ID: 1073542269

View in Genome Browser
Species Human (GRCh38)
Location 10:104323883-104323905
Sequence CACAGTAAAGAGCAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073542269_1073542279 20 Left 1073542269 10:104323883-104323905 CCACCTTCCTGCTCTTTACTGTG 0: 1
1: 0
2: 3
3: 35
4: 422
Right 1073542279 10:104323926-104323948 TCCTACCTACAGTTCCAGCATGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073542269 Original CRISPR CACAGTAAAGAGCAGGAAGG TGG (reversed) Intronic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
902063691 1:13666301-13666323 CATAATGAAGAGCAGGAATGGGG + Intergenic
902333582 1:15742682-15742704 CACTGCAAAGAGCTGGAAGGGGG - Intronic
902938338 1:19780919-19780941 CACACTACAGACCAGGATGGAGG + Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
905435757 1:37954135-37954157 CAAAGTAAGGAGGAGGAAAGGGG - Intergenic
905872901 1:41415254-41415276 CACAGGGAGAAGCAGGAAGGTGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
907350804 1:53829191-53829213 CAAAGTAAAGAGATGGCAGGAGG + Intronic
907850384 1:58249915-58249937 CACCGCGAAGAGCGGGAAGGCGG - Intronic
908710963 1:67013595-67013617 GACAGCAAAGAGGAGGAAGGAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910849288 1:91635263-91635285 AACAGTGAGGAGCAGAAAGGTGG - Intergenic
911377411 1:97068001-97068023 CACTATAAAGAGTACGAAGGAGG - Intergenic
912242067 1:107921529-107921551 CACAGTAAAGTTCTGGAAAGTGG + Intronic
912677533 1:111698849-111698871 AACATTAGAGAGCAGGAGGGTGG - Intronic
913461212 1:119087843-119087865 AAAAGTAAAGAGCAGAAAGAAGG + Intronic
913970148 1:143408732-143408754 CACAATAAAGAGCAGAGAAGTGG - Intergenic
914064523 1:144234329-144234351 CACAATAAAGAGCAGAGAAGTGG - Intergenic
914114627 1:144732025-144732047 CACAATAAAGAGCAGAGAAGTGG + Intergenic
915440119 1:155940702-155940724 CACAGACTAGAGCAGGAAAGGGG + Intergenic
915725616 1:158014891-158014913 CCCAGTAAAGCACCGGAAGGAGG - Intronic
915805216 1:158841489-158841511 CACACTAGAGAGCAGATAGGAGG + Intronic
916165273 1:161961215-161961237 TCCACTGAAGAGCAGGAAGGTGG + Exonic
916585303 1:166144817-166144839 CATGGTAAAGAACAGAAAGGGGG - Intronic
917980088 1:180263778-180263800 CCCACTAAAAAGCAGGCAGGGGG - Intronic
918463826 1:184801682-184801704 CACAGTAGAGAGCAGGAGACAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
920397132 1:205655155-205655177 CACAGGAAACATCCGGAAGGAGG + Intergenic
921220332 1:212969091-212969113 TTCAGAAAAGTGCAGGAAGGTGG + Intronic
921500614 1:215898098-215898120 CATAGCAAAGAACTGGAAGGAGG - Intronic
922232396 1:223698463-223698485 CACAGTGAAGAGCATGATTGTGG + Intergenic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923526266 1:234775236-234775258 CACAGGAAACAGCAGCAAGATGG - Intergenic
924700018 1:246441907-246441929 GATAGTAAAGAGAAAGAAGGTGG - Intronic
1063947191 10:11189556-11189578 CACCGTAAAGAGTAGCAAAGAGG - Intronic
1064044056 10:11995445-11995467 GACTGTAAACTGCAGGAAGGAGG - Intronic
1064173781 10:13056664-13056686 CAGAATAAAAAGCAGGGAGGTGG + Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1065343989 10:24731199-24731221 CACAGAAGAAAGCTGGAAGGAGG - Intergenic
1066016238 10:31246676-31246698 TACAGGAGAGAGGAGGAAGGAGG - Intergenic
1067574567 10:47401175-47401197 CAGAGTAAGGAGCTTGAAGGGGG - Intergenic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1069834823 10:71301867-71301889 GACAGAAAAGAACAGGGAGGAGG - Exonic
1069942166 10:71963774-71963796 CGCAGGAAAGTGCAGGAGGGCGG + Intergenic
1070402421 10:76065349-76065371 CACAATAGAAAGAAGGAAGGTGG + Intronic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070673084 10:78391834-78391856 CTCTTTAAAGAGCAGGAAGCAGG - Intergenic
1070707188 10:78648245-78648267 CACAGTTAGGAACAGGAAGGTGG - Intergenic
1070847516 10:79535520-79535542 CTCAGTAAAGACCCGGAGGGAGG - Intergenic
1072578372 10:96720244-96720266 CATAGAAAAGAGCAGAAAGAGGG + Intronic
1073041921 10:100613517-100613539 AGCAGTAGAGAGCTGGAAGGTGG + Intergenic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073429864 10:103479086-103479108 CACAGCAGACACCAGGAAGGTGG - Exonic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074047663 10:109853331-109853353 CACATTACAGAGCAGGAAATGGG + Intergenic
1074060122 10:109957633-109957655 CTCATTACAGAGCAGGACGGTGG + Intergenic
1074925739 10:118068558-118068580 CACAGCAAATAGGGGGAAGGGGG - Intergenic
1075435786 10:122440412-122440434 CACAAATAATAGCAGGAAGGTGG - Exonic
1076118723 10:127919470-127919492 CACAGAACAGAACAGGAAGAAGG - Intronic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1077003841 11:341120-341142 AAAAGGAAAGAGGAGGAAGGAGG + Intergenic
1078254169 11:9643101-9643123 CACAGTTCAGAGGAGGAAGTGGG + Intergenic
1078527410 11:12111142-12111164 CCCAGTGAAGAGCTGGAACGGGG - Intronic
1078632051 11:13011313-13011335 CTCATTAAAGAGAGGGAAGGAGG + Intergenic
1078670387 11:13359547-13359569 TACAGTAAAGAGCAGGGATAGGG + Intronic
1080428867 11:32180198-32180220 TGCAGTAAAGAGGAGGAGGGAGG - Intergenic
1080751789 11:35157635-35157657 CACAGCTATGAGGAGGAAGGAGG - Intronic
1081255057 11:40882516-40882538 TGCAGAAATGAGCAGGAAGGTGG - Intronic
1084477844 11:69398950-69398972 CACAGTGGGGACCAGGAAGGGGG + Intergenic
1084737434 11:71114643-71114665 CCCAGAACAGAGCAGGCAGGAGG + Intronic
1085717894 11:78889355-78889377 TGCAGTGAGGAGCAGGAAGGAGG - Intronic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086168425 11:83807561-83807583 CTCAGTAAATAATAGGAAGGAGG + Intronic
1086342374 11:85859113-85859135 AAAAATAAAAAGCAGGAAGGTGG + Intronic
1086905457 11:92413303-92413325 CACAGTAAATTTCAGGAAAGAGG - Intronic
1087071424 11:94085063-94085085 CTTAGTAGAGAGCAGGAGGGGGG + Intronic
1087701126 11:101437783-101437805 AACAGTAAAGTGCAAGAAGTAGG - Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1090128323 11:124113678-124113700 CACACCAATGAGCAGGAAGAGGG + Intergenic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1091173708 11:133541428-133541450 CAAAGTGAAGAGCAGGAATGCGG + Intergenic
1092306973 12:7311268-7311290 CACAGTAGAGAGCAGGAGAGGGG - Intronic
1092926337 12:13275710-13275732 CACAGTGAAAGGCAGGAAGGGGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093619056 12:21265328-21265350 CACAGTGAAGGGATGGAAGGTGG + Exonic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093739872 12:22672681-22672703 CAAACTAAAGAGAAGGAAAGGGG + Intronic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096851420 12:54440486-54440508 GACAGAAAACAGCAGGTAGGTGG + Intergenic
1097309837 12:58106382-58106404 CACATTCAAGAGCTGGAAGCTGG + Intergenic
1097856529 12:64469365-64469387 CGGAGAAAGGAGCAGGAAGGGGG - Intronic
1100950296 12:99840969-99840991 CTCAGTAAAGAACAAAAAGGTGG + Intronic
1102647082 12:114410728-114410750 CACTTCAAAGAGCAGAAAGGTGG + Intergenic
1102901571 12:116642173-116642195 CACAGTAAAAACCTGGAGGGTGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103689914 12:122763886-122763908 GACAGTAATAAGCAGGAAAGGGG + Intronic
1103909385 12:124344046-124344068 CTAAGTAAAGATCTGGAAGGCGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104646178 12:130499103-130499125 AACAGGAAAGAGCATGAAGCAGG + Intronic
1104769874 12:131354758-131354780 CCCTGTGAAGAGCAGAAAGGAGG + Intergenic
1105948804 13:25211809-25211831 CTCAGAGAAGAGCAGGAAGAGGG - Intergenic
1106063126 13:26315394-26315416 CACTGACAAGAGCAGGGAGGAGG + Intronic
1106175984 13:27332090-27332112 CACAGGAATGAGGAGGAAGAGGG + Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1106776084 13:33011157-33011179 CAGAGTAACGAGCAGGGAGATGG + Intergenic
1106780781 13:33057081-33057103 CCCAGTAAAGAGGAGGAGGAAGG - Intronic
1106863196 13:33934069-33934091 CAAAGAAAAGAGCATGTAGGAGG + Intronic
1107786670 13:43964472-43964494 TTCAGGAAAGAGCAGGCAGGAGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108541248 13:51448835-51448857 CCTAGTATAGAGCAGGAAAGGGG + Intronic
1109393776 13:61726626-61726648 GGCAGTAAAGAGAATGAAGGAGG + Intergenic
1109406427 13:61906212-61906234 CACAGTACAGTGCAGCAAGCAGG - Intergenic
1109540385 13:63769688-63769710 GACAGAAAAGAGCATGAAGTAGG - Intergenic
1110499860 13:76214314-76214336 CACAGTAAAAGGCAAGCAGGGGG + Intergenic
1113988686 13:114340973-114340995 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1114290595 14:21285303-21285325 CCAAATAAAGAGCAAGAAGGAGG + Intergenic
1114903074 14:27090051-27090073 CCCAGTAAAGAGCAAGAATATGG + Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117651656 14:57914227-57914249 CACAGGACAGAGCAGAAAAGGGG + Intronic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1118269690 14:64331001-64331023 CACAGTAAGTAGCAGTATGGTGG + Intronic
1119153818 14:72389988-72390010 AACAGTAAAGTGTAGGAAAGTGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119821888 14:77623496-77623518 AACAGTAAGAAGCAGGAAGTGGG + Intergenic
1121312214 14:92941327-92941349 CACAGTAGAGAGCAGGCGGACGG + Exonic
1121668618 14:95691422-95691444 CTCAGCAAACAGCAGGGAGGAGG - Intronic
1121698132 14:95929330-95929352 CCCAGCCAAGAGCAGGAAGCAGG + Intergenic
1122036784 14:98954712-98954734 CACAGTGAAGAGCAGTTAGTCGG + Intergenic
1124600364 15:31128553-31128575 CCCAGTTGTGAGCAGGAAGGGGG - Intronic
1124992467 15:34689489-34689511 CACAGGAAACAGCAAGAAGGTGG + Intergenic
1125130966 15:36284116-36284138 CACACTATAGAGCATGAAGTGGG + Intergenic
1125214855 15:37259935-37259957 CAGAAGAAAGAGCAGGCAGGAGG - Intergenic
1126669604 15:51104242-51104264 CACAGGAAAGAGCTGGGAGGAGG - Intronic
1128767868 15:70262034-70262056 CCCAGAGCAGAGCAGGAAGGTGG - Intergenic
1129004711 15:72362978-72363000 GACATTAAAGAGTGGGAAGGTGG - Intronic
1129263946 15:74383926-74383948 GACAGGAGAGTGCAGGAAGGAGG + Intergenic
1129793091 15:78354867-78354889 TACAGTAAAGTGCTGGAAGGAGG - Intergenic
1132389356 15:101427296-101427318 CACAGAACAGAGCAGGCATGAGG + Intronic
1132520861 16:387907-387929 CAAAGTATAGAGAAGGAAAGGGG + Intergenic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133505553 16:6408834-6408856 CACAGAAAATAGCAGCAAGATGG - Intronic
1135112100 16:19698337-19698359 AACAGGAAAGAGGAGGAAGAAGG - Intronic
1135242125 16:20816896-20816918 CACAGTGAAGAATAGGCAGGAGG + Intronic
1135592702 16:23715759-23715781 CAAAATATAGAGCAGAAAGGAGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136418723 16:30118835-30118857 CACAGTTAAGAGCAGCAACTTGG + Intronic
1137911921 16:52386151-52386173 CACGGAAAAGAGCAGGCTGGTGG + Intergenic
1138495594 16:57407207-57407229 GACAGTAAAGAGCTAGAAGATGG + Intronic
1138528830 16:57623829-57623851 CACAGGAGATAGCAGGGAGGTGG + Intronic
1141635883 16:85313548-85313570 CACAGCAAAGGGCAGGGAGGGGG - Intergenic
1141921525 16:87138801-87138823 CACAGTCAATCGCAGGAAGTAGG + Intronic
1142351520 16:89582963-89582985 CTCAGTGAGGAGCAGGACGGGGG - Intronic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1142652163 17:1361240-1361262 CACAGGAAACGACAGGAAGGAGG - Exonic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1143882426 17:10039909-10039931 AAGAGAAAAGACCAGGAAGGTGG - Intronic
1144074919 17:11708664-11708686 CTCAGTCATTAGCAGGAAGGAGG + Intronic
1144396937 17:14853524-14853546 GAAAGTACAGAGCAAGAAGGTGG + Intergenic
1145966595 17:28923237-28923259 ACCTGTGAAGAGCAGGAAGGTGG + Intronic
1146057194 17:29587418-29587440 CACAATAGAGGTCAGGAAGGTGG - Intronic
1147058559 17:37854450-37854472 CACAGGAAATGACAGGAAGGAGG - Intergenic
1147283291 17:39380606-39380628 CAAAATAAAGGGCAGGAAAGGGG - Intronic
1149673451 17:58436090-58436112 CACAGTAAAGAGCAGAATCCAGG + Intronic
1150137001 17:62701608-62701630 TTCAGTAAAGAGGAGGAGGGAGG + Exonic
1151563965 17:74886847-74886869 CAAACTAAGGAGCAGGAAGGTGG - Intronic
1151713165 17:75818184-75818206 CACAGCAGAGGGGAGGAAGGGGG - Intronic
1151820316 17:76493461-76493483 AAGAGTAAAGGGCAGGAAAGTGG + Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1203171916 17_GL000205v2_random:156433-156455 CACAGGACAGAGCAAGAGGGAGG - Intergenic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1153178988 18:2411608-2411630 GGCAGAAAAGAGCAGGAAGTAGG - Intergenic
1153565760 18:6415304-6415326 CAAAGTCAAGAGCAGGAAAGGGG - Intergenic
1153652081 18:7249739-7249761 CACAGTAGAGAGCAGACAGGTGG - Intergenic
1153683254 18:7521403-7521425 CACATTACTGAGCAGGGAGGAGG - Intergenic
1155484929 18:26331124-26331146 CACTGGGAAGAGCAGGAAGGTGG + Intronic
1157102991 18:44746765-44746787 CACAGTAAAGAACAAGCGGGTGG + Intronic
1157299207 18:46467609-46467631 CACAGTAGACAGCAGGGATGAGG + Intergenic
1157616446 18:48990395-48990417 TACAGCAATGGGCAGGAAGGAGG + Intergenic
1157777367 18:50406216-50406238 GCCAGTAAAAATCAGGAAGGAGG + Intergenic
1158194302 18:54867085-54867107 TAAAGGAAAGAGCAGGAAGTGGG + Intronic
1159865773 18:73702973-73702995 GACAGTAAAGAGCTGGGAGAGGG - Intergenic
1159879832 18:73848220-73848242 CACATTAAAGACCACGAAAGAGG - Intergenic
1160952371 19:1673944-1673966 AACGGTAAAGAGGAGGGAGGCGG - Intergenic
1162507095 19:11092107-11092129 TACAGATAAGAGCAGGAATGAGG - Intronic
1163050230 19:14677613-14677635 CACAGGAGAGAGCTGCAAGGGGG + Intronic
1163302785 19:16458190-16458212 CACAGCGATGAGGAGGAAGGTGG - Intronic
1164785112 19:30924359-30924381 CACAGTAAGGAGAAGCCAGGAGG - Intergenic
1166679852 19:44759536-44759558 CCCAGCAAAGGGCAGGAAGGCGG - Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
925283024 2:2698036-2698058 CTCTGTAAAAAGCAGGAAGGAGG + Intergenic
925356820 2:3247521-3247543 TGCAGGTAAGAGCAGGAAGGAGG - Intronic
925517688 2:4702902-4702924 CCCAGAAAAGAGCATGAAAGAGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
927213043 2:20650523-20650545 CACAGTACAGGGCAGGAACCCGG - Intronic
927420804 2:22928476-22928498 CACACTGGTGAGCAGGAAGGAGG - Intergenic
927683427 2:25154940-25154962 GACAGCAAAGGGCAGGAAGCAGG + Exonic
927934886 2:27070853-27070875 CAAACTATAGAGAAGGAAGGGGG - Intronic
928792837 2:34979310-34979332 CGCAGTAAAGGGCAAGATGGTGG + Intergenic
929471323 2:42196856-42196878 CACAGTAGAGGGCAGGGTGGAGG - Intronic
931218246 2:60265713-60265735 TACAGGAAGGAGCAGGAAGTGGG + Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931529971 2:63202842-63202864 CACAGACAAGGGAAGGAAGGAGG - Intronic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
931602283 2:64016975-64016997 AAAAGCAAAGAGCAGGAAAGAGG + Intronic
933894588 2:86799307-86799329 CATAGTAAGGAACAGGAGGGCGG - Intronic
934174842 2:89569642-89569664 CACAATAAAGAGCAGAGAAGTGG - Intergenic
934285159 2:91643994-91644016 CACAATAAAGAGCAGAGAAGTGG - Intergenic
935236517 2:101143376-101143398 TAAAGTAAAAAGCAGGAAGCAGG + Intronic
938673910 2:133611369-133611391 TACAGCCAAGAGCAGGAAGGTGG + Intergenic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939135474 2:138288364-138288386 CACAGGAAATGACAGGAAGGAGG - Intergenic
940032892 2:149283531-149283553 CCCAGTAAAGAGAATGGAGGTGG + Intergenic
940728996 2:157368503-157368525 CACAGTAAAAAGTAGGAACAAGG + Intergenic
940770560 2:157835197-157835219 CACAGTGTAGGGGAGGAAGGGGG - Intronic
943449896 2:188033964-188033986 CGGAGCAAAGAGCAGGACGGGGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944925534 2:204460324-204460346 CACAGTGAAGAGCTGGAGAGAGG - Intergenic
945265712 2:207889403-207889425 CACATTTAAGAGCAGACAGGAGG + Intronic
946306160 2:218858222-218858244 CACACTAAAGAAGGGGAAGGGGG - Intergenic
946317272 2:218924991-218925013 CACAGTCAAGAACAGCAATGGGG + Intergenic
946749285 2:222877119-222877141 AACAGTAGAGATCAGGCAGGGGG + Intronic
947058952 2:226140028-226140050 CATGGCACAGAGCAGGAAGGTGG - Intergenic
948312433 2:236998785-236998807 GACAGCAAAAAACAGGAAGGAGG + Intergenic
948513941 2:238491139-238491161 CATAGTCATGAGTAGGAAGGAGG - Intergenic
948764721 2:240213526-240213548 GACTGTCAAGACCAGGAAGGGGG + Intergenic
948832580 2:240605374-240605396 CACAGGAAAGGCCAGGAAGGAGG - Intronic
1168857023 20:1015700-1015722 TACAGAACAGAGCAGGAAGTTGG - Intergenic
1169507094 20:6223000-6223022 CACAGTGAAGGGCAGGGATGAGG - Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1171070580 20:22064480-22064502 CACAGAAATAAGCAGAAAGGTGG - Intergenic
1171180211 20:23085988-23086010 CACTGTGAAGAGCAAGGAGGAGG - Exonic
1171279401 20:23883354-23883376 CACAGTTGGGAGCAGGGAGGGGG - Intergenic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1172099178 20:32475275-32475297 CACAGCAAAGGTTAGGAAGGAGG - Intronic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1173447619 20:43134170-43134192 CACAACAAAGAAAAGGAAGGGGG + Intronic
1174277298 20:49413362-49413384 CATAGTACAGAGCAGGTAGTGGG - Intronic
1174575361 20:51533208-51533230 CCCAAAACAGAGCAGGAAGGTGG + Intronic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175781275 20:61683887-61683909 CACAGTAGAGAGCAGCCAGAGGG + Intronic
1175911760 20:62408404-62408426 CACAGGAGGGAGCAGGCAGGCGG - Intergenic
1176052104 20:63125310-63125332 TGCAGTAAAGAGCGGGCAGGTGG + Intergenic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1178583595 21:33855584-33855606 CACTGGAATGAGCAGGAGGGAGG - Intronic
1178838618 21:36120346-36120368 TACAGTAAAGATTAGGGAGGCGG - Intergenic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179341041 21:40509692-40509714 CACATTAAAAAACAGGAACGAGG + Intronic
1179958955 21:44757711-44757733 CACAGTAGAGAGCTGGGGGGTGG + Intergenic
1181417409 22:22770677-22770699 CAGAGAAAAGGGCAGGGAGGTGG - Intronic
1181423474 22:22817967-22817989 CAGAGCAAAGGGCAGGGAGGGGG - Intronic
1181772792 22:25138953-25138975 CAGAGGGAAGACCAGGAAGGGGG - Intronic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182570213 22:31231632-31231654 CAAAGTAAAGAGCAGGATTAAGG - Intronic
1182680270 22:32074051-32074073 CACTGCAATGAGCAGGAGGGTGG + Intronic
1182879830 22:33723877-33723899 AACAGGAAAGAGAATGAAGGAGG + Intronic
1182960488 22:34467684-34467706 CACATTAAAGATGAGGAAAGTGG + Intergenic
1183329130 22:37210088-37210110 CACAGCACAGGGCAGCAAGGTGG - Intronic
1183467267 22:37986023-37986045 CACAGGGAAGAGAAGGGAGGCGG - Intronic
1183692148 22:39396499-39396521 CCCAGATAAGAGAAGGAAGGAGG - Intergenic
1184200488 22:42965411-42965433 CTCAATAAAGAGGAAGAAGGCGG + Intronic
1184281377 22:43439533-43439555 CACAGCAAAGAGGAGGAAACAGG - Intronic
1184662844 22:45973342-45973364 CACAGCACAAAGCAGGAAGATGG + Intronic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
952121296 3:30247541-30247563 TAAAGTAAAGAGGAGAAAGGAGG + Intergenic
952359359 3:32614294-32614316 CACAGTAAAGGGGATGAGGGTGG + Intergenic
952749431 3:36813444-36813466 CACAGTAAAAATGAGGTAGGCGG + Intergenic
952973495 3:38672591-38672613 CAAAGGAAAGAGCTGGAAGGAGG + Intergenic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953930501 3:47003534-47003556 CACAAACCAGAGCAGGAAGGGGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
956691834 3:71885701-71885723 CACAGAAAGGACCAGGAATGGGG + Intergenic
957471666 3:80667030-80667052 CACAGAAATGAGAAGGAATGAGG + Intergenic
957877940 3:86173734-86173756 CACAGGCAGGAGCAGGAAGGTGG - Intergenic
960699593 3:120427249-120427271 CAAAGTTCAGAGAAGGAAGGGGG - Intronic
962613149 3:137097998-137098020 GAAACTAAAGAGCAGGAAGAAGG - Intergenic
963282416 3:143397726-143397748 CACATCAAAGAGCAGCAATGTGG - Intronic
963304485 3:143635706-143635728 CACAGTTAAGATCAGGTAGATGG - Intronic
965158080 3:165089957-165089979 CATAGGACAGAGCAAGAAGGTGG + Intergenic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
965784530 3:172321934-172321956 CACTGTAAACAGCTAGAAGGTGG - Intronic
966374883 3:179286329-179286351 CACAGTGAAACCCAGGAAGGAGG + Intergenic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
967370913 3:188744984-188745006 CTCCCTAAAAAGCAGGAAGGGGG - Intronic
967662765 3:192133289-192133311 GACAGAAAAGTGGAGGAAGGAGG - Intergenic
968222332 3:196948192-196948214 CACAGCAAAGGCCAGAAAGGTGG + Exonic
968374587 4:28315-28337 CACAGGAAAGAGCAGGATCCTGG + Intergenic
968737055 4:2303137-2303159 CACAGGAAAGAGCTGCAGGGAGG + Intronic
969892209 4:10270232-10270254 AAGAGTTAAGACCAGGAAGGCGG - Intergenic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
970360472 4:15304022-15304044 CACTGACAAGGGCAGGAAGGAGG + Intergenic
970648845 4:18155719-18155741 AACAGTATAGAGCAGGAAAAGGG - Intergenic
970910133 4:21265220-21265242 CACAGGCAAAAGCAGGCAGGAGG + Intronic
971111414 4:23590251-23590273 TACAGTAAAAAGCAAGAAGAGGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
972473891 4:39432805-39432827 CACAGAATAGAGCACGTAGGAGG - Intronic
972865340 4:43225482-43225504 CACTGCACAGAGCAGGATGGAGG + Intergenic
973638718 4:52883183-52883205 CACTCTAAAAAGCAGGAAGCTGG + Intronic
973713392 4:53651292-53651314 CGCAGTGCAGAGCAGGATGGGGG - Intronic
974063460 4:57055723-57055745 AACAGTCAAGGGCAGGAATGAGG - Intronic
974442042 4:61931362-61931384 CACAGTACAGTGTAGGAAGAAGG - Intronic
974733783 4:65901699-65901721 CAAAAAAAAGATCAGGAAGGAGG - Intergenic
975880875 4:78906211-78906233 AAAAGTAAAGAGCAGTAATGAGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976971947 4:91114618-91114640 AACTGCAAAGAGCAGGAAGCAGG - Intronic
977136364 4:93309809-93309831 CAAAGTTAAGTGCAGGAAGAGGG + Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978315445 4:107430748-107430770 TTCACTAAAGAGTAGGAAGGTGG - Intergenic
978472743 4:109088289-109088311 CACAGTGAGGAGCAGGTATGGGG + Intronic
978738318 4:112109394-112109416 CAAAGAAAATAGCAGGAAGATGG - Intergenic
979753113 4:124303872-124303894 CACATTAAAAGGCAGGAAAGGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
982981615 4:162144094-162144116 CACAGTGAAGAACAGGGACGAGG + Intronic
983575223 4:169254260-169254282 CACAGTCATGAGCAGAAAAGAGG + Intronic
984869137 4:184311335-184311357 CACAGCACAGAGCAAGAATGGGG - Intergenic
984927875 4:184822434-184822456 CACAGTCAAGAACATGAAAGTGG + Intronic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986282672 5:6336419-6336441 CACAGTGCAGGGCAGGAAGCAGG + Intergenic
986743973 5:10728119-10728141 CAAAGAAAAGAACATGAAGGCGG + Intronic
986857832 5:11891633-11891655 GTGAGGAAAGAGCAGGAAGGCGG + Intronic
987605815 5:20134744-20134766 CAAAGTCAAAAGGAGGAAGGAGG - Intronic
988799107 5:34679698-34679720 AGCAGTAATGAGAAGGAAGGGGG + Intronic
989398105 5:40980161-40980183 CAGAGTAAAAATCATGAAGGTGG - Intronic
989398470 5:40983820-40983842 CACAGGAAAGGGCAGGAAGATGG - Intergenic
990496323 5:56351645-56351667 CAAACTAAAGACAAGGAAGGGGG + Intergenic
990807715 5:59684744-59684766 CTCAGTAAATACCAGGAAGCAGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992120806 5:73590080-73590102 GACAGTAACAAGCAGGAAGCTGG + Intergenic
993168234 5:84384058-84384080 TACAGGAAAGAGGAGGACGGTGG - Intronic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
995008960 5:107236239-107236261 CAGAGTATAGAGCAAGAAGAGGG - Intergenic
998893212 5:146768756-146768778 AACAGGAAAGAGCTGGGAGGAGG - Intronic
998966404 5:147545595-147545617 CTCAGCAAAGAGCATGAAGGTGG - Intergenic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999314770 5:150576384-150576406 CACAGGAAAGGGCGGGCAGGTGG + Intergenic
999528593 5:152436371-152436393 CACAGGAGAGAGAATGAAGGAGG - Intergenic
999608429 5:153342789-153342811 CACAGTAAAGAGAAACAAGAAGG - Intergenic
1000116899 5:158162005-158162027 CTCAGAAATGAGCAAGAAGGTGG - Intergenic
1001245831 5:170105444-170105466 CACAGTTCAGAGCAGAAGGGAGG + Intergenic
1002493797 5:179598507-179598529 CACAAGAAAGAGCAGGAACCAGG - Intronic
1003003488 6:2359545-2359567 CTCTGTTAAGAGCAGGGAGGTGG - Intergenic
1003377773 6:5595052-5595074 CACCGTAGAGTGCAGGAAGGGGG + Intronic
1003522364 6:6868915-6868937 CCAAAGAAAGAGCAGGAAGGGGG + Intergenic
1003635970 6:7831884-7831906 CTCAGGAAAGAGCACGAAGCAGG + Intronic
1004468370 6:15906519-15906541 CACAGTGAGGAACAGAAAGGAGG + Intergenic
1004772559 6:18800611-18800633 CACAGTAATAAGCAGGAAGGTGG + Intergenic
1004785131 6:18960135-18960157 AAGAATAAAGTGCAGGAAGGGGG + Intergenic
1005062087 6:21786051-21786073 TACAGGAAAGAGAATGAAGGAGG - Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1006656865 6:35602703-35602725 AACAGTGCAGAGGAGGAAGGCGG - Intronic
1008145591 6:47888054-47888076 CAGAGTAAAGAGCAGAGAGTAGG + Intronic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008851056 6:56022192-56022214 CACATTTAAGAGAAGGAAAGTGG - Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010636321 6:78262978-78263000 CACAGCAAAGATAAGGAAGTCGG + Intergenic
1012143837 6:95656717-95656739 CTCAGGAAAAAGGAGGAAGGTGG - Intergenic
1013023625 6:106246229-106246251 CACATTAAAGATCAAGCAGGAGG + Intronic
1013702115 6:112784611-112784633 CACAGTAGAGAGCATTCAGGTGG + Intergenic
1014020715 6:116585498-116585520 CAGAGTAGAGAGTAGGGAGGGGG + Intronic
1015039038 6:128694006-128694028 CACATTAAAGAGTAGGTAAGTGG + Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017111797 6:150939642-150939664 CGCAGTAGAGAGAAGGCAGGTGG - Intronic
1017891117 6:158640115-158640137 CACAGCAGGGGGCAGGAAGGTGG - Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018816458 6:167336216-167336238 CACTGTAGAGAGCAGCATGGAGG - Intronic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1020000549 7:4753357-4753379 CAGAGGAAAGGGCAGCAAGGCGG + Intronic
1020466942 7:8490819-8490841 AACATTAAAGACCTGGAAGGTGG - Intronic
1022049918 7:26656690-26656712 GACAGTAAAGAGCAGGTAACTGG + Intergenic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1024221759 7:47294241-47294263 CACTGAAAAGAGCTGGAAGGAGG + Intronic
1024584524 7:50830198-50830220 CACAGTAAAGAAAATGGAGGAGG + Intergenic
1025152351 7:56568511-56568533 CACAGGAAATGACAGGAAGGAGG - Intergenic
1025764848 7:64434272-64434294 CACAGGAAATGACAGGAAGGAGG + Intergenic
1030437107 7:109536340-109536362 CACAGAAAATAGCAGAAATGTGG - Intergenic
1030502822 7:110381883-110381905 CACATTATAAAGCAGCAAGGAGG - Intergenic
1033529445 7:142247577-142247599 CCCAGTGCAGTGCAGGAAGGAGG + Intergenic
1033822112 7:145147395-145147417 CACAGTCAGGAACAGGAAGGGGG - Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037708746 8:21338364-21338386 CTCTGTCAAGAGCAGGGAGGGGG + Intergenic
1039868340 8:41525404-41525426 CACTGTAAAGTTCAGGAAGGTGG - Intergenic
1040573631 8:48631279-48631301 AACAGTAAGAAGCAGGAAGCAGG + Intergenic
1041860833 8:62510863-62510885 CACAGGAAAAAGCAGGACAGAGG - Intronic
1041928656 8:63264570-63264592 CAGACTACAAAGCAGGAAGGAGG - Intergenic
1044145450 8:88708534-88708556 CACAGTAAAGCATAGCAAGGGGG - Intergenic
1044180571 8:89188713-89188735 CCAAGTAAAGAGTTGGAAGGAGG + Intergenic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044826140 8:96199203-96199225 CACAGTAGGAAGCAGGAAGCTGG - Intergenic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1047247088 8:123155429-123155451 TACAGTAAAGGGCAGCAGGGCGG + Intergenic
1047321188 8:123785272-123785294 GACAGGAAAGAGCAGGAAAAGGG + Intronic
1048043027 8:130749086-130749108 AGCTGTAAAGAGCAGGAAAGAGG + Intergenic
1049348456 8:142151638-142151660 CACGATCTAGAGCAGGAAGGGGG - Intergenic
1049874385 8:145006658-145006680 AGCAGGAAAGAGCAGCAAGGTGG + Intergenic
1050229039 9:3497898-3497920 TACAGTAAAGAGCAGAAATTAGG - Intronic
1050299554 9:4243241-4243263 CAGAGTACAGTACAGGAAGGAGG + Intronic
1050984711 9:12067620-12067642 CACAGAAAAGAGAAAGAAGATGG + Intergenic
1051286311 9:15500762-15500784 GACAATTAAGAGCAGTAAGGAGG + Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052367216 9:27626228-27626250 CACTCTAAAGAACAGGAAAGTGG + Intergenic
1052535392 9:29739691-29739713 CACACTCAAGAGCAGGAGCGTGG + Intergenic
1052986282 9:34490510-34490532 CACAGTGAAGAGCTGCAAAGGGG - Intronic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1055404016 9:75955273-75955295 AAAAATATAGAGCAGGAAGGGGG + Intronic
1055407372 9:75988903-75988925 CACCGTAAACAGCAGAAGGGTGG - Intronic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1056957035 9:91090799-91090821 CGCATGAAAGAGAAGGAAGGAGG - Intergenic
1057294754 9:93828432-93828454 CACTGTCCAGAGCAGGAAGGAGG - Intergenic
1058341883 9:103907308-103907330 CACAGTAAATGGCACGTAGGAGG + Intergenic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1060975879 9:127764682-127764704 AACAACAAAGAGCAGGAGGGAGG - Intronic
1061518962 9:131106172-131106194 CACAGTACTGAGGAGGAAGTGGG - Exonic
1061618695 9:131796741-131796763 CACAGTGAAGAGCAGCCAGGAGG + Intergenic
1203574632 Un_KI270744v1:165835-165857 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1186501715 X:10055966-10055988 TACAGTAAAGAGCAGAAAGCTGG + Intronic
1187310182 X:18134291-18134313 AAGACTAAAGAGCAGGAATGAGG + Intergenic
1187351018 X:18517208-18517230 CACTGTAAAAAGGAGGAATGAGG - Intronic
1187626261 X:21117408-21117430 AATAGTAAAGAGCAGGAGAGTGG + Intergenic
1189118835 X:38371705-38371727 CCCCCTAAAGAGAAGGAAGGAGG + Intronic
1190397970 X:50003796-50003818 CACAGCCTAGAGAAGGAAGGGGG + Intronic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1190584334 X:51922899-51922921 AACATGAAAGAGGAGGAAGGAGG + Intergenic
1190619891 X:52276376-52276398 AAACGTAAGGAGCAGGAAGGTGG + Intergenic
1191035543 X:56022696-56022718 CACAGTGAAAAGCAGCAACGTGG + Intergenic
1193086700 X:77453465-77453487 CACAGCAAAGAGTTGGCAGGTGG - Intronic
1193351774 X:80472282-80472304 CACAGGAGAGAGCAGGATGTGGG - Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1195281285 X:103336470-103336492 CACAGAAAAGTGCAGTAATGGGG + Intergenic
1197247632 X:124182409-124182431 CCCAGTGAAGCCCAGGAAGGGGG - Intronic
1197675291 X:129323352-129323374 CACAGTAAAGAGGAGAAACTGGG + Intergenic
1199028098 X:142962777-142962799 GACAGTTAAGATCAGGAGGGAGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1200050345 X:153426168-153426190 GACAGTGAGGAGCAGGAAAGAGG - Intergenic
1201365764 Y:13204773-13204795 CACAGGAAAGAGGAGGAAACTGG - Intergenic