ID: 1073535111

View in Genome Browser
Species Human (GRCh38)
Location 10:104269248-104269270
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073535106_1073535111 0 Left 1073535106 10:104269225-104269247 CCGAGTTCCCGGAGGTCTCTCGC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535098_1073535111 25 Left 1073535098 10:104269200-104269222 CCGCCGCCAATCCTGGTCCGGTT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535099_1073535111 22 Left 1073535099 10:104269203-104269225 CCGCCAATCCTGGTCCGGTTGCC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535101_1073535111 14 Left 1073535101 10:104269211-104269233 CCTGGTCCGGTTGCCCGAGTTCC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535100_1073535111 19 Left 1073535100 10:104269206-104269228 CCAATCCTGGTCCGGTTGCCCGA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535103_1073535111 8 Left 1073535103 10:104269217-104269239 CCGGTTGCCCGAGTTCCCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535105_1073535111 1 Left 1073535105 10:104269224-104269246 CCCGAGTTCCCGGAGGTCTCTCG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535109_1073535111 -7 Left 1073535109 10:104269232-104269254 CCCGGAGGTCTCTCGCGGGACCT 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1073535110_1073535111 -8 Left 1073535110 10:104269233-104269255 CCGGAGGTCTCTCGCGGGACCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1073535111 10:104269248-104269270 GGGACCTCTCTCACCGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type