ID: 1073535098

View in Genome Browser
Species Human (GRCh38)
Location 10:104269200-104269222
Sequence AACCGGACCAGGATTGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535098_1073535108 5 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535108 10:104269228-104269250 AGTTCCCGGAGGTCTCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1073535098_1073535112 28 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535112 10:104269251-104269273 ACCTCTCTCACCGCCACCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1073535098_1073535114 29 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535114 10:104269252-104269274 CCTCTCTCACCGCCACCGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 63
1073535098_1073535104 -6 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535104 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1073535098_1073535102 -9 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535098_1073535107 4 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535098_1073535111 25 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535098 Original CRISPR AACCGGACCAGGATTGGCGG CGG (reversed) Exonic