ID: 1073535094

View in Genome Browser
Species Human (GRCh38)
Location 10:104269183-104269205
Sequence CGGCGGCAGCAGCAGCAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 7, 3: 87, 4: 550}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535094_1073535102 8 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535094_1073535097 -8 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535094_1073535104 11 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535094_1073535107 21 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535094_1073535108 22 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535094 Original CRISPR CGGCGGCAGCAGCAGCAAGG AGG (reversed) Exonic