ID: 1073535098

View in Genome Browser
Species Human (GRCh38)
Location 10:104269200-104269222
Sequence AACCGGACCAGGATTGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535098_1073535112 28 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535112 10:104269251-104269273 ACCTCTCTCACCGCCACCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1073535098_1073535102 -9 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535098_1073535111 25 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535098_1073535107 4 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535098_1073535104 -6 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535098_1073535114 29 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535114 10:104269252-104269274 CCTCTCTCACCGCCACCGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 63
1073535098_1073535108 5 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535098 Original CRISPR AACCGGACCAGGATTGGCGG CGG (reversed) Exonic
901683018 1:10926484-10926506 AAACAGTCCAGGATTGGTGGAGG - Intergenic
902490900 1:16779647-16779669 AACTGGACCAGCCTTGGCTGTGG + Intronic
907537634 1:55179554-55179576 AAGGGGACCAGGATTTACGGGGG - Intronic
923529545 1:234802889-234802911 AACTGGACCAGCCTTGGCTGTGG - Intergenic
1072470245 10:95706877-95706899 ACCCGGGCCATGAATGGCGGCGG - Intergenic
1073535098 10:104269200-104269222 AACCGGACCAGGATTGGCGGCGG - Exonic
1092829422 12:12429440-12429462 ACCCGGGGCAGGATTTGCGGTGG + Intronic
1096181371 12:49552491-49552513 AACCCGACCATGATTGGGGTCGG - Intronic
1127960251 15:63885233-63885255 ATCAGGACCAGGATTGTGGGAGG + Intergenic
1135026951 16:19006046-19006068 AACCGGATGAGGATGGGCAGGGG - Intronic
1152494456 17:80661128-80661150 CACGGGACCAGGATTGGAAGTGG + Intronic
1161479694 19:4504363-4504385 AACCGATCCAGGTTTGGGGGCGG + Exonic
1162720356 19:12658283-12658305 AACCGGTCCAGAACTGGTGGGGG + Exonic
939299479 2:140317107-140317129 AAGCGGACCTGGATTGGAGAGGG + Intronic
1169807442 20:9574058-9574080 AACAGGACCAGGCTTGGCTTTGG + Intronic
1170619977 20:17987844-17987866 AACCCGACCAGGATAGGGGATGG + Intronic
1180235863 21:46459076-46459098 AACCGGACCGGGCCTGGCGGCGG - Intronic
1180641183 22:17300759-17300781 AACCAGACCAGTATGGGCTGTGG + Intergenic
1182468738 22:30533957-30533979 AACAGGACCAGGCTAGGCAGGGG + Intronic
1183436820 22:37801153-37801175 AACTGGAGCAGGGTTGGGGGTGG - Intergenic
1184982448 22:48104079-48104101 AAACGGACCAGGATGGGGAGTGG + Intergenic
956978986 3:74614667-74614689 AGCCGGAGCCGGAGTGGCGGAGG - Intergenic
965667867 3:171115335-171115357 TACCGGACCAGGATTAGGGATGG + Intronic
973134837 4:46694564-46694586 AACAGGACAAGGATTGGATGTGG - Intergenic
1001088737 5:168721288-168721310 ATCAGGCCCAGGATTGGGGGTGG + Intronic
1003073449 6:2962380-2962402 AACCAGACCAGGATATTCGGAGG + Intronic
1003362705 6:5444015-5444037 AACCAGACAGGGATTGGTGGTGG + Intronic
1007787703 6:44290716-44290738 AGCAGGACCAGGCTTGGCAGGGG + Intronic
1011668843 6:89662791-89662813 AACAGGACCAGGAATGGATGAGG - Exonic
1032344887 7:131108202-131108224 AACAGCAGCAGGACTGGCGGCGG + Intergenic
1036280509 8:7396188-7396210 CAACGGACCAGGATGGGAGGTGG + Intergenic
1036340960 8:7915382-7915404 CAACGGACCAGGATGGGAGGTGG - Intergenic
1038332643 8:26621410-26621432 AACCGGACCAGCTTTTGCTGCGG - Intronic
1047482829 8:125301153-125301175 AACTTGAGCAGGATTGGCTGGGG + Intronic
1048073174 8:131041620-131041642 AACCGGGCCGGGGGTGGCGGAGG + Exonic
1053045784 9:34915926-34915948 AACAGCACCAGGGTTGGTGGTGG - Intergenic
1055146876 9:72946323-72946345 AATGGGACCAGGGTTGGGGGAGG + Intronic
1056937956 9:90932217-90932239 AACAGGACCAGTAATGGCAGAGG + Intergenic
1057268818 9:93635844-93635866 GACAGGCCCAGGGTTGGCGGTGG + Intronic
1057294249 9:93826322-93826344 AACCGGAACGGGAATGGTGGCGG - Intergenic
1057408123 9:94792077-94792099 AACAGGACCAGGATTAGAGCTGG - Intronic
1060796613 9:126516342-126516364 AACAGGACCTGGAGTGGTGGGGG - Intergenic
1192569345 X:72190049-72190071 CAGAGGAACAGGATTGGCGGAGG - Intronic