ID: 1073535096

View in Genome Browser
Species Human (GRCh38)
Location 10:104269193-104269215
Sequence GCTGCTGCCGCCGCCAATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535092_1073535096 -9 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535090_1073535096 1 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535088_1073535096 3 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535093_1073535096 -10 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535091_1073535096 -8 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210
1073535089_1073535096 2 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535096 10:104269193-104269215 GCTGCTGCCGCCGCCAATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535096 Original CRISPR GCTGCTGCCGCCGCCAATCC TGG Exonic