ID: 1073535102

View in Genome Browser
Species Human (GRCh38)
Location 10:104269214-104269236
Sequence GGTCCGGTTGCCCGAGTTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 48}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535090_1073535102 22 Left 1073535090 10:104269169-104269191 CCGTCTAGGCCCCGCCTCCTTGC 0: 1
1: 0
2: 4
3: 21
4: 290
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535092_1073535102 12 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535089_1073535102 23 Left 1073535089 10:104269168-104269190 CCCGTCTAGGCCCCGCCTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535091_1073535102 13 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535088_1073535102 24 Left 1073535088 10:104269167-104269189 CCCCGTCTAGGCCCCGCCTCCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535098_1073535102 -9 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535093_1073535102 11 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535095_1073535102 5 Left 1073535095 10:104269186-104269208 CCTTGCTGCTGCTGCCGCCGCCA 0: 1
1: 3
2: 12
3: 119
4: 671
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1073535094_1073535102 8 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535102 Original CRISPR GGTCCGGTTGCCCGAGTTCC CGG Exonic
900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG + Intergenic
900350712 1:2233241-2233263 GGTCCTGTTCCCAGAGGTCCGGG + Intronic
900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG + Intergenic
912652127 1:111449038-111449060 GGTCCGGTGAGCCGAGATCCCGG - Exonic
1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG + Intergenic
1065259215 10:23907537-23907559 GGTCCGATAGCCCAAGTTCCTGG + Intronic
1070913610 10:80138641-80138663 GGTCAGGGTGCCTGAGGTCCAGG + Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG + Intronic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1083894623 11:65613841-65613863 GGCCCGGATGCCCAGGTTCCGGG - Exonic
1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG + Exonic
1088182505 11:107128300-107128322 GCTCAGGTTGCCTGATTTCCTGG + Intergenic
1092230534 12:6773347-6773369 GGTCCTGTTGCCCAAGTTTGGGG - Intronic
1093984805 12:25518809-25518831 GGTCTGGTTGACCGAGTCCTGGG + Exonic
1102806646 12:115787311-115787333 GCTCCACTTTCCCGAGTTCCAGG + Intergenic
1117490388 14:56241055-56241077 GGTCCAGTTTCCAGTGTTCCAGG - Intronic
1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG + Exonic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1139509028 16:67416050-67416072 GAGCCGGTGGCCTGAGTTCCAGG - Intronic
1139891831 16:70258088-70258110 GGTCCCGGTGTCCGAGTTGCTGG - Exonic
1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG + Exonic
1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG + Intergenic
1147427962 17:40355267-40355289 GGTCCGGCTGCTCCAGGTCCTGG - Exonic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1167612782 19:50515302-50515324 GGTCAAGGTGCCCGAGTTGCAGG - Intergenic
938265955 2:129928401-129928423 GGTGAGGGTGCCTGAGTTCCAGG - Intergenic
944937427 2:204583940-204583962 GGCCTGCTTGCCCAAGTTCCTGG + Intronic
946765316 2:223035383-223035405 GGTCTGGATGCCTGGGTTCCAGG - Intergenic
1174172298 20:48625274-48625296 GGGCTGGTGGCCCCAGTTCCAGG + Exonic
1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG + Intronic
1181555669 22:23670485-23670507 GGTCCACTTGCCCGGTTTCCAGG + Intergenic
1183102768 22:35594007-35594029 GGTCTGAATGCCAGAGTTCCGGG - Intergenic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
984920845 4:184762890-184762912 GGCCCGGTGGCCTCAGTTCCTGG - Intronic
985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG + Intergenic
985384306 4:189429306-189429328 TGTCCGCTTGGCCGAGTCCCTGG - Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
1004283516 6:14300385-14300407 GGCCCGGTGGCCAGATTTCCGGG + Intergenic
1017313531 6:153002490-153002512 GGTCAGGAGGCCCGAGTTGCTGG - Exonic
1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG + Intergenic
1035728246 8:1838086-1838108 TGTCCTGTTCCCCGAGGTCCTGG + Intronic
1044277232 8:90316003-90316025 GGTCCTGTTTCCCTACTTCCTGG + Intergenic
1047998662 8:130358831-130358853 GCTCCGGAAGCCCGAGTCCCTGG + Intronic
1049054563 8:140225640-140225662 GGTCCGCTTGACCTGGTTCCTGG - Intronic
1050401365 9:5259294-5259316 GGTCTGGCTGCCTGAGATCCGGG + Intergenic
1052772623 9:32703602-32703624 GGAATGGTTGGCCGAGTTCCTGG - Intergenic
1060832074 9:126723070-126723092 GGTCCCGATCCCCGAGTGCCTGG - Intergenic
1060929395 9:127479421-127479443 GCTCCCGCTGCCCCAGTTCCAGG - Exonic
1062344293 9:136107718-136107740 GTTCCGGTTGGCCCAGCTCCAGG + Intergenic
1198432084 X:136577556-136577578 GGTCCTGTTGCCCTAGTTTCAGG + Intergenic
1198636945 X:138711459-138711481 CGTCCGGCCGCCCGAGCTCCCGG - Exonic