ID: 1073535097

View in Genome Browser
Species Human (GRCh38)
Location 10:104269198-104269220
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535093_1073535097 -5 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535090_1073535097 6 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535089_1073535097 7 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535091_1073535097 -3 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535088_1073535097 8 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535092_1073535097 -4 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1073535094_1073535097 -8 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535097 10:104269198-104269220 TGCCGCCGCCAATCCTGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type