ID: 1073535095

View in Genome Browser
Species Human (GRCh38)
Location 10:104269186-104269208
Sequence TGGCGGCGGCAGCAGCAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 3, 2: 12, 3: 119, 4: 671}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535095_1073535104 8 Left 1073535095 10:104269186-104269208 CCTTGCTGCTGCTGCCGCCGCCA 0: 1
1: 3
2: 12
3: 119
4: 671
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535095_1073535102 5 Left 1073535095 10:104269186-104269208 CCTTGCTGCTGCTGCCGCCGCCA 0: 1
1: 3
2: 12
3: 119
4: 671
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535095_1073535108 19 Left 1073535095 10:104269186-104269208 CCTTGCTGCTGCTGCCGCCGCCA 0: 1
1: 3
2: 12
3: 119
4: 671
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1073535095_1073535107 18 Left 1073535095 10:104269186-104269208 CCTTGCTGCTGCTGCCGCCGCCA 0: 1
1: 3
2: 12
3: 119
4: 671
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535095 Original CRISPR TGGCGGCGGCAGCAGCAGCA AGG (reversed) Exonic
900088108 1:908300-908322 TGGTGGGGGCAGCAGCTGGAAGG + Intergenic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900510079 1:3054683-3054705 TGGCAGAGGCAGAAGCAGCTGGG + Intergenic
901054723 1:6443826-6443848 TGCCGGCAGCAGGGGCAGCATGG + Intronic
901308726 1:8252466-8252488 AGGCAGCGGGAGCAGCAGCCAGG + Intergenic
901453520 1:9350623-9350645 GGGTGGCGGTGGCAGCAGCAGGG + Intronic
901683541 1:10930278-10930300 GGGCGGCAGCAGCAGCAGAAGGG + Intergenic
901878123 1:12178703-12178725 GGGCAGAGGCAGCAGCAGTACGG + Intronic
901936453 1:12630359-12630381 TGATGGCTGCAGCAGCAGCCGGG - Intergenic
902037722 1:13469742-13469764 AGGCAGTGGCAACAGCAGCATGG + Intergenic
902479637 1:16704778-16704800 TGCCGGCAGCAGGGGCAGCATGG - Intergenic
902813454 1:18902506-18902528 GGGCGCCGGCAGCAGCATCTCGG + Exonic
902950984 1:19882642-19882664 TGGCGGCGGCGGCGGCTGCGAGG + Exonic
902961765 1:19968628-19968650 TGGAGGCAGCTGTAGCAGCAGGG + Intergenic
903186432 1:21631931-21631953 TGGCGGTGGCTGCAGGAGCCAGG - Intronic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903418425 1:23200878-23200900 TGACAGCAGCAGCAGAAGCAAGG + Intergenic
904360303 1:29966829-29966851 TGGCTGTGGCAGCAGCTACAGGG - Intergenic
904575600 1:31503242-31503264 TGACCTCAGCAGCAGCAGCATGG - Intergenic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
905352810 1:37359270-37359292 GGGAGGTGGCAGCAGCAGCTGGG - Intergenic
905499999 1:38428713-38428735 GGGCGGCAGCAGCTGCTGCACGG - Intergenic
905730993 1:40299571-40299593 TGGCGGCTACAGTGGCAGCATGG + Intergenic
906278548 1:44536687-44536709 TGGTGGCGGCAGCAGCAGAGGGG - Intronic
906365472 1:45206194-45206216 GGGCGTCGGCAGCAGCTGCCTGG - Exonic
906637098 1:47416905-47416927 AGGCGGCGGCACCAGCAGCGCGG - Exonic
906680762 1:47724175-47724197 TGTCACCAGCAGCAGCAGCAGGG + Intergenic
906724434 1:48033681-48033703 TGGGGGCTGCAGCAGCAGCTGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
911196721 1:95002281-95002303 AAGCGGCCCCAGCAGCAGCATGG + Intronic
911449586 1:98046170-98046192 TAGCAGCGGCAGCGGCAGCTTGG - Intergenic
912487161 1:110038297-110038319 TGGCAGTGGCAGCAGCAGATGGG - Intronic
912716922 1:111989722-111989744 TGGCGGCGGCAGTGGCGGCGGGG - Intergenic
912955559 1:114152648-114152670 TGGCGGCGGGAGCTGCGGGAGGG - Exonic
914730410 1:150364726-150364748 CGGCGGCGGAGGCAGCAGTAAGG + Exonic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915528901 1:156492175-156492197 TTGGGGCGGCAGCAGCAGGAGGG + Intronic
915747598 1:158176647-158176669 TGGGGATGGCAGCAGCTGCAGGG + Intergenic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
916975611 1:170074467-170074489 TGGCGGCAGCGGCAGCGGCGTGG + Exonic
917109839 1:171536050-171536072 TGGCAGCAGCAGCAACAGCAAGG + Exonic
917258574 1:173142279-173142301 TGGCAGAGGCTGCAGCAGCAAGG + Intergenic
917345197 1:174022212-174022234 TGGCGGCGGCAGCCGTGGCCCGG - Exonic
917904544 1:179575878-179575900 GGGCGGCTGGAGCAGCAGCGCGG + Exonic
918342940 1:183582190-183582212 AGGCGGGGGCTGCCGCAGCACGG - Intronic
919678382 1:200409588-200409610 CGGCGGCAGCAGCGGCAGGAGGG - Exonic
919829754 1:201532037-201532059 AGGAGGCTGCAGCTGCAGCAGGG + Intergenic
920886898 1:209938211-209938233 TGGCGGGGGCAGCAGACGCGAGG - Exonic
921603991 1:217135550-217135572 TGGCGGCGGCGGCGGCAGGGCGG + Intronic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
923301061 1:232641157-232641179 AGGTGGCAGAAGCAGCAGCAGGG + Intergenic
923318578 1:232805793-232805815 AGGGGGCAGCTGCAGCAGCAAGG - Exonic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923963004 1:239105006-239105028 GGGCGGCAGCAGCCGCTGCATGG - Intergenic
1063460950 10:6214780-6214802 TGGCGGCTGCACCAGCAGAAGGG + Intronic
1064017162 10:11781533-11781555 TGGCAGCGGAGGCAGCAGCTGGG + Intergenic
1064086578 10:12349943-12349965 TGGCCGCGGCAGGGGCTGCACGG + Intronic
1064665242 10:17644151-17644173 CTGCGGCGGCGGCAACAGCAAGG - Exonic
1065341834 10:24714527-24714549 TGATGGCAGTAGCAGCAGCAGGG - Intronic
1066037897 10:31512207-31512229 TGGTGGCAGCAGCTGCAGGATGG - Intronic
1066065793 10:31760026-31760048 TGGGGCCGGCAGCCGCGGCAGGG + Intergenic
1066604427 10:37146464-37146486 TGGAGGGGGCACCAGCTGCAGGG + Intronic
1068130495 10:52889822-52889844 GGGTGGCTGCAGCAGCACCAGGG - Intergenic
1068378281 10:56213191-56213213 TGTGTGAGGCAGCAGCAGCAGGG + Intergenic
1069015721 10:63427145-63427167 CGGTGGCGGCAGCAGCTGCTTGG + Intronic
1069091470 10:64204518-64204540 TAGGGTCAGCAGCAGCAGCAGGG - Intergenic
1069424682 10:68279039-68279061 TGGCGGCAGCAGCGGCGGCGGGG + Intergenic
1069761725 10:70815992-70816014 CGGCGGCGGCGGCGGCAACAGGG + Exonic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1070444799 10:76486796-76486818 TGGCAGTGGCAGCAGCATAATGG - Intronic
1070772797 10:79092073-79092095 AGGAGGTGGCAGCAGCAGCTGGG + Intronic
1070793167 10:79201732-79201754 TGGGGCGGGCTGCAGCAGCAGGG + Intronic
1070954301 10:80454342-80454364 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071611722 10:87038202-87038224 CGGCAGTGGCAGCAGCAGCATGG + Intergenic
1071695468 10:87864226-87864248 TGGCAGCGGCGGCAGCGGAATGG - Exonic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1073076341 10:100827583-100827605 AGGCAGCGGCAGCAGCGGCAGGG - Exonic
1073110916 10:101062591-101062613 GGGCCGCGGCGGCGGCAGCATGG - Exonic
1073122629 10:101131802-101131824 CGGCGGCGGCGCCTGCAGCATGG + Exonic
1073535095 10:104269186-104269208 TGGCGGCGGCAGCAGCAGCAAGG - Exonic
1074591958 10:114821989-114822011 CGGCCCCGGCAGCCGCAGCAGGG + Exonic
1074973759 10:118564770-118564792 AGGCGGCAGCAGCTGCAGCCTGG - Intergenic
1075401390 10:122163765-122163787 TGGCGGCGGGAGCGGCGGCAGGG - Intronic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1075768899 10:124917083-124917105 GGGCGGAGGCGGCAGCAGCGGGG + Intergenic
1076146481 10:128126280-128126302 AGGCGGCGGCGGGAGCAGCGGGG - Exonic
1076719306 10:132386308-132386330 TGGCAGAGGCAGCAGCTGGAAGG + Intergenic
1076922601 10:133462570-133462592 TGCCACAGGCAGCAGCAGCAAGG + Intergenic
1077103683 11:832976-832998 CGGCGGCGGCAGCAGCTGCGGGG - Exonic
1077515598 11:3000215-3000237 TGGTGGCAGCAGCCTCAGCATGG - Intergenic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078175067 11:8964224-8964246 CAGCTGCGCCAGCAGCAGCACGG + Exonic
1078594417 11:12674473-12674495 CGGCGGCGGCAGCAGAGGCTCGG - Intergenic
1079257984 11:18849021-18849043 TGGCTGGTGCAGAAGCAGCAAGG - Intergenic
1079733152 11:23961825-23961847 GGGCGGCTGCAGCGGCAACAGGG - Intergenic
1080503805 11:32893254-32893276 TGGCGGCGGCGGCGGCGGCTCGG - Exonic
1080517780 11:33039749-33039771 TCGCGGCGGGAGCGGCAGGAGGG + Exonic
1082004753 11:47413414-47413436 GCGCGGCGGCAGCAGCAGTGGGG - Exonic
1082026905 11:47579093-47579115 TGGCGGCGGCGGCGGTAGCCAGG + Exonic
1082794675 11:57370542-57370564 TGGAGGCGGCTGAAGCAGCAGGG - Exonic
1082928976 11:58579452-58579474 CGGCGGCGGCCGCAGCGGCCCGG - Exonic
1083363906 11:62129902-62129924 CGGCAGCTGCAGCCGCAGCACGG - Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083809589 11:65096252-65096274 TGGCGGCGGCAGCTGCCGCCGGG + Exonic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1085440231 11:76555001-76555023 TGGCTGCAGCATGAGCAGCAAGG + Intergenic
1085802202 11:79601043-79601065 ATGCAGAGGCAGCAGCAGCAGGG - Intergenic
1086059844 11:82689482-82689504 TGGTGGCGGCAGCAGCACCTGGG + Intergenic
1086887803 11:92224820-92224842 TAGCGGCGGCGGCTGCAGCTCGG + Intergenic
1087014714 11:93543553-93543575 AGGCAGCGGCAGCAGCAGGCCGG - Intergenic
1088172837 11:107017848-107017870 CGGCGGCGGCAGAAGCAGCCGGG + Exonic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1088668890 11:112121974-112121996 TGGCGAAGGCAGCAGGAGAAGGG + Intronic
1089242758 11:117096910-117096932 AGGAGGCGGCAGCAGCTGTAAGG + Intronic
1089262372 11:117232030-117232052 AGGCGGCGGCAGCTGCGGCGGGG - Exonic
1089470844 11:118719079-118719101 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1089593452 11:119559868-119559890 TGGGGGCTGCAGGAGCAGCAAGG - Intergenic
1089757401 11:120696703-120696725 TGGCCAAGGCAGCGGCAGCAGGG + Intronic
1090068743 11:123525857-123525879 TGGCAGCGGCAGCCACAGCTCGG + Exonic
1090526558 11:127544597-127544619 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1090611092 11:128471414-128471436 TGGGGGCGGCAGCAGGAGAAAGG + Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092256393 12:6928479-6928501 TGGAGGCGGCGGCGGCAGGAGGG - Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335416 12:7628724-7628746 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335432 12:7628766-7628788 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092810371 12:12266803-12266825 GGGCGGCCGCCGCAGCGGCAGGG + Exonic
1093518885 12:20024467-20024489 GAGTGGCAGCAGCAGCAGCAGGG + Intergenic
1093542011 12:20298709-20298731 AGGGTGGGGCAGCAGCAGCAAGG + Intergenic
1095248719 12:39953860-39953882 TGGCAGAGGCTCCAGCAGCAGGG + Intronic
1095310596 12:40692873-40692895 TGGCGGCGGCAGCCTCCGAAAGG - Intronic
1095945167 12:47749565-47749587 TGGGGGCGGCAGGGGCGGCAGGG - Intronic
1096053742 12:48633591-48633613 AGGCAGCTGCAGGAGCAGCAAGG - Intergenic
1096184281 12:49568082-49568104 CGGCGACGGTAGCAGCCGCAGGG + Intronic
1096576478 12:52556148-52556170 GGGTGGCTGCAGCAGCGGCAGGG - Intergenic
1096602702 12:52741879-52741901 TGGCAGCGGCTGCAGCAGGGAGG + Intergenic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1097541937 12:60953844-60953866 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1097592581 12:61590504-61590526 GGGCGGTGGCAGCCGCTGCACGG - Intergenic
1097994864 12:65877268-65877290 TGCTGGCTGCTGCAGCAGCAGGG + Intronic
1098435443 12:70463906-70463928 TGGGGCCAGCAGCAGCAGCAGGG + Intergenic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1101211464 12:102539117-102539139 TTTCAGCAGCAGCAGCAGCAGGG + Intergenic
1101813627 12:108129303-108129325 TGGCGGCGGCGGCAGCGGCGCGG + Intergenic
1101981009 12:109406896-109406918 CGAGGGAGGCAGCAGCAGCAGGG - Intronic
1102136955 12:110583270-110583292 CGGCGGCGGCCGCTGCAGCCGGG - Exonic
1102371018 12:112382324-112382346 CGGCGGCGGCGGCGGCGGCAGGG - Intronic
1102457137 12:113077853-113077875 TGGCGGCGGCGGCGGCAGCGGGG - Exonic
1102471939 12:113164155-113164177 GGGCGGCAGGAGCAGCAGGAGGG - Exonic
1103128769 12:118448377-118448399 TGGAAGTGGCAGGAGCAGCAGGG + Intergenic
1103176832 12:118871662-118871684 TGGATGAAGCAGCAGCAGCAGGG - Intergenic
1103202020 12:119095502-119095524 TGGGGTGTGCAGCAGCAGCATGG - Intronic
1103445547 12:120992864-120992886 GGGGCGCAGCAGCAGCAGCAGGG - Intronic
1103694075 12:122799912-122799934 TGGTGGCAGCGGCAGCAGCTAGG - Intronic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1104112203 12:125714616-125714638 TGCAGGCTGCAGAAGCAGCATGG - Intergenic
1104315999 12:127702300-127702322 TGGCGTTGGGAGCAGCAGCGTGG - Intergenic
1104801551 12:131558279-131558301 TGATGGGGGCAGCACCAGCAGGG + Intergenic
1104843186 12:131834336-131834358 CGGGTGCTGCAGCAGCAGCAGGG - Intronic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1104910601 12:132238426-132238448 AGGCCGGGGCAGCAGCCGCAGGG + Intronic
1104947624 12:132423617-132423639 TGGCGGCTGCAGGCGGAGCAGGG + Intergenic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1105602777 13:21901933-21901955 CAGCGGTGGCAGGAGCAGCATGG + Intergenic
1106314714 13:28583091-28583113 TGGCGGTGGCAGGGGGAGCAGGG + Intergenic
1106322966 13:28659278-28659300 TGGCGGCGGCGGCGGCAGCGTGG + Intronic
1106500657 13:30325393-30325415 TGGCAGTGGCAGCCACAGCATGG + Intergenic
1106555470 13:30804716-30804738 TGCCAGTGGCATCAGCAGCAGGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107220046 13:37971044-37971066 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1107826440 13:44332730-44332752 TGGAGGCAGCAGCAGCAGCAGGG - Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1109343849 13:61092378-61092400 AGGCGGCAGCAGCCGCTGCATGG - Intergenic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110765702 13:79277773-79277795 GGGCGGCAGCAGCCGCTGCACGG - Intergenic
1111512808 13:89287878-89287900 GGGTGGCTGCAGCAGCAGCCAGG + Intergenic
1112045685 13:95595162-95595184 TGGGTGAGGCAGCAGCAGAAGGG - Intronic
1112091798 13:96090812-96090834 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1112237078 13:97646149-97646171 GGGCGGCAGCAGCCGCAGCACGG - Intergenic
1112502581 13:99954582-99954604 TGGCGGGGTGAGCAGCAGCTGGG + Intergenic
1112505042 13:99970434-99970456 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1112505098 13:99970638-99970660 CGGCGGCCGCAGCAGCGGCCGGG - Exonic
1113200736 13:107866164-107866186 CGGCGGCGGCGGCGGCGGCAAGG - Exonic
1113447339 13:110379540-110379562 TGGCTGCAGCAGAAGCTGCAAGG + Intronic
1113720711 13:112553733-112553755 TGGAGGAGGCAGCAGCAGCTGGG + Intronic
1114317668 14:21523262-21523284 TGGCGGCAGCAGCCACAGCTGGG - Exonic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1115399312 14:32939397-32939419 CGGCGGCGGGAGCAGCGGCCCGG - Intronic
1115855125 14:37622507-37622529 GGGCGGAGGCAGCAGGACCACGG - Intronic
1116436180 14:44897479-44897501 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116469904 14:45275058-45275080 TGGGGGCGGCAACAGCAGGATGG - Intergenic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116961572 14:50973136-50973158 TGGAGGGGGCACCAGGAGCAGGG - Intergenic
1117296231 14:54381931-54381953 TAGCAGTGGCAGCAGCAGCTAGG - Intergenic
1117512897 14:56471256-56471278 TGGCAGCGGCAGCAGCAGGCTGG + Intergenic
1117602712 14:57391104-57391126 AGGCGGCGGCAGCAGGAGCCCGG + Exonic
1117680665 14:58200016-58200038 TGGCGACGGCAGCACCTGCAAGG + Intronic
1117875891 14:60249617-60249639 AGGCGGCGGCGGCGGCAGCCGGG - Intronic
1118776962 14:68979226-68979248 TGGCGGCGACAGCGGCGGCTGGG + Exonic
1118930354 14:70234821-70234843 GGGCGGCGGCAGCAGTTTCAGGG - Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119615602 14:76096799-76096821 TGGCAGTGGCAGCACCAGCTGGG - Intergenic
1119771663 14:77224003-77224025 TGGTGGTGGCAGCAGCAGTGGGG - Intronic
1120618488 14:86735173-86735195 AGGCGGCAGCAGCCGCTGCACGG - Intergenic
1120771575 14:88385695-88385717 CGACGGGGGCTGCAGCAGCAGGG - Exonic
1120859489 14:89241943-89241965 TGTCCGGGGGAGCAGCAGCATGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121473477 14:94174315-94174337 AGGCGGCGGGAGCAAGAGCACGG - Exonic
1122108768 14:99480817-99480839 TGGCGGCGGCGGCGGCCGGACGG + Exonic
1122122961 14:99564341-99564363 TGGAGAAGCCAGCAGCAGCAGGG + Intronic
1122363955 14:101183410-101183432 TGGCGGCAGCTGCATGAGCAGGG - Intergenic
1122390047 14:101373882-101373904 TGGCGGAGGCGGCAGCAGGAGGG + Intergenic
1122517623 14:102319807-102319829 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1122608774 14:102966746-102966768 AAGCGGCTGCAGAAGCAGCAGGG - Intronic
1122693597 14:103542617-103542639 TGGGGACGGCAGCTGCAGGAAGG - Intergenic
1122999948 14:105287992-105288014 GGTGGCCGGCAGCAGCAGCAGGG + Intronic
1123017661 14:105383080-105383102 TGTGGGCGGGAGCAGCAGCCTGG + Intronic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1123035477 14:105470151-105470173 TGGCGGTGGCCGCGGCGGCAGGG - Exonic
1124654714 15:31498967-31498989 TGGCGGCATCAGCAGTAGCCGGG + Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125131296 15:36287708-36287730 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1125212974 15:37238078-37238100 GGGCGGCGGCAGCCACTGCACGG + Intergenic
1125516472 15:40323877-40323899 CGGCGGCGGCTGCAGCAACGCGG + Intergenic
1125522928 15:40358232-40358254 TGGCGGCGGCAGCGGCGGCGGGG - Exonic
1125545076 15:40497501-40497523 TGGCAGAGGCAGGAGCAGCAAGG - Intergenic
1125852815 15:42920717-42920739 AGGCGGCGGCGGCGGCAGGAGGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1125953832 15:43776191-43776213 TGGCGGCGGCAGGAGGGGGAGGG - Intronic
1126091105 15:45052691-45052713 TGGTGGGGGCAGCAGTGGCAAGG - Intronic
1126689910 15:51281083-51281105 TGGCGGAGTTAGCAGCAGCTGGG - Intronic
1126844019 15:52742595-52742617 GGGTGGCAGCAGCAGCTGCACGG - Intergenic
1127165756 15:56243743-56243765 TGCCTGGGGCTGCAGCAGCACGG - Intergenic
1128067858 15:64775603-64775625 CGGCGGCGGCAGCGGCGGCGGGG + Intergenic
1128513836 15:68329735-68329757 TGGTGGCAGCAACAGCAGCCTGG - Intronic
1129116453 15:73367931-73367953 GGGCGGCGGCAGCGGCGGCACGG - Exonic
1129206339 15:74039083-74039105 TGGTGGCAGCAGCAACAGGAGGG + Intronic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129784918 15:78303844-78303866 GGGCGGCTGCAGCAGCACCTGGG - Intergenic
1129844088 15:78760316-78760338 TGGCAGTGGCATCAGGAGCAAGG - Intronic
1130174164 15:81550224-81550246 TGATGGCAGCAGCAGCAGGAGGG + Intergenic
1130224237 15:82045633-82045655 CGGCGGCGGCAGCAGCGGAGGGG - Exonic
1130257713 15:82333484-82333506 TGGCAGTGGCATCAGGAGCAAGG + Intergenic
1130597222 15:85256479-85256501 TGGCAGTGGCATCAGGAGCAAGG - Intergenic
1132086903 15:98916077-98916099 TGGCAGCGGCAGCCTCAGGACGG + Exonic
1132543021 16:520187-520209 GCGGGGCCGCAGCAGCAGCATGG + Exonic
1132586195 16:706610-706632 CGGCGGCGGCTGCTGCAGCCCGG + Intronic
1132588173 16:715201-715223 GGGCGGCGGCGGGAGCAGCCGGG - Exonic
1132608892 16:805346-805368 TAGCCCCGGAAGCAGCAGCAGGG - Intergenic
1132641879 16:981786-981808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1132645495 16:997526-997548 TGCCAGCGGCAGGAGCGGCAGGG + Intergenic
1132758543 16:1497599-1497621 TGGGGGTGCCAGCTGCAGCACGG - Intronic
1132885643 16:2180926-2180948 TGTCGGCGGCAGCAGCTGCGGGG + Exonic
1132930009 16:2454270-2454292 TTGGGGAGGAAGCAGCAGCAGGG - Intronic
1133002407 16:2858024-2858046 TGTCGACGCCAGCAGCAGCAGGG + Exonic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133357722 16:5148644-5148666 TGGCAGCAGCAGCAGCTGGAGGG + Intergenic
1133380273 16:5324123-5324145 TGGGGGCTGGATCAGCAGCACGG + Intergenic
1133759324 16:8785789-8785811 TGGCGGCTCCATCACCAGCATGG - Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134149884 16:11797243-11797265 TAGCGGCGGCGGCAGCGGCTCGG + Intronic
1134378739 16:13704068-13704090 TGGTGATGGCAGCAGCAGCTGGG + Intergenic
1135979769 16:27138801-27138823 TGGCGGCGGCAGCAGCGGTGTGG + Intergenic
1135987317 16:27193541-27193563 TGGAGGCTGCAGCAGAAGTAAGG - Intergenic
1136145186 16:28312288-28312310 TGACCGCGGCAACACCAGCAGGG - Intronic
1136153019 16:28364634-28364656 AGGCGGCGGCGGCCGGAGCAGGG + Intergenic
1136210064 16:28750639-28750661 AGGCGGCGGCGGCCGGAGCAGGG - Intergenic
1136365681 16:29808057-29808079 CGGCGGCGGCAGCGGCTGCTGGG + Intronic
1136508457 16:30721352-30721374 TGGTGGTGGCAGCAGCAGGAGGG - Exonic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1136561547 16:31042144-31042166 CGGCAGCGGCAGCAACAGCAGGG - Intronic
1137038908 16:35591813-35591835 TGGCGGCTGGGCCAGCAGCAGGG - Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137668617 16:50266484-50266506 CAGCGGCGGCGGCGGCAGCAAGG - Intronic
1138105629 16:54285960-54285982 TGGCGGCAGCGGCGGCAGCGCGG - Exonic
1138516195 16:57536560-57536582 CGGCGGCGGTCGCAGCTGCACGG - Exonic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1140927760 16:79599899-79599921 CGGCGGCGGCGGCAGGAGAATGG - Exonic
1141032968 16:80605980-80606002 AGAGGGCGGCAGCAGCAGCGTGG - Intronic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141479123 16:84294687-84294709 GGGCGGTGGCAGCAGGAGGAGGG - Exonic
1141487683 16:84351807-84351829 TGGTGGCGGTAGAAGCAGCCAGG - Intergenic
1141697758 16:85628154-85628176 GGGCGGGGGCCGCAGCAGCCGGG - Intronic
1141886218 16:86894266-86894288 AGCCGGCAGCAGCAGCAGCCAGG + Intergenic
1141982070 16:87556917-87556939 TGGCCCGGGCAGGAGCAGCAGGG + Intergenic
1142148016 16:88500542-88500564 TGACAGCGACAGCACCAGCAAGG - Intronic
1142259482 16:89036160-89036182 TGGGGGCGGGAGCAACAGTAAGG - Intergenic
1142386837 16:89770669-89770691 TGGGGACGGGAGCAGCAGGAAGG + Intronic
1142524957 17:533621-533643 TGGCGAAGGCAGCAGAAGAAAGG - Intronic
1142764451 17:2057554-2057576 TCGCGGCGGCAGCGGCAGCCCGG + Exonic
1142940736 17:3378289-3378311 TGGAGGGGGCAGAGGCAGCAGGG + Intergenic
1143130729 17:4675321-4675343 GGGCAGCAGCAGCAGCCGCAGGG + Exonic
1143209997 17:5179085-5179107 TGACAGCGCCAGCAGCAGCAGGG + Intergenic
1143256007 17:5558557-5558579 TGGCTGCAGCAGCAGCTGCAGGG + Exonic
1143478186 17:7214721-7214743 TGGCAACGGCGGCAGCAGCGCGG + Intronic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1144207480 17:12989253-12989275 GGGCGGCGGCTGCAGCAGCAAGG + Intronic
1144360503 17:14487309-14487331 TGGCTGGGGCAGAAGCAGCAGGG + Intergenic
1144504511 17:15818356-15818378 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1144634250 17:16893975-16893997 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1144791558 17:17862425-17862447 TGTCTGCAGCAGCAGCAGCATGG + Intronic
1144967336 17:19085979-19086001 AGGAGGTGGCAGCAGTAGCAAGG + Intergenic
1144980583 17:19166087-19166109 AGGAGGTGGCAGCAGTAGCAAGG - Intergenic
1144987639 17:19212146-19212168 AGGAGGTGGCAGCAGTAGCAAGG + Intergenic
1145117876 17:20228393-20228415 TGGAGACAGCAGCAGTAGCATGG - Intronic
1145168364 17:20633870-20633892 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1145243627 17:21253420-21253442 CGGCGGCGGCAGCAACAAAAAGG + Intergenic
1146164457 17:30576833-30576855 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1146398559 17:32487001-32487023 CGGCGGCGGCGGCGGCAGCTAGG - Exonic
1146533113 17:33627489-33627511 TGGCAGGAGCAGCAGCAGGAGGG - Intronic
1146896592 17:36545664-36545686 CGGCGGCGGCGGCGGCAGCTGGG + Exonic
1147262742 17:39218051-39218073 TGGGGGCGTCAGCAGCACCTCGG + Exonic
1148021647 17:44557581-44557603 GGGAGGCGGCAGCCGCAGCGAGG + Exonic
1148027799 17:44600404-44600426 TGGATGGGGCATCAGCAGCAAGG - Intergenic
1149597906 17:57874878-57874900 GGGCGGGGGCGGCAGCAGAAGGG + Intronic
1149656624 17:58312555-58312577 TGGGGGTGGCAGCAGTAGCGGGG - Exonic
1149915040 17:60600676-60600698 CGGCGGCGGCAGCAGCGGCTAGG - Exonic
1151543331 17:74776519-74776541 TGGCGCCGGCAGCAGCGGACCGG + Exonic
1151679368 17:75615503-75615525 TGGCTGCGGCGGCACCACCATGG - Intergenic
1151878157 17:76879027-76879049 TGGAGGCTGCAGCAGCAGCATGG - Intronic
1151937231 17:77270041-77270063 TTCCGGCGGGAGCAGCAGGATGG - Intergenic
1152222187 17:79074987-79075009 CGGCGGCGGCGGCAGCTGCAGGG + Exonic
1152225209 17:79089797-79089819 AGGTGGCGGGAGCAGCACCAAGG - Intronic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1153140946 18:1971954-1971976 TGGCATCTGCAGCTGCAGCATGG - Intergenic
1153935222 18:9914594-9914616 TGGCGGCGGCGGCGGCGCCAGGG - Intronic
1155654517 18:28177784-28177806 CGGCTGCGGCAGCAGCTGCGCGG - Intergenic
1156099620 18:33578349-33578371 CGGGGGCGGCGGCAGCAGCGGGG - Intergenic
1156750369 18:40446232-40446254 TGGTGGTGGCAGCAGGAGGAAGG + Intergenic
1156791186 18:40976506-40976528 TGGTGGCAGCAGCAGTAGCAAGG + Intergenic
1157383796 18:47246621-47246643 TGGCGGCGGCAGCAGCAGCCCGG - Intronic
1157610073 18:48950528-48950550 AGGCGACAGCAGCAGCAGCAGGG + Exonic
1157984487 18:52421513-52421535 GGGCTGGGGCAGCAGCAGCAAGG - Intronic
1158894605 18:61901179-61901201 TGGCAGCTGGAGCAGCAGGAGGG - Intergenic
1159164698 18:64685271-64685293 GGGCGGCAGCAGCCGCTGCACGG - Intergenic
1159798237 18:72868237-72868259 GGGCCGCGGCGGCGGCAGCAAGG + Intergenic
1160527316 18:79545342-79545364 TCGGGGCGGCAGGAACAGCAGGG - Intergenic
1160541565 18:79626831-79626853 TGGGGGCAGCAGCTGCAGCGTGG - Intergenic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1160866182 19:1257164-1257186 GGGCGGCGGCAGCCCCAGCGAGG + Exonic
1161068918 19:2250927-2250949 GGACCGCGGCAGCAGGAGCAGGG - Exonic
1161069657 19:2253726-2253748 GGGCGGCGGCGGCGGCTGCAGGG + Exonic
1161436906 19:4268911-4268933 AGGTGGGGGCAGGAGCAGCAGGG - Exonic
1161461888 19:4402658-4402680 CCGCGGCGGCAGCAGCGGCGCGG + Exonic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161851410 19:6739743-6739765 CGGCGGCGGCGGGAGCAGCATGG + Exonic
1162033056 19:7925634-7925656 CGGCGGCGGCGGCGGCAGGAGGG - Intronic
1162481471 19:10929197-10929219 GGCCGGCGCCAGCAGCAGGAGGG - Exonic
1162954678 19:14091273-14091295 CGGGGGCGGCGGCAGCAGGAGGG - Intergenic
1163453745 19:17394066-17394088 TGGCTGCGGCAGCAGCCGGCGGG - Intergenic
1163559462 19:18010221-18010243 TGGCAGCTCCAGCAGCAGCTTGG - Exonic
1164069159 19:21750630-21750652 AGGCGGAGGCAGCGGCAGCGCGG + Intronic
1165129270 19:33622022-33622044 CGGCGGCGGCAGCAGGAGGTGGG + Intronic
1166226326 19:41397889-41397911 AGGCTGCCGCAGCAGCAGGAGGG - Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166546994 19:43639787-43639809 CGGCGGCGGCGGCGGCACCATGG - Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166782700 19:45350726-45350748 AGGCGGCGGCAGGAGCAGCCGGG + Exonic
1166807687 19:45496950-45496972 CGGCGGCGGCTGGAGCAGCCCGG - Exonic
1166873798 19:45885514-45885536 TGGCGGCGGCAGCCGCACAGGGG - Exonic
1166883010 19:45940369-45940391 TGGCGGCGGCGGCGGCTGCTGGG + Exonic
1166890096 19:45986234-45986256 TGGGGGCGATAGCAGCAGCAGGG - Intergenic
1167249775 19:48393733-48393755 TGGCGGCGGCGGCCGCGGCTTGG - Intergenic
1167250060 19:48394777-48394799 TGGCGGCAGCAGCGGCAGCCCGG - Intergenic
1167299402 19:48670448-48670470 TGGTGGCGGCAGTGGCAGCGGGG + Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167384986 19:49157848-49157870 TTGCGGCGGCCGCGGCAGCATGG + Exonic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167638222 19:50667310-50667332 GGGAGGCGGCAGGACCAGCAGGG + Exonic
1167638606 19:50668440-50668462 TAGCAGCGGCCGCAGCAGCCAGG - Exonic
1167785216 19:51630306-51630328 CAGCAGGGGCAGCAGCAGCAGGG + Intronic
1167787315 19:51646730-51646752 CAGCAGGGGCAGCAGCAGCAGGG + Exonic
1168148021 19:54430371-54430393 TGGCTGTGGCAGGAGCAGAAGGG + Intronic
1168346230 19:55651420-55651442 AGGAGGCGGCAGAAGCAGAAGGG + Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
1202713673 1_KI270714v1_random:30684-30706 TGCCGGCAGCAGGGGCAGCATGG - Intergenic
925070996 2:966035-966057 TGGAGGCGAGAGAAGCAGCAAGG - Intronic
925568026 2:5277717-5277739 TAGCAGCAGGAGCAGCAGCAGGG + Intergenic
925733714 2:6942483-6942505 TAGCAGTAGCAGCAGCAGCAGGG + Intronic
926112429 2:10191855-10191877 TGTTGGCAGCAGGAGCAGCAAGG + Intronic
926251545 2:11157843-11157865 TGGAGGCAGGAGAAGCAGCAAGG - Intronic
926801415 2:16664164-16664186 AGGGGGCAGCAGCAGCATCACGG - Intronic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927491547 2:23524399-23524421 AGGCGTCGGCAGGAGAAGCAGGG + Intronic
927510794 2:23642689-23642711 TGGCGGCGGTGGAGGCAGCAGGG - Exonic
927697959 2:25250854-25250876 TGGCAGCGGCAGCAGCAGGTGGG + Intronic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
929004585 2:37382857-37382879 GGGCGGTGGCAGCCGCTGCACGG + Intergenic
929076454 2:38082834-38082856 GGGCGGCAGCAGCCGCTGCATGG + Intronic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929265941 2:39919825-39919847 AGACAGCAGCAGCAGCAGCAAGG + Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
930161104 2:48156571-48156593 TGTTGGTGGCAGCAGTAGCAGGG - Intergenic
930706473 2:54509480-54509502 GGGCAGCGGCAGCTGCTGCACGG + Intronic
931022866 2:58069661-58069683 TGACAGTGGCGGCAGCAGCAGGG - Intronic
931504148 2:62905364-62905386 TGGCTGCAGCAGCATCATCAAGG + Intronic
931566822 2:63622969-63622991 TGGCGGCGGCAGCAGCTGCTTGG - Intronic
931728043 2:65129948-65129970 GGGCGGCGGCTGCGGCAGCAAGG - Exonic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932208183 2:69902812-69902834 CGGCAGCGGCAGCAGCGGAAGGG - Intronic
932355964 2:71068665-71068687 CAGCGACGGTAGCAGCAGCATGG + Exonic
932365969 2:71153828-71153850 TGGCAGCTGCGGCAGCAGCTGGG + Intergenic
932704148 2:74010273-74010295 TGGAGGCGGCAGCATCTGGAAGG - Intronic
933163938 2:79055017-79055039 GGGCGGCAGCAGCTGCTGCATGG - Intergenic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933801215 2:85961601-85961623 TGGAGGGGGCTGAAGCAGCAGGG + Intergenic
933971769 2:87475549-87475571 TGTGGGAGGCAGCAGCAGAATGG + Intergenic
934670454 2:96209035-96209057 TGGCGGCGACGGCGGCAGCCGGG - Intergenic
935149083 2:100417552-100417574 CGGCGGCGGCAGCGGAAGTAAGG + Exonic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592897 2:104857084-104857106 CGGCGGCGGCGGCGGCGGCAGGG - Exonic
936321959 2:111474652-111474674 TGTGGGAGGCAGCAGCAGAATGG - Intergenic
937141452 2:119605532-119605554 AGGGGGTGCCAGCAGCAGCAGGG - Intronic
937844085 2:126558232-126558254 CGGCGGCGGCAGCAGCGGCGAGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
939189779 2:138902486-138902508 TGGCAATGGCAGCAGCCGCATGG + Intergenic
939432660 2:142130786-142130808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
939572409 2:143856251-143856273 TGCCGGGTGCAGAAGCAGCATGG - Intergenic
939900447 2:147844397-147844419 CGGCGGCGGCAGCGGCGGCCGGG - Intergenic
941639278 2:167969961-167969983 TGGCTGGAGCAGGAGCAGCAAGG - Intronic
942083988 2:172427695-172427717 TGGCTGCGGTAGCAGCAGCGCGG + Intronic
942241123 2:173964716-173964738 GGGCGGGGGCAGCAGCAGGAGGG - Intronic
942241244 2:173965119-173965141 CGGCGGCGGCGGCAGCAGCAAGG + Intronic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944875901 2:203963985-203964007 GGGCGGCAGCAGCCGCTGCAAGG + Intergenic
945173727 2:207021260-207021282 TGGCGGCAGCAGCCACTGCATGG - Intergenic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946219861 2:218217205-218217227 TGGCGGCGGCGGCGGCGGCTCGG + Exonic
946343168 2:219085563-219085585 TGGCGAGGTCGGCAGCAGCAGGG - Intronic
946431977 2:219631011-219631033 TGGCAGCAGTAGCAGCAGGATGG + Intronic
946886716 2:224228932-224228954 GGGCGGCAGCAGCTGCTGCACGG - Intergenic
946893492 2:224300312-224300334 GGGCGGCAGCAGCCGCTGCATGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947314024 2:228835578-228835600 AGACAGCAGCAGCAGCAGCAAGG - Intergenic
947954012 2:234171830-234171852 TGGATCCGGCAGCAGGAGCAGGG + Intergenic
948107666 2:235428157-235428179 TGTCGGGGGCAGGATCAGCAGGG + Intergenic
948737522 2:240018940-240018962 TGGTGGGGGCAGGAGCAGGATGG - Intronic
948843986 2:240674525-240674547 TGGCAGCAGAAGCAGCAGCAGGG - Intergenic
948849826 2:240700110-240700132 TGGCAGCAGAAGCAGCAGCAGGG + Intergenic
948937974 2:241180754-241180776 TGGTCGGGACAGCAGCAGCAGGG + Intronic
1168852526 20:986317-986339 TGGAGGCCACAGCAGCATCAGGG + Intronic
1169255051 20:4090884-4090906 TGGTGGCAGCAGCAGCATCCTGG - Intergenic
1170325239 20:15149684-15149706 GGGCGGCAGCAGCTGCTGCACGG + Intronic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170680186 20:18519458-18519480 GGGCGGCAGCAGCTGCCGCACGG + Intronic
1170889969 20:20368416-20368438 CGGCGGCGGCGGCAGCGGCCCGG - Exonic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1172932192 20:38594404-38594426 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1173250079 20:41359750-41359772 AGGCAGCGGCAGCAGCCGGACGG - Exonic
1173763529 20:45586064-45586086 GGGCGGCAGCAGCTGCTGCACGG + Intergenic
1173807408 20:45934915-45934937 TGGCGGCGGCAACAGAGACAGGG - Intronic
1173807441 20:45935023-45935045 TGGCGGCGGCAGCAGCGGAGGGG - Intronic
1174874707 20:54214781-54214803 TGGCACTGGCAGCAGCAGCTTGG - Intronic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175169927 20:57073066-57073088 TTTCGGGTGCAGCAGCAGCAAGG + Intergenic
1175215898 20:57391580-57391602 CGGCGCGGGCTGCAGCAGCATGG - Exonic
1175407174 20:58742787-58742809 GGGAGGAGGCAGCAGCTGCAGGG + Intergenic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175575641 20:60058574-60058596 ACGCAGCGGCAGCAGCAGCAAGG - Intronic
1175708135 20:61196445-61196467 TGGCTGGGGCAGCAGGAGCCAGG - Intergenic
1175715516 20:61252449-61252471 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1175956732 20:62614471-62614493 CGGAGGAGGCAGAAGCAGCAGGG + Intergenic
1176000955 20:62830880-62830902 TGGCGGAGGCAGTGGCATCAGGG + Intronic
1176093405 20:63328868-63328890 AGGCGGAGGAAGCAGCAGCCAGG - Intronic
1176681108 21:9819823-9819845 TGGCGGCAGCAGGAGCATCGCGG - Intergenic
1177100895 21:16896183-16896205 GGGCGGCAGCAGCTGCTGCACGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178319994 21:31597904-31597926 CGGCGGCAGCAGCAGCTGCAAGG + Intergenic
1178992417 21:37366875-37366897 TGGCGGCGGCAACCGCGGCGGGG + Intronic
1179828521 21:43981802-43981824 TGGCAGGGGCGGCAGGAGCAGGG - Intronic
1179906644 21:44426306-44426328 AGGCAGCGGAAGCAGCAGCCTGG - Intronic
1180226305 21:46394408-46394430 TGACGGCAGCGTCAGCAGCAGGG - Intronic
1180556773 22:16584591-16584613 TGGCGGCTGAAGCAGGAGAATGG + Intergenic
1180801456 22:18633958-18633980 TGGCGGCGGTGGAGGCAGCAGGG + Intergenic
1180852690 22:19029498-19029520 TGGCGGCGGTGGAGGCAGCAGGG + Intergenic
1181035393 22:20167604-20167626 GGGGAGCGGCAGCCGCAGCAGGG - Intergenic
1181175490 22:21032526-21032548 CGGCTGCGGCAGCAGCAGGTGGG - Exonic
1181220265 22:21361303-21361325 TGGCGGCGGTGGAGGCAGCAGGG - Intergenic
1181478025 22:23180573-23180595 CGGCGGCGGCGGCGGCGGCACGG + Exonic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181578945 22:23816281-23816303 TGACTGCAGTAGCAGCAGCAGGG - Intronic
1181648087 22:24244578-24244600 AGTCGGCGGCAACAGCAGCGTGG + Exonic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182255046 22:29031829-29031851 TGGTGGCGGCAACAGAAACAGGG + Intronic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182944679 22:34310778-34310800 TGGCAGAAGCAGCAGCTGCAGGG - Intergenic
1183001913 22:34867271-34867293 TGAGGGCAGAAGCAGCAGCAGGG - Intergenic
1183247219 22:36703246-36703268 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1183264806 22:36818570-36818592 AGGTGACGGCAGTAGCAGCAGGG - Intronic
1183359014 22:37373770-37373792 AGGAGGCGGCAGCAGCTGCAGGG + Exonic
1183359023 22:37373824-37373846 GGGAGGCGGCAGCAGCAGTGGGG - Exonic
1183441444 22:37825282-37825304 TGGCGGCGTCGGCGGCCGCACGG - Exonic
1183708142 22:39487583-39487605 GGGCGGCAGCGGCTGCAGCAGGG - Exonic
1183862392 22:40679493-40679515 TGGAGGCGGCAGCGGCTGCCAGG + Exonic
1183951968 22:41357393-41357415 TGGCGGTGGCAGCAGCAGCAGGG - Exonic
1184054521 22:42035421-42035443 GGGCGGCTGCAGCAGCATCCAGG + Intronic
1184148842 22:42627136-42627158 TGGCGGCCTTGGCAGCAGCACGG - Intronic
1184207650 22:43015134-43015156 TGGCGGCAGAAGCGGCCGCAGGG - Exonic
1184510509 22:44930573-44930595 GGGCAGAGGCACCAGCAGCAGGG + Intronic
1184762328 22:46551580-46551602 TGTCGGGGCCTGCAGCAGCATGG - Intergenic
1184778183 22:46633595-46633617 TCCCGTTGGCAGCAGCAGCAAGG - Intronic
1184850642 22:47117619-47117641 TGGCAGCGGCCGCAGGAGCGAGG + Intronic
949351275 3:3126965-3126987 TGGCGGCTGCGGCAACAGCGGGG + Exonic
949490145 3:4581192-4581214 TTGCCGAGGCAGCATCAGCAGGG + Intronic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
949875340 3:8623026-8623048 TGGCTGCAGCAGCAGCAGAAGGG + Intronic
950168062 3:10816337-10816359 GGGTGGCGGCTGCAGCAGCGGGG + Exonic
950505314 3:13391003-13391025 TGGGGGCTGCAGAAGCAGCCAGG + Intronic
950660103 3:14461879-14461901 TCTGGGCAGCAGCAGCAGCAGGG - Intronic
952190105 3:31014134-31014156 TGGCTGCAGCTGGAGCAGCAGGG - Intergenic
952316608 3:32238143-32238165 TGGCGGCGGCCGCAGCAGGAGGG + Intergenic
952408340 3:33025743-33025765 TGGCGGTGGGAGCAGCTGCAGGG + Intronic
953947779 3:47164026-47164048 CGGCGGCGGCGGCGGCGGCAGGG + Intergenic
954154610 3:48678536-48678558 TGGAGGTGGCTGCAGCAGCGGGG - Intronic
954304489 3:49718228-49718250 GCACGGCGGCAGCAGCGGCAGGG + Exonic
954365582 3:50144445-50144467 TGGCCGAGGCAGAGGCAGCAGGG - Intergenic
954408426 3:50358533-50358555 CAGCAGCGCCAGCAGCAGCATGG + Exonic
954419870 3:50413115-50413137 TGGCAGCGGCAGCAGCAGCTGGG - Intronic
954615555 3:51967344-51967366 CGGCGGCGGCGGCGGCGGCACGG + Exonic
955506557 3:59638758-59638780 TGGTGGTGGCAGTGGCAGCAAGG - Intergenic
956170851 3:66432299-66432321 TGGAGGCCGCAGAAGCACCAGGG - Intronic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956371874 3:68571571-68571593 TGGCAGTGGCAGTGGCAGCATGG - Intergenic
956417863 3:69052107-69052129 TGGCGGCGGCAGCACCAAGCGGG + Exonic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
962173974 3:133133152-133133174 TTGATGCAGCAGCAGCAGCAGGG + Intronic
962212741 3:133492313-133492335 TGGCAGCAGCTGCAGCAGCATGG - Intergenic
962660885 3:137599330-137599352 GGGCGGCAGCAGCTGCTGCACGG - Intergenic
963150863 3:142044204-142044226 CGGCGGCGGCAGCAGCAAAAGGG + Intronic
963240909 3:143001589-143001611 CTTCGGCGGCGGCAGCAGCACGG - Exonic
963456446 3:145553253-145553275 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
963602555 3:147390836-147390858 AGGCGGCGGCGGCAGCAGCAGGG + Intronic
963615274 3:147528733-147528755 TGCCAGCAGCTGCAGCAGCATGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964068110 3:152601090-152601112 GGGCGGCAGCAGCTGCTGCATGG - Intergenic
964118909 3:153162437-153162459 CCGCGGCGGCAGCAGCAGCCCGG - Exonic
965262399 3:166502638-166502660 GGGCGGCAGCAGCCGCTGCATGG + Intergenic
965639761 3:170819653-170819675 GGGCGGCAGCAGCCGCTGCACGG + Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966686869 3:182705142-182705164 AGGAGGCAGCAGCAGAAGCAGGG + Intergenic
966852072 3:184170598-184170620 CGGCGGGGGCATCATCAGCATGG - Exonic
967657893 3:192073154-192073176 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
967982952 3:195076589-195076611 GGGCGGCTTCAGCAGCAGAAAGG + Intronic
968132047 3:196197681-196197703 TGGGGGCTCCTGCAGCAGCAGGG + Exonic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968625060 4:1623316-1623338 TGGGGGTGGCAGCAGGAGCCAGG - Intronic
968775444 4:2536996-2537018 CGGCGGCGCGAGCAGCGGCAAGG + Intronic
969018061 4:4118261-4118283 TGGCGGCGGCAGCTGTCACAGGG - Intergenic
969467485 4:7366334-7366356 TGGTGGCTGGAGCTGCAGCAGGG + Intronic
969746776 4:9078951-9078973 CGGCGGCAGCAGCAGCTGGAGGG - Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
971036950 4:22704120-22704142 TGGTGCCGTCAGCAGCAGCTGGG + Intergenic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
972246002 4:37245507-37245529 TGGTGGCGGCGGCGGCAGAATGG - Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
975585063 4:75940887-75940909 GGCCAGCAGCAGCAGCAGCAGGG + Exonic
976122922 4:81802592-81802614 TTGCAGCTGCAGTAGCAGCAGGG + Intronic
976246470 4:83010793-83010815 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
976719351 4:88154896-88154918 GGGCGGCGGCAGCCACTGCACGG + Intronic
978438831 4:108712792-108712814 GGGCGGCAGCAGCTGCTGCACGG - Intergenic
978596250 4:110380109-110380131 TGGCAGTGGCAGTGGCAGCATGG - Intronic
979054404 4:115977726-115977748 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
979716999 4:123851867-123851889 TGGCGGCAGCAGGAGGAGAAGGG - Intergenic
979832042 4:125315658-125315680 CGGCGGCGGCGGCTGCAGGAGGG + Intergenic
980792032 4:137632457-137632479 TGCCAGCAGCAGCAGCAGCATGG - Intergenic
980917067 4:139043453-139043475 TGGAGGTGACTGCAGCAGCATGG + Intronic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981803205 4:148681984-148682006 TAGTGGCAGCAGCAACAGCATGG + Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
984057539 4:174948649-174948671 TGCCAGCAGCTGCAGCAGCATGG + Intronic
985599091 5:816344-816366 AGATGGCGGCAGCAGCTGCACGG + Intronic
985629986 5:1009168-1009190 GGGCGGCGGCGGCTGCGGCACGG - Exonic
985896304 5:2751590-2751612 CGGTGGCGGCGGCAGCAGCGCGG + Exonic
985939907 5:3127077-3127099 TGATGGCAGCAGAAGCAGCAGGG - Intergenic
986297048 5:6448621-6448643 TGGCAGCAGCAGCAGCACCCCGG + Exonic
986456756 5:7927613-7927635 TGGCAGCATCAGCAGCAGCCAGG + Intergenic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987878640 5:23712196-23712218 TGGGGGCTGCTGCAGGAGCAGGG + Intergenic
988437534 5:31193822-31193844 CGGCGGAGGCAGGAGCAGCCTGG + Exonic
988547688 5:32173923-32173945 CGGCGGCGCCGGCAGCAGCGAGG - Exonic
988617746 5:32792238-32792260 TGGCAGCAGCAGCAGGATCAGGG - Intergenic
989188336 5:38645942-38645964 TGAAGGCAGCTGCAGCAGCAAGG - Intergenic
991371753 5:65926197-65926219 TGGCGGCGGCAGCGGCGTCGCGG + Intergenic
991549155 5:67817689-67817711 TGGTGGAGGCCGCAGAAGCAGGG + Intergenic
992105525 5:73447222-73447244 CGGCGGCGGCAGCGGCGGCCGGG + Exonic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
994775891 5:104035251-104035273 GGGCAGCGGCAGCTGCTGCACGG - Intergenic
995224710 5:109689806-109689828 CGGCGGCGGCAGCAGCACGAAGG + Exonic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997635130 5:135399074-135399096 TGGCGGCGGCGGCAGCTGCAAGG + Exonic
997869970 5:137498517-137498539 TGGCGGCGGCCGCCGCGGCGTGG - Exonic
997887270 5:137641412-137641434 TGGCAGCAGCAGCAGCACCTGGG - Intronic
999062806 5:148654127-148654149 CAGCGGCGGCAGCAGAAGCTCGG - Exonic
999244591 5:150147237-150147259 TGGGGAGGGCAGCAGCAGGATGG - Intronic
1000279899 5:159773412-159773434 CGGCGGCGGCGGCAGCAGCCGGG + Intergenic
1002134209 5:177098009-177098031 ACGCTGGGGCAGCAGCAGCAGGG - Exonic
1002158973 5:177303826-177303848 CGGCGGCGGCGGCAGCTGCTTGG + Exonic
1002202262 5:177536533-177536555 GGGCAGTGGCAGCAGCAACAGGG + Exonic
1002524237 5:179806663-179806685 AGGCGGCGGCGGCGGCGGCAGGG + Intronic
1002661181 5:180792073-180792095 CGGCGGCCGGAGCAGCGGCAGGG - Exonic
1003608228 6:7584960-7584982 TGTCGGCACCAGCAGCAGCATGG + Exonic
1003645306 6:7909883-7909905 CGGTGGCCGCGGCAGCAGCAAGG + Intronic
1004507782 6:16261061-16261083 GGACGGCGGCAGCCGCTGCACGG + Intronic
1004589128 6:17031763-17031785 TGTGGGTGGCAGCAGCAGTAAGG - Intergenic
1004768359 6:18756139-18756161 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1004837250 6:19542756-19542778 GGGCGGCAGCAGCTGCTGCACGG - Intergenic
1004924105 6:20402561-20402583 TGGTGGCTGCTGCAGCAGCCCGG - Exonic
1005040309 6:21595044-21595066 CGGCGGCGGGAGCAGCAACGCGG + Exonic
1005896298 6:30182062-30182084 TGGCGGCAGCAGCCCCAGCCAGG + Intergenic
1007409385 6:41653216-41653238 CTGCGGCAGCGGCAGCAGCAGGG - Intronic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007625339 6:43243496-43243518 CGGCGGCGGCAGCGGCAGAGCGG - Intergenic
1007625399 6:43243654-43243676 CGGCGGCGGAGGCAGCAGCTCGG - Intergenic
1008941105 6:57046692-57046714 TGGTGGCGGCTGCGGCAGTAGGG + Exonic
1009243445 6:61205314-61205336 TGGAGGGGGCACCAGGAGCAGGG + Intergenic
1010184324 6:73125400-73125422 TGGCAGAGGCAGAACCAGCAAGG + Intronic
1011722837 6:90176769-90176791 TGGAGGAGGCAGGAGCAGGAGGG - Intronic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012449313 6:99338472-99338494 TGGTGGCTGCAGCAGCTGCCAGG - Intronic
1013422516 6:109979177-109979199 CGGCGGCGGCCACAGCAGCAGGG + Exonic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014874689 6:126643480-126643502 CGGCGGCGGCGGCAGCTGCTTGG + Intergenic
1015799336 6:137044684-137044706 CGGCAGCGGCAGCGGCCGCAGGG + Exonic
1015895018 6:138008611-138008633 GGGCGCCAGCAGCAGCAGCCTGG - Intergenic
1016923437 6:149317788-149317810 TGGCGGCGGCGGCGGCCGGAGGG + Intronic
1016969536 6:149749610-149749632 TGGCAGCGGTAGCAGCCACAGGG + Exonic
1017182206 6:151564479-151564501 TGGCAGTGGCAGCAGCAGGTGGG + Intronic
1017779131 6:157702724-157702746 GGGCGGCAGCAGCCGCTGCACGG + Intronic
1017812916 6:157996991-157997013 AGACGGAGGCAGCAGCAGCCAGG - Intronic
1018084277 6:160288644-160288666 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018516376 6:164584261-164584283 TGGCAGAGGCAGCATCGGCAGGG + Intergenic
1019049931 6:169175041-169175063 CGGGGGCGGAAGGAGCAGCAGGG - Intergenic
1019531175 7:1504216-1504238 TGGAGGCGGCAGAACCAGAAGGG + Intronic
1019642163 7:2109335-2109357 AAGCGGCTGCAGCAGCCGCAGGG + Intronic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1019989613 7:4682457-4682479 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
1020034938 7:4959085-4959107 CGGCGGCGGCAGCAGCAGGTTGG + Exonic
1020326680 7:6979626-6979648 CGGCGGCAGCAGCAGCTGGAGGG + Intergenic
1020445399 7:8262215-8262237 TGGTGGCGGCCGCCGCAGGAAGG - Exonic
1020735952 7:11949819-11949841 TGCCAGCTGCAGCAGAAGCATGG + Intergenic
1022202689 7:28132897-28132919 TTGCTACTGCAGCAGCAGCATGG - Intronic
1022207658 7:28179932-28179954 CGGCGGCGGCTGCAGCCGCGGGG - Intronic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1023607445 7:41943219-41943241 ACGCGGTGGCAGCAGCAGCATGG + Intergenic
1023801498 7:43838962-43838984 TGGCGGCCGCAGTAGGAGCACGG + Intergenic
1024673775 7:51620065-51620087 TGACAGGGCCAGCAGCAGCATGG - Intergenic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1025829645 7:65038265-65038287 CGGCGGCGGCCGCGGCAGCTGGG + Intergenic
1025955101 7:66176763-66176785 TGGAGGCGGAAGCAGCAGGATGG - Intergenic
1026786492 7:73304824-73304846 TGGCGGGGGGTCCAGCAGCATGG + Exonic
1026822278 7:73557578-73557600 TGGCGGCGGCGGGAGCGGCGGGG + Exonic
1027138199 7:75639204-75639226 CGGCGGCGGCGGCGGCACCAAGG + Intronic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1027760758 7:82276430-82276452 TGGCCGTGGCAGCAACATCAGGG + Intronic
1029110982 7:98212900-98212922 TGGCGGTGGCCGCAGCTGCCTGG + Exonic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029437769 7:100572539-100572561 GGGCGGCGGCAGCAGTTTCAGGG + Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029458468 7:100682675-100682697 TGGGGGCGGCAGCAGCGGCCTGG - Exonic
1029896399 7:103989353-103989375 CGGCGGCGGCGGCGGCGGCATGG - Exonic
1031500619 7:122510646-122510668 TGGCAGCGGCAGACACAGCAGGG + Intronic
1031899307 7:127392367-127392389 TGGCGGCGGCAGCTGCTGCCGGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1033033219 7:137846781-137846803 CGGCGGCGGCTGCAGGAGCGCGG + Exonic
1033087121 7:138352927-138352949 TGGCTGGGGCTGCAACAGCATGG - Intergenic
1033475700 7:141690195-141690217 TGGTGGCTGCAGCATCATCAGGG - Intronic
1034306362 7:150047957-150047979 GGGAGGCAGCAGCAGCAGCAAGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034977862 7:155458467-155458489 CGGCGGCGGCGGTAGCAGCCCGG + Exonic
1035013761 7:155745051-155745073 TTACGGCGGCAGCAGCAGGCTGG + Exonic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035388514 7:158490073-158490095 TGGCCGCGGGAGCAGCAGCGGGG + Intronic
1036633452 8:10531420-10531442 GGGCGAAGCCAGCAGCAGCAAGG - Exonic
1036639751 8:10575284-10575306 TGGAGGCAGCAGCTGCTGCACGG - Intergenic
1037818348 8:22123753-22123775 TGGCAACGGCTGCAGCAGCGTGG + Exonic
1037822032 8:22139720-22139742 TGGTGGCGGCAGCTGGAGCATGG - Intronic
1037901764 8:22692952-22692974 TGGCGGCGGCGGCGGCAGCTCGG - Exonic
1038296001 8:26291546-26291568 CGGCGGCGGCGGCAGCGGCAGGG - Intronic
1038428454 8:27480762-27480784 TGGCAGCGGTGGCAGCAGCAGGG - Intergenic
1038727611 8:30095452-30095474 CGGCGGCAGCAGCGGCAGCCGGG - Intronic
1039467851 8:37796904-37796926 CGGCGGCGGCAGCAGGAGCCCGG + Intronic
1039558825 8:38496607-38496629 AGGGGGCGGCAGCAGCTGCTGGG - Intergenic
1039879435 8:41615280-41615302 TGGTGGCGGCAGCAGCATGCAGG - Intronic
1040548380 8:48419786-48419808 TGGCGCCCACAGCAGCAGGAGGG - Intergenic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041381674 8:57259187-57259209 TGCCGGCGCCACCAGCAGCGCGG + Intergenic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042951441 8:74204227-74204249 TGGCAGCAGCTGCAGCAGCCAGG + Intergenic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1045305228 8:100951985-100952007 CGGCGGCGGCAGCAGCGGCGAGG + Exonic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1046654211 8:116874713-116874735 TGGCGGCGGCGGGAGCTGCTCGG - Exonic
1046871299 8:119208393-119208415 CGGCGGCGGCGGCAGGAGCCCGG + Exonic
1047454686 8:124998383-124998405 GGCCGGCGGCGGCAGGAGCAGGG + Intergenic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047769481 8:128019154-128019176 TGGAGGCAGCAGCAGCATCCTGG - Intergenic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048305033 8:133278216-133278238 TGGCTGTGGCACCAGCACCATGG - Intronic
1048492025 8:134902689-134902711 TGGCAGAGGTAGCAGGAGCAAGG - Intergenic
1048575001 8:135683343-135683365 CGGGACCGGCAGCAGCAGCAGGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1049260507 8:141636463-141636485 TCTCGGCAGCAGCTGCAGCAGGG - Intergenic
1049264644 8:141660910-141660932 TGGCAGAGGCAGCAGCAGATCGG + Intergenic
1049378539 8:142300971-142300993 TGGAGGGGGCGGCCGCAGCATGG - Intronic
1049434238 8:142579152-142579174 TGCCGGCCGCCCCAGCAGCAAGG - Intergenic
1049689332 8:143951877-143951899 TGGGGGCGGCAGCAGCGGGGCGG - Intronic
1049793128 8:144482069-144482091 CGGCGGCGGCGGCGGCAGCCGGG - Intronic
1050437927 9:5629190-5629212 CGGCGGCGGCGGCGGCAGCTCGG - Exonic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1051116169 9:13697343-13697365 TGCCTGCGGCAGTTGCAGCAAGG + Intergenic
1051287426 9:15510935-15510957 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1052888798 9:33676869-33676891 TGGCAGCGGCGGCAGCGGAATGG + Intergenic
1053128044 9:35598898-35598920 GGGCGGCTGCAGCAGCACCCAGG - Intergenic
1053445010 9:38146114-38146136 TGGAGGGGGCTGAAGCAGCAGGG - Intergenic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053707355 9:40768631-40768653 TGCCAGCGCCACCAGCAGCATGG - Intergenic
1053874086 9:42525159-42525181 TGGCGGCAGAAGCAGGAGAACGG - Intergenic
1054160924 9:61671722-61671744 TGGCGGCAGCAGGAGCATCGCGG - Intergenic
1054173107 9:61857838-61857860 TGGCGGCAGCAGGAGCATCGCGG + Intergenic
1054268248 9:62941595-62941617 TGGCGGCAGAAGCAGGAGAACGG + Intergenic
1054417269 9:64889399-64889421 TGCCAGCGCCACCAGCAGCATGG - Intergenic
1054447960 9:65386880-65386902 TGGCGGCAGCAGGAGCATCGCGG + Intergenic
1054664435 9:67722943-67722965 TGGCGGCAGCAGGAGCATCGCGG - Intergenic
1054833102 9:69648005-69648027 TGGTGGGGGCGGCTGCAGCATGG - Intronic
1055201432 9:73667316-73667338 TGGCAACAGCAGCAGCAACAGGG - Intergenic
1055989346 9:82088768-82088790 TTGCGGCGGCAGCGACAGCTGGG + Intergenic
1056379859 9:86047273-86047295 AGTGGGCGGCAGCAGCAGCCAGG + Intronic
1056773943 9:89498044-89498066 CGGCGGCGGCAGCGGCGGCTGGG + Intronic
1057327020 9:94074745-94074767 TGCTTGGGGCAGCAGCAGCAGGG + Intronic
1057489142 9:95508358-95508380 CGGCGGCGGCGGCGGCAACATGG - Exonic
1057631887 9:96725853-96725875 GGGTGGCGGCAGCGACAGCAGGG + Intergenic
1057869710 9:98708687-98708709 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1057996132 9:99822761-99822783 CGGCGGCAGCGGCAGCGGCAGGG + Intronic
1058058675 9:100473679-100473701 TGGTGGCGGCGGCAGCGGCGGGG + Exonic
1058387903 9:104460517-104460539 GGGCCAAGGCAGCAGCAGCAGGG - Intergenic
1059110128 9:111549642-111549664 TGGTGGTGGCAGCGGCAGCAGGG + Intronic
1059342899 9:113609543-113609565 TGGCAGCGACAGCAGAAGCAAGG - Intergenic
1060283508 9:122228918-122228940 AGGCAGCGGCGGCAGCAGCCAGG - Intronic
1060318254 9:122532709-122532731 GGGCGGCAGCAGCCGCTGCACGG + Intergenic
1061835242 9:133324274-133324296 TGGCGGGGGAGGCAGCAGCAGGG + Intergenic
1061849662 9:133406922-133406944 GCGGGGCGGCAGCAGCAGCAGGG + Exonic
1061943066 9:133893350-133893372 AGGCGGCGGCAACAGCAGCTGGG + Intronic
1061968866 9:134032741-134032763 GTGGCGCGGCAGCAGCAGCAGGG + Exonic
1062064191 9:134517553-134517575 TGGCTGCGGGAGCAGCTGCCAGG - Intergenic
1062212192 9:135371168-135371190 TGGCGGCGGCCTGGGCAGCAGGG - Intergenic
1062236157 9:135508720-135508742 TGGGTGGGTCAGCAGCAGCATGG + Intergenic
1062305762 9:135906702-135906724 TGGCGGCGGCGGCGGCGGGAAGG - Intronic
1062692237 9:137848134-137848156 GGGCGGCAGCAGCCGCTGCATGG - Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187326445 X:18295040-18295062 TGGCGGCTGTGGTAGCAGCAGGG - Intronic
1187856052 X:23637039-23637061 TGGTGGCAGCAGCAGCAGCTGGG - Intergenic
1188727823 X:33607211-33607233 TGGCGGGGGCTGAGGCAGCAGGG + Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189310547 X:40014642-40014664 TGGGGGCGGCTCCAGCCGCACGG - Intergenic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1189821479 X:44873366-44873388 AGGCGGCGGCGGCGGCGGCAGGG - Intronic
1190234457 X:48605012-48605034 TGGAGGCGGGAGCAGAAGTAGGG + Exonic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190369441 X:49727099-49727121 TGGAGGGGGCAGAGGCAGCAGGG - Intergenic
1191757818 X:64613333-64613355 TGGCGGTGTCGGCAGCAGCAGGG + Intergenic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192363282 X:70452473-70452495 CGGCGGCGGCAGCGGCTGCGCGG + Intronic
1192451681 X:71248768-71248790 CTGCGGCGGCAGAAGCTGCAGGG + Exonic
1192557459 X:72101755-72101777 TGGAGGAGGCAGCAGTAGGAAGG - Intergenic
1193469030 X:81876732-81876754 TGGTGGCAGCAGTTGCAGCAGGG - Intergenic
1193697357 X:84724908-84724930 TGGCAGCTGCAGCAGTGGCATGG - Intergenic
1193823606 X:86195598-86195620 TGCCAGCAGCAGCAGTAGCATGG - Intronic
1194265177 X:91744228-91744250 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196214622 X:113035924-113035946 CAGTGGCGGCAGCAGCAGCTTGG - Intergenic
1196300243 X:114043833-114043855 AGGCGGCAGCAGCTGCTGCATGG - Intergenic
1196473678 X:116058319-116058341 CTGCAGTGGCAGCAGCAGCATGG + Intergenic
1197141559 X:123122467-123122489 TGTCAGCAGCAGCAGCAGCTTGG - Intergenic
1197782446 X:130171696-130171718 CGGCGGCGGCTGGAGCAGCGCGG + Exonic
1198471120 X:136948139-136948161 TGGCGGCAGCAGAGGCAGAAAGG + Intergenic
1198667255 X:139038146-139038168 TGGAGAGGGCAGCAGCTGCATGG - Intronic
1198797658 X:140416179-140416201 TGGCTGCAGGAGCAGCAGCTGGG - Intergenic
1199500387 X:148500731-148500753 CGGCGGCGGCAGCGGCGGCGGGG - Exonic
1200100661 X:153688028-153688050 TGGCGGCGGCGGCGGCGGCTCGG - Intronic
1200123723 X:153803528-153803550 TGCCTGCGGGAGCAGCAGAATGG - Exonic
1200126820 X:153819124-153819146 TGGCTGCGGCTGCGGGAGCAGGG + Intronic
1200582329 Y:4964674-4964696 TGGCAGCAGCAGCAGCTGCATGG - Intergenic