ID: 1073540181

View in Genome Browser
Species Human (GRCh38)
Location 10:104311528-104311550
Sequence AGCCCCCGTTGAGAACCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073540181_1073540188 3 Left 1073540181 10:104311528-104311550 CCCCCAGGTTCTCAACGGGGGCT 0: 1
1: 1
2: 1
3: 8
4: 68
Right 1073540188 10:104311554-104311576 CTTCAGCCAGGCATGCAGAGGGG 0: 1
1: 0
2: 0
3: 30
4: 293
1073540181_1073540191 26 Left 1073540181 10:104311528-104311550 CCCCCAGGTTCTCAACGGGGGCT 0: 1
1: 1
2: 1
3: 8
4: 68
Right 1073540191 10:104311577-104311599 CTAGAGCTTTTGAGGATATAAGG 0: 1
1: 1
2: 0
3: 7
4: 122
1073540181_1073540190 18 Left 1073540181 10:104311528-104311550 CCCCCAGGTTCTCAACGGGGGCT 0: 1
1: 1
2: 1
3: 8
4: 68
Right 1073540190 10:104311569-104311591 CAGAGGGGCTAGAGCTTTTGAGG 0: 1
1: 0
2: 0
3: 16
4: 143
1073540181_1073540186 1 Left 1073540181 10:104311528-104311550 CCCCCAGGTTCTCAACGGGGGCT 0: 1
1: 1
2: 1
3: 8
4: 68
Right 1073540186 10:104311552-104311574 TGCTTCAGCCAGGCATGCAGAGG 0: 1
1: 0
2: 7
3: 189
4: 3026
1073540181_1073540185 -9 Left 1073540181 10:104311528-104311550 CCCCCAGGTTCTCAACGGGGGCT 0: 1
1: 1
2: 1
3: 8
4: 68
Right 1073540185 10:104311542-104311564 ACGGGGGCTGTGCTTCAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 161
1073540181_1073540187 2 Left 1073540181 10:104311528-104311550 CCCCCAGGTTCTCAACGGGGGCT 0: 1
1: 1
2: 1
3: 8
4: 68
Right 1073540187 10:104311553-104311575 GCTTCAGCCAGGCATGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073540181 Original CRISPR AGCCCCCGTTGAGAACCTGG GGG (reversed) Exonic