ID: 1073540489

View in Genome Browser
Species Human (GRCh38)
Location 10:104313301-104313323
Sequence AGGTGCTCAAAAATGCTACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073540489_1073540493 28 Left 1073540489 10:104313301-104313323 CCGGGTAGCATTTTTGAGCACCT 0: 1
1: 0
2: 2
3: 15
4: 128
Right 1073540493 10:104313352-104313374 GAGACTTCGCTGCAGGACGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1073540489_1073540494 29 Left 1073540489 10:104313301-104313323 CCGGGTAGCATTTTTGAGCACCT 0: 1
1: 0
2: 2
3: 15
4: 128
Right 1073540494 10:104313353-104313375 AGACTTCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 70
1073540489_1073540492 21 Left 1073540489 10:104313301-104313323 CCGGGTAGCATTTTTGAGCACCT 0: 1
1: 0
2: 2
3: 15
4: 128
Right 1073540492 10:104313345-104313367 TACAGCAGAGACTTCGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073540489 Original CRISPR AGGTGCTCAAAAATGCTACC CGG (reversed) Exonic
900899037 1:5504399-5504421 AGCAGCTCAGAAATGCTCCCAGG + Intergenic
902605555 1:17567176-17567198 AGGTGCCCAAAAATGCTAGCTGG - Intronic
904230865 1:29070282-29070304 AAATGCTCAAAAATGATACTTGG - Intronic
904280155 1:29413354-29413376 AGGTTCTCATAAATTCTCCCAGG + Intergenic
906159343 1:43636143-43636165 AAGTGCTTAATAATGCTAGCAGG - Intergenic
906733893 1:48105801-48105823 AGGTTTTCAAAAATGATAACTGG + Intergenic
907112841 1:51942173-51942195 AGGCGCTCAGAAATCCTGCCTGG - Intronic
912013333 1:105000056-105000078 AGGAGCTCAAAAATGTTCCAAGG + Intergenic
912231482 1:107797953-107797975 TGGTTCTCAAATATGGTACCTGG - Intronic
913085052 1:115429204-115429226 AGGTGCTCAAAGATGCCATCAGG + Intergenic
915278041 1:154803128-154803150 AGTGGCTCAAAAATGCCCCCAGG + Intronic
917598824 1:176555657-176555679 AGGGGCACAAAAATGCAAGCTGG - Exonic
920158804 1:203979408-203979430 AGTTGGTCAAAAATGCTTCTTGG + Intergenic
921974269 1:221184362-221184384 AGGTGCTAAAAAAAGAAACCTGG - Intergenic
1063567856 10:7187596-7187618 AGCTGTTCAAAAATGACACCAGG + Intronic
1063927543 10:10995353-10995375 AGGTGCTCAAAAATACTGGCTGG - Intergenic
1066135852 10:32445852-32445874 AGGTTCTCAAAGGTCCTACCAGG + Intergenic
1069193608 10:65520609-65520631 AGGTTCTCAAAAATGAGAACTGG - Intergenic
1070853152 10:79584130-79584152 AGGTGCTCAATTCTGCTTCCTGG - Intergenic
1073004150 10:100309055-100309077 ACATGCACAAAAATGATACCTGG + Intronic
1073540489 10:104313301-104313323 AGGTGCTCAAAAATGCTACCCGG - Exonic
1075160697 10:120022207-120022229 AGCTACTCAAAAATGGTCCCAGG + Intergenic
1077755574 11:5024689-5024711 AGCTGCTCAAAAAAGCAGCCAGG + Intergenic
1080652042 11:34230495-34230517 ATGGACTCAAAAATGGTACCTGG + Intronic
1081698025 11:45131870-45131892 AGTTGCTCAAAAATGTTATCCGG + Intronic
1081714217 11:45237136-45237158 AGTAGCTTAAAAATGCTACTTGG - Intergenic
1083619358 11:64041385-64041407 ATGTCCTCAAAAATGCTGCCGGG + Intronic
1084440641 11:69170872-69170894 AGGTGCTCAAGACTGCAATCAGG - Intergenic
1084763987 11:71295555-71295577 AGGTGCGCAATCATGGTACCTGG - Intergenic
1085454986 11:76660580-76660602 AGGTGCTCAAGAAAGCTGTCGGG + Exonic
1088952917 11:114588919-114588941 AGGTTCTCCAAAATGCTATCTGG - Intronic
1090326185 11:125888037-125888059 AGGAGCTCAGAAAGGCCACCGGG - Intronic
1095334634 12:41010547-41010569 AGGTTCTCCAAGATGCTATCTGG + Intronic
1097077738 12:56407807-56407829 AGGTCCTCTAAAATACTACCTGG + Intergenic
1099479267 12:83145743-83145765 AGCTGCTCAACAATCCTATCAGG - Intergenic
1100680534 12:96915253-96915275 AGGGGGTCAAAAATGCTTCAAGG - Intronic
1100680764 12:96917412-96917434 AGGGGGTCAAAAATGCTTCAAGG - Intronic
1101455611 12:104827272-104827294 AGGTTCTCTAAAGTGCTATCTGG - Intronic
1105424765 13:20284835-20284857 AGGTCCTCTAAAGTACTACCTGG - Intergenic
1113635858 13:111918719-111918741 AAATGCTCAGAAATTCTACCTGG - Intergenic
1113635862 13:111918748-111918770 AAATGCTCAGAAATTCTACCTGG - Intergenic
1113635866 13:111918777-111918799 AAATGCTCAGAAATTCTACCTGG - Intergenic
1113635870 13:111918806-111918828 AGATGCTCAGAAATTCTACCTGG - Intergenic
1115620844 14:35138752-35138774 AAGTGTTTAAAACTGCTACCTGG + Intronic
1117654477 14:57940500-57940522 AGCTGTTCACTAATGCTACCAGG + Intronic
1118752665 14:68817996-68818018 AGGTGCTTAAAAATGCTCATTGG - Intergenic
1121332264 14:93057062-93057084 GGGTGCTCCCAAATGCCACCCGG + Intronic
1122175030 14:99910846-99910868 AAGTGCTCATAAATGCTCACTGG - Intronic
1133703421 16:8330952-8330974 AGGCACTCAAAAATGCTGACTGG + Intergenic
1134203700 16:12220210-12220232 AGGTGCTCAAACAGTTTACCAGG + Intronic
1137275051 16:46927840-46927862 TGGTGCACCAAAATGCTCCCTGG - Intronic
1138053339 16:53805889-53805911 AGCTGCTCACAAATGCCACACGG - Intronic
1138646228 16:58427020-58427042 AGGGGGTCAAAAATGCGCCCTGG + Intergenic
1146542512 17:33709830-33709852 AGGTGCTTAAAAATGTTAAGTGG - Intronic
1148161607 17:45453434-45453456 AGGTGCTGAAATTTGCCACCCGG - Exonic
1149222147 17:54427478-54427500 AGGTCCTCAGTAAAGCTACCTGG + Intergenic
1149911140 17:60568130-60568152 AGGGGGGTAAAAATGCTACCAGG - Intronic
1149930314 17:60746632-60746654 AGCTGCTAAAAAAAGCTGCCAGG - Intronic
1150392844 17:64800079-64800101 AGGTGCTGAAATTTGCCACCCGG - Intergenic
1150809276 17:68344024-68344046 AGCTGCTCAAAGATGCTGCCGGG + Intronic
1151426449 17:74033850-74033872 AGCTTCTCAAAAATCCTTCCCGG + Intergenic
1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG + Intronic
1154928386 18:20964399-20964421 AGATGCTCAAAAATGGTCCCTGG - Intronic
1155398592 18:25414354-25414376 TGGTGTTAATAAATGCTACCAGG - Intergenic
1157571655 18:48716355-48716377 AGATGCTCCAGAATGCTTCCTGG + Intronic
1159025010 18:63175702-63175724 AGGTGCCCAAAAATACTCTCAGG + Intronic
1162661991 19:12177024-12177046 ACATGCTAAAAGATGCTACCAGG - Intronic
1167525957 19:49983914-49983936 AGGCGCACAAAAATGCTCTCTGG - Intronic
926360270 2:12080374-12080396 AGCTGCTGACAAATGCTACTGGG - Intergenic
926727714 2:16011501-16011523 AGGTGCTCAAAAGTGATGCAAGG + Intergenic
927540372 2:23905215-23905237 AGGTACTGAAAAATGCCACATGG + Intronic
928287452 2:30005417-30005439 AGGTGCTTAAAAATACCACGAGG + Intergenic
930156347 2:48111477-48111499 AGGTGCTGACAAAGGCTGCCTGG + Intergenic
930251979 2:49044584-49044606 AGGTGTGCAGAAATGCTACTGGG + Intronic
931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG + Intergenic
932099577 2:68885576-68885598 AGATGCCCATAAATGCTATCGGG - Intergenic
932735911 2:74254517-74254539 AGGTGCTCAAATGTGCTGGCTGG + Intronic
935317680 2:101852798-101852820 AGGTGCAGATATATGCTACCTGG + Intronic
942752610 2:179304724-179304746 ACCTTCTCAAAAATACTACCAGG + Intergenic
944074909 2:195718788-195718810 TGATGTTCAAAAATGTTACCTGG + Intronic
1169080250 20:2794081-2794103 AGGTGCTCATTAAAGCTACCGGG - Exonic
1173376247 20:42486085-42486107 AGGTGCTCAACAAGGCCAGCAGG - Intronic
1174106077 20:48163222-48163244 TGGTGCTCAATAAAGCAACCAGG - Intergenic
1175319722 20:58076667-58076689 AGGTGCTCAGAAATGTCGCCAGG - Intergenic
1177702893 21:24661491-24661513 AGGTGCACAAAAGTTCTACTAGG - Intergenic
1178102688 21:29286806-29286828 AGGTGCACAAAAATGGTAAAAGG + Intronic
1180065765 21:45411432-45411454 AGGTGCTCAAAAATGCACACAGG - Intronic
1180750224 22:18119368-18119390 CGGTGCAGAAAAATGCTACCAGG + Intronic
1181732006 22:24854187-24854209 ATATGCTCAAAAATGCCCCCTGG - Intronic
1185126371 22:49013108-49013130 GGATGCTTAAAAATGCTGCCCGG + Intergenic
950878227 3:16298223-16298245 AGGTGCTAAAATATGCTGCTGGG + Intronic
953584736 3:44189330-44189352 AGGTGCTCAAACCTGATACAAGG - Intergenic
955009649 3:55001853-55001875 AGCTGCTCAAGAATGCACCCTGG + Intronic
955094196 3:55781378-55781400 AGGTGCTCAGAAAACCTTCCTGG + Intronic
956225194 3:66949786-66949808 AGGTTTTAAAAAATTCTACCTGG + Intergenic
958501663 3:94918615-94918637 AGGTGCTCAAAAATATTAGTAGG - Intergenic
964386747 3:156155740-156155762 AGGTCCTCAAGAATGCTCTCAGG + Intronic
966349847 3:179021041-179021063 AGGGCTTCAAAAATCCTACCTGG + Exonic
969105231 4:4802500-4802522 AGGAGCTCATCAATGCTCCCAGG + Intergenic
971568249 4:28173363-28173385 AAGTTCTTAAAAATGCTACATGG + Intergenic
972438672 4:39061692-39061714 TGCGGCTCAAAAAAGCTACCAGG - Intronic
976242502 4:82973394-82973416 AGATAATCAGAAATGCTACCAGG - Intronic
976344146 4:83980261-83980283 AGGAACTCAAAAATGCTCCCTGG - Intergenic
976712984 4:88093135-88093157 AGTTGCACAAAAATGGTATCAGG - Intronic
984304909 4:177976241-177976263 AGGAGTGCAAAAATGCTATCGGG + Intronic
987522744 5:19007986-19008008 AGGTGTTCAAAAATGCTCATTGG + Intergenic
989958458 5:50382204-50382226 TGGTGCTCAGAAAAGATACCTGG - Intergenic
994550058 5:101222940-101222962 AGGTCCTCAAATGTACTACCGGG + Intergenic
994723541 5:103408108-103408130 AGGAGCTCAAAGAGGGTACCAGG - Intergenic
995256250 5:110050006-110050028 AGATGCTCAAAAAGCCTGCCAGG - Intergenic
996892115 5:128433562-128433584 AAATTCTCAGAAATGCTACCAGG - Intronic
1001536351 5:172500919-172500941 AGGTGCTTAAAAATGGGAGCTGG + Intergenic
1001599586 5:172920242-172920264 AGGTGCTCAAAGAAGCCACCAGG + Intronic
1001784652 5:174401713-174401735 AGGTGCTCAGTAATACTAACAGG - Intergenic
1003066162 6:2904745-2904767 AAGTACTAACAAATGCTACCTGG - Intergenic
1003704219 6:8506383-8506405 AGGGGCTCTAAAGTGCTTCCTGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1009242789 6:61201000-61201022 AGGTTCTCTAAAGTGCTATCTGG + Intergenic
1009941107 6:70288821-70288843 AGGTGGTCATAAATGCTATGGGG - Intronic
1011480555 6:87789446-87789468 TGGTGTTGGAAAATGCTACCTGG + Intergenic
1012416407 6:99018477-99018499 GAGTGTTCTAAAATGCTACCGGG + Intergenic
1013365099 6:109431325-109431347 AGGAACTCAAAAATGAAACCTGG - Exonic
1015244315 6:131060888-131060910 AGTTGCTACAAAATGCTCCCTGG + Intronic
1016831019 6:148433188-148433210 AGGTGATCAAAAATCTTACTGGG - Intronic
1019030529 6:169006524-169006546 GGGTGCTCTAAAATGTAACCTGG - Intergenic
1019116419 6:169767120-169767142 AGGTGCACATGAACGCTACCCGG - Intronic
1034177075 7:149108590-149108612 TGGTACTCAAAAATCCTTCCAGG + Intronic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1039202704 8:35114097-35114119 AGGTGAACAGAAATTCTACCAGG - Intergenic
1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG + Intronic
1041679915 8:60578181-60578203 AGGCACTCAAATATGTTACCTGG - Intronic
1047276720 8:123411136-123411158 AGGGTCTCCAAAATGTTACCAGG - Intronic
1052941086 9:34132733-34132755 AGGAGCTCAGAAGTGCTACATGG + Intergenic
1053215529 9:36267274-36267296 AGGTGCTCTAAAAAGCTGACTGG - Intronic
1053225228 9:36349369-36349391 AGGTGCTCAACATTGCAATCAGG - Intronic
1055815923 9:80206539-80206561 AAGTGATCAAAAATATTACCTGG - Intergenic
1057350585 9:94293736-94293758 TGATGCACAAAAAAGCTACCAGG - Intronic
1058731599 9:107855487-107855509 ATGTGCTCTAAAATGATACTTGG - Intergenic
1060672833 9:125485417-125485439 TGGTGCTCAAAAATCTTCCCTGG + Intronic
1187022193 X:15395308-15395330 AGATGCTCAATAATGGTAACTGG - Intronic
1192667312 X:73101559-73101581 AGGTTGTCATAAATGCTGCCTGG + Intergenic
1195343739 X:103928311-103928333 AGGTCCTCAATACTTCTACCGGG + Intronic
1195363247 X:104105020-104105042 AGGTCCTCAATACTTCTACCGGG - Exonic
1195437696 X:104864448-104864470 AAGTGCTCAAATATGCCACTTGG - Intronic
1198601689 X:138291041-138291063 AGTTGCTCAATTATGGTACCAGG - Intergenic
1200565438 Y:4759643-4759665 AGTAGCTCAAAAAGGCTACTTGG + Intergenic