ID: 1073535107

View in Genome Browser
Species Human (GRCh38)
Location 10:104269227-104269249
Sequence GAGTTCCCGGAGGTCTCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535094_1073535107 21 Left 1073535094 10:104269183-104269205 CCTCCTTGCTGCTGCTGCCGCCG 0: 1
1: 0
2: 7
3: 87
4: 550
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535101_1073535107 -7 Left 1073535101 10:104269211-104269233 CCTGGTCCGGTTGCCCGAGTTCC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535091_1073535107 26 Left 1073535091 10:104269178-104269200 CCCCGCCTCCTTGCTGCTGCTGC 0: 1
1: 0
2: 2
3: 84
4: 611
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535092_1073535107 25 Left 1073535092 10:104269179-104269201 CCCGCCTCCTTGCTGCTGCTGCC 0: 1
1: 0
2: 7
3: 106
4: 846
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535098_1073535107 4 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535093_1073535107 24 Left 1073535093 10:104269180-104269202 CCGCCTCCTTGCTGCTGCTGCCG 0: 1
1: 0
2: 6
3: 61
4: 579
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535099_1073535107 1 Left 1073535099 10:104269203-104269225 CCGCCAATCCTGGTCCGGTTGCC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535100_1073535107 -2 Left 1073535100 10:104269206-104269228 CCAATCCTGGTCCGGTTGCCCGA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1073535095_1073535107 18 Left 1073535095 10:104269186-104269208 CCTTGCTGCTGCTGCCGCCGCCA 0: 1
1: 3
2: 12
3: 119
4: 671
Right 1073535107 10:104269227-104269249 GAGTTCCCGGAGGTCTCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073535107 Original CRISPR GAGTTCCCGGAGGTCTCTCG CGG Exonic