13912-13934 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203665140 Un_KI270754v1:16727-16749 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203665418 Un_KI270754v1:18134-18156 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203665697 Un_KI270754v1:19544-19566 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203665987 Un_KI270754v1:20954-20976 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203666276 Un_KI270754v1:22363-22385 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203666565 Un_KI270754v1:23770-23792 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203667133 Un_KI270754v1:26593-26615 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203667425 Un_KI270754v1:28002-28024 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203667714 Un_KI270754v1:29409-29431 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203668281 Un_KI270754v1:32232-32254 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203668573 Un_KI270754v1:33641-33663 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203668859 Un_KI270754v1:35051-35073 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203669134 Un_KI270754v1:36458-36480 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203669418 Un_KI270754v1:37867-37889 GGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203669706 Un_KI270754v1:39274-39296 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1186925084 X:14324789-14324811 TGGTGGCAGCAGCAGTAAGAGGG - Intergenic
1188707892 X:33357806-33357828 CAGTGGCAGGAGCAGCAAGGTGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1189888802 X:45577436-45577458 GGGCACCAGCAGTAGCAAGGAGG + Intergenic
1191800349 X:65072738-65072760 CAGTGGCAGCAGCAACATGGTGG + Intergenic
1192034126 X:67545301-67545323 CTGCTGCAGCAGCAGCAAACTGG - Exonic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1192432843 X:71124364-71124386 AGGCAGCAGCAGCAGCAAGCTGG + Exonic
1192638755 X:72844488-72844510 AGGAGGCAACATCAGCAAGGGGG + Intronic
1192642957 X:72876320-72876342 AGGAGGCAACATCAGCAAGGGGG - Intronic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197585127 X:128337648-128337670 CGGCAGGAGCAGGACCAAGGGGG - Intergenic
1199711305 X:150471348-150471370 CTGCTGCTGCAGCTGCAAGGTGG - Exonic
1199772511 X:150983780-150983802 GGGCGGCGGCAGCGGGAAGGGGG + Intronic
1200118860 X:153781128-153781150 CGGCGGCAGTAGCAGCAGGTAGG + Exonic
1201175561 Y:11306811-11306833 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1201176824 Y:11314812-11314834 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic