ID: 1073544101

View in Genome Browser
Species Human (GRCh38)
Location 10:104334718-104334740
Sequence CAGGGCTTTGTCTACCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073544101_1073544111 29 Left 1073544101 10:104334718-104334740 CCGCAGAGGTAGACAAAGCCCTG 0: 1
1: 0
2: 3
3: 23
4: 306
Right 1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073544101 Original CRISPR CAGGGCTTTGTCTACCTCTG CGG (reversed) Intronic
900151716 1:1181808-1181830 CTGGGCTGAGTCTACCTCTGTGG - Exonic
900411152 1:2513306-2513328 CAGGGCTGTGGGTACCTGTGGGG - Intronic
900543957 1:3218194-3218216 CAGGGCTCTTTCTTCCTCTCTGG + Intronic
902683752 1:18062177-18062199 CAGGACCCTGTCTATCTCTGTGG - Intergenic
902887435 1:19416012-19416034 TGGGGCCTTGTCTACCTCAGAGG - Intronic
903563350 1:24245731-24245753 CAGGGCTTTGTCCTTCTCTGTGG - Intergenic
905546190 1:38802156-38802178 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
907153048 1:52306673-52306695 CAGGGCTGTGACTCCCTCTTTGG + Intronic
907369535 1:53991993-53992015 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
907509516 1:54947772-54947794 CTGGGCCTTGTTTAACTCTGTGG - Intergenic
907932740 1:59015625-59015647 TAGAGCTTTGTCTAGGTCTGAGG + Intergenic
910654861 1:89609403-89609425 CAGGGCTTTGACTCCCTCTTTGG - Intergenic
912553057 1:110496899-110496921 CAGGGCTCTGTTTAACACTGAGG + Intergenic
912754565 1:112313672-112313694 CAGGACTCTTTCTACCTCTGGGG + Intergenic
914242809 1:145863470-145863492 CAGGACTTTGGCTCCCTCCGGGG - Intergenic
916157738 1:161872428-161872450 CAGGGCTTTGTCTTAGTCTCTGG - Intronic
918388531 1:184036089-184036111 CTGGGCTCTGTCTTCCTCAGGGG + Intronic
918644299 1:186885038-186885060 CAGAGCTTTGTCAACCTCAAAGG + Intronic
920276390 1:204808116-204808138 CAGAGCTCTGTCTCTCTCTGTGG + Intergenic
920502085 1:206491816-206491838 CAGGGCTTTGTGGAGCCCTGAGG + Exonic
922729179 1:227941126-227941148 CAGGGCTGTGTCTACACTTGTGG - Intronic
923679995 1:236111507-236111529 CAGGGCTGTGACAATCTCTGGGG - Intergenic
923826785 1:237509144-237509166 CTGGGCTTGATGTACCTCTGGGG + Intronic
924003521 1:239580903-239580925 CAGGGCATTCTTTACCTCTTGGG + Intronic
924294115 1:242568158-242568180 CTGAGCTTTGTCTACCTCAGGGG - Intergenic
924514293 1:244753279-244753301 CAAGGTATTCTCTACCTCTGTGG + Intergenic
1062769966 10:91680-91702 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1062795738 10:343858-343880 CAGGGCTGTGTCTTACTCTTCGG - Intronic
1063009713 10:2010789-2010811 CAGAGCTTTGTAAACATCTGAGG - Intergenic
1063726742 10:8645385-8645407 CAGCACTTTCTCTTCCTCTGAGG - Intergenic
1066128746 10:32369119-32369141 CATGGCTTTGTCTGGCTATGTGG - Intronic
1067000832 10:42611528-42611550 AAGGGCTTTGTCTATCCCTAGGG - Intronic
1067018120 10:42772599-42772621 CAGGGCTTTGACTCCCTCTTTGG + Intergenic
1067669113 10:48303543-48303565 CTGGTCTTTGGATACCTCTGAGG - Intergenic
1067741855 10:48901638-48901660 CAGGCCTGGGTGTACCTCTGAGG - Intronic
1068083675 10:52348239-52348261 CAGGGCTGTGACTTCCTCTTTGG + Intergenic
1068279807 10:54854256-54854278 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1068300382 10:55131360-55131382 CAGGGCTTTGACACCCTCTTTGG - Intronic
1069249022 10:66245315-66245337 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1069593046 10:69653643-69653665 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1070660962 10:78304888-78304910 AAGGGCTCTGGCTACCTCTGAGG + Intergenic
1073544101 10:104334718-104334740 CAGGGCTTTGTCTACCTCTGCGG - Intronic
1073930313 10:108567155-108567177 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1074247854 10:111713112-111713134 CAGGGCTGTGACTACCCCTTTGG - Intergenic
1074991463 10:118712349-118712371 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1075733973 10:124652889-124652911 CAGGGCGTCGTCTGCCTGTGTGG - Intronic
1075787548 10:125060240-125060262 CAGAGCTTTGTTTTCCTCTGCGG - Intronic
1076805546 10:132856830-132856852 TTGGGCTTTGTCTTCCTTTGGGG + Intronic
1077726032 11:4675880-4675902 CTGGGCTTTGCCTACTTCTATGG - Intergenic
1079472219 11:20789468-20789490 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1081045107 11:38264407-38264429 CAGTGCTTTGTCAGCCTCAGTGG - Intergenic
1081082159 11:38755900-38755922 AATGGTTTTGTTTACCTCTGAGG - Intergenic
1082819873 11:57537635-57537657 CAGGGCTTCTCCTACCTGTGGGG - Intergenic
1083166015 11:60888390-60888412 AAGGACTTGGTCTATCTCTGGGG + Intergenic
1084193884 11:67512372-67512394 GAGGACTCTGTCTACCTCGGGGG + Intergenic
1087453346 11:98352842-98352864 CAGGGCTTTGACACCCTCTTTGG - Intergenic
1089404443 11:118185904-118185926 CAAGGCTTTGTATAGCTCTGAGG - Intergenic
1090124802 11:124074893-124074915 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1092229581 12:6769170-6769192 CTGCCTTTTGTCTACCTCTGGGG - Intronic
1093492914 12:19725462-19725484 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1093666759 12:21823627-21823649 CAAGGCTTTGTCTTGCTGTGTGG - Intronic
1094018165 12:25885529-25885551 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1094397059 12:30018910-30018932 CAGGGCTTTGTGGACATCAGGGG + Intergenic
1095984493 12:47990493-47990515 CAAGGCTTGGTTAACCTCTGTGG + Intronic
1096191410 12:49622660-49622682 CAGGAGTTTTTCTACCTCTCCGG + Intronic
1096432539 12:51558923-51558945 CAGGATAGTGTCTACCTCTGTGG - Intergenic
1097140719 12:56900567-56900589 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1098087499 12:66862715-66862737 CAGAGCTTTATCAACCTCCGAGG + Intergenic
1098597754 12:72294084-72294106 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1099148962 12:79084485-79084507 CAGTGCTTTGCCTAAATCTGAGG + Intronic
1100651516 12:96595054-96595076 CAGGGCTGTGATTTCCTCTGAGG + Intronic
1101395908 12:104347285-104347307 AAAGGCTTTGTCACCCTCTGAGG + Intronic
1101555573 12:105805778-105805800 CTGGACTTTGTCCTCCTCTGGGG - Intergenic
1101824295 12:108208670-108208692 CTGGGCTTTGAACACCTCTGTGG - Intronic
1104805629 12:131587571-131587593 CAGGGCTATGACTCCCTCTTTGG + Intergenic
1104860950 12:131923256-131923278 CAGGGCTGTGTCGACCATTGTGG - Intergenic
1104918961 12:132280698-132280720 CGGGGTCTTGTCTCCCTCTGGGG - Intronic
1105041963 12:132967707-132967729 CAGGGCTGTGACTCCCTCTTAGG + Intergenic
1105048630 12:133028136-133028158 CAGGGCTGTGACTTCCTCTTTGG + Intergenic
1106360851 13:29029252-29029274 CAGGGGTTTGTCTTGCTGTGCGG + Intronic
1107612227 13:42126807-42126829 CATTGCTTTGACTCCCTCTGAGG + Intronic
1108240239 13:48456908-48456930 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1109337777 13:61014627-61014649 CTGGGCATTGTACACCTCTGGGG - Intergenic
1114296391 14:21333308-21333330 CAAGGCTTTGTCTACATATGTGG - Intronic
1115221208 14:31060470-31060492 CAGGGGGATGGCTACCTCTGAGG - Intronic
1117991285 14:61436330-61436352 CAGGGCTTTGGTTCCCTCTGAGG - Intronic
1119036284 14:71232513-71232535 CAGGGCTGTGACTACCCCTTTGG + Intergenic
1119431485 14:74570779-74570801 CTGAGCTCTGTCTGCCTCTGGGG + Intronic
1121438956 14:93936830-93936852 TAGGGCTTTCTCTGGCTCTGAGG - Intronic
1121506194 14:94479383-94479405 CAGGGTTTCCTCTAGCTCTGAGG + Intronic
1122885369 14:104708180-104708202 CAGGGCAGGGGCTACCTCTGAGG + Intronic
1125113974 15:36067226-36067248 CAGGGCTTTGACACCCTCTTTGG - Intergenic
1125507184 15:40273655-40273677 CAGGTCTTTGTATGCCACTGAGG + Exonic
1125517047 15:40327203-40327225 CAGAGCTTTGTCTACCATGGAGG + Intergenic
1126208061 15:46068988-46069010 CATGGCGTTGTCTGCTTCTGGGG + Intergenic
1127525823 15:59791435-59791457 CAGGGCTGTGGCTTCCTCTTTGG - Intergenic
1128187244 15:65652758-65652780 CATGGCTGTGTCAAGCTCTGTGG + Exonic
1128847954 15:70917982-70918004 CAGGGCTGTGACTCCCTCTTTGG + Intronic
1129591166 15:76916298-76916320 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1130303304 15:82696673-82696695 CAGGGCTGTGTCTATCTGTAGGG - Intronic
1130907236 15:88249379-88249401 CATGACTGTGTCTCCCTCTGAGG - Intronic
1132935353 16:2477720-2477742 GAAGGCTCTGTCCACCTCTGTGG - Intronic
1133646895 16:7773176-7773198 CATGGCAGTGTCTACTTCTGTGG + Intergenic
1134416379 16:14047212-14047234 CAGGGCTTTATCTTTCTCTCCGG + Intergenic
1134862848 16:17575911-17575933 CAGGGCTTTCTCTACATCAAGGG + Intergenic
1135205552 16:20480836-20480858 CAGTGCATTCTCTACCTCCGAGG - Exonic
1135213354 16:20542977-20542999 CAGTGCATTCTCTACCTCCGAGG + Exonic
1135843059 16:25893985-25894007 CAGGGCGATTTCTACCTGTGTGG + Intronic
1135856560 16:26016874-26016896 CAAGGCTCTGTCTAACTCTAAGG - Intronic
1135949616 16:26901941-26901963 CAGGCCCTGGTCTACCTCTCTGG - Intergenic
1137615816 16:49846334-49846356 CAGGGCGCTCACTACCTCTGTGG - Intronic
1138196067 16:55053166-55053188 CAGACCTCTGGCTACCTCTGAGG + Intergenic
1138200904 16:55087652-55087674 GATGGCTTGGTGTACCTCTGTGG - Intergenic
1139718470 16:68833399-68833421 CTGGTCTTTGTCTGACTCTGAGG - Exonic
1139775725 16:69316033-69316055 CTTGGCTTTGTCCTCCTCTGTGG - Exonic
1139777382 16:69324867-69324889 CAGGGCTGTGTCTTCCTTGGGGG + Exonic
1140017744 16:71205012-71205034 TAGGGCTTTGCTTACTTCTGTGG - Intronic
1141252584 16:82371625-82371647 CATGGCCTTGTCTACTCCTGAGG + Intergenic
1141703132 16:85651471-85651493 CAGGGCTTTGTCCTCGGCTGAGG + Intronic
1141995860 16:87635988-87636010 CAGGACATTATCTAGCTCTGGGG + Intronic
1142801862 17:2351321-2351343 CAGGGATTGGTCTGCCTGTGAGG + Intronic
1143840602 17:9728572-9728594 CAGGGGTCTGTCTAGCTCAGAGG - Exonic
1144353585 17:14423248-14423270 CAGTGCTTTGTATTCCTTTGTGG + Intergenic
1145272751 17:21413447-21413469 GAAGGCTTTGTCTAGCTCTGAGG + Intronic
1145310959 17:21700910-21700932 GAAGGCTTTGTCTAGCTCTGAGG + Intronic
1146359266 17:32160565-32160587 CAGGGCTGTGACTCCCTCTTTGG + Intronic
1146511242 17:33450721-33450743 CATGACTTTGTCTTCCTCTGTGG + Intronic
1148386202 17:47236920-47236942 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1149329942 17:55570359-55570381 CAGGGCTATGACTCCCTCTTTGG + Intergenic
1150448243 17:65244228-65244250 CGGGGCTTAGTCCACTTCTGAGG - Intergenic
1150529264 17:65959574-65959596 CAGGGCTATGACTTCCTCTTTGG + Intronic
1152125470 17:78444115-78444137 GAGGACTTTGAGTACCTCTGTGG - Intronic
1152895790 17:82910525-82910547 CAGTGCTTTCTCCAGCTCTGTGG + Intronic
1154036106 18:10803956-10803978 CAGGGCTTTGTCCTCTTCTTTGG + Exonic
1155819265 18:30353447-30353469 CAGGGCTGTGACAACCTCTTTGG + Intergenic
1156405574 18:36779475-36779497 CAGGGCTCTGGCTTCTTCTGGGG - Exonic
1158023302 18:52869017-52869039 CAGGGCTGTATCTCCCTCTTTGG - Intronic
1158256306 18:55553000-55553022 CTGTGCTTTTTCTCCCTCTGTGG - Intronic
1159836391 18:73341942-73341964 CAGGTCTTTCTCTGACTCTGGGG - Intergenic
1161154769 19:2726928-2726950 CTGGGCTTTGTGGACATCTGGGG - Intronic
1161780304 19:6287265-6287287 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1163661969 19:18583630-18583652 CAGGGCTTTGATTACCTCCTGGG - Intronic
1164669942 19:30066799-30066821 CAGGGCTCTGTGTACCCATGGGG + Intergenic
1166897568 19:46033451-46033473 CAGGGCTATGACTCCCTCTTGGG + Intergenic
1167702044 19:51054557-51054579 GAGGACTTTGTTTTCCTCTGAGG - Intergenic
925119496 2:1406529-1406551 CAGGGCTGTGTCTTGCTCAGGGG - Intronic
928365071 2:30694204-30694226 GATGGCAATGTCTACCTCTGCGG + Intergenic
930612111 2:53554858-53554880 CAGGGCTGTGACTCCCTCTTTGG + Intronic
932054627 2:68432040-68432062 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
932353773 2:71051804-71051826 CAGGGCTGTGTATACCCCTGCGG + Intergenic
932479344 2:72029223-72029245 CAGGGCATTGTCTATTTCAGAGG + Intergenic
932479516 2:72030766-72030788 CAGGGCGTTGTCTACATCAGTGG + Intergenic
932501561 2:72187223-72187245 CAGGGCTGTGACTCCCTCTTTGG - Intronic
932594217 2:73084098-73084120 CAGGTTTGTGTGTACCTCTGGGG - Intronic
932774924 2:74522641-74522663 CAGGGCTTTGGCCAGCTCAGGGG + Exonic
932852300 2:75199319-75199341 CAGGGCTTTGCCTTTCCCTGCGG - Exonic
932899039 2:75676997-75677019 TAGGGCATTGGCTACCTATGGGG - Intronic
933801059 2:85960820-85960842 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
933974275 2:87495677-87495699 CAGCCCTTTGTCCACCTCTTAGG + Intergenic
934699987 2:96431288-96431310 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
935068342 2:99672256-99672278 AAAGGCTCTGTCTACTTCTGAGG + Intronic
936319551 2:111455146-111455168 CAGCCCTTTGTCCACCTCTTAGG - Intergenic
937201016 2:120204563-120204585 CTGGCCTTTGTCTATCTCTGTGG + Intergenic
937754491 2:125519545-125519567 GAGGGCTTTTTCTATTTCTGTGG - Intergenic
938371756 2:130773241-130773263 CAGTGCTTTGTCTGCCTCCCAGG - Intergenic
940396200 2:153195591-153195613 CAGGGCTATGACTCCCTCTTTGG - Intergenic
940422700 2:153498674-153498696 CAGGGCTGTGACAACCTCTTTGG - Intergenic
940956868 2:159738266-159738288 CAGGGCTGTGACAACCTCTTTGG - Intronic
942418112 2:175780022-175780044 CAAGACTTTGTCTACTTCTGGGG + Intergenic
943129422 2:183838220-183838242 CAGGGCTGTGACACCCTCTGTGG + Intergenic
943820315 2:192314090-192314112 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
945837301 2:214848325-214848347 CTTGGCTTTTTCTACCACTGTGG + Intergenic
946161466 2:217838539-217838561 CAGGGCAGTGCCTCCCTCTGCGG + Intronic
948467157 2:238158148-238158170 CAGGGTCTGGTCCACCTCTGGGG + Intergenic
1168860608 20:1043716-1043738 CAGAGCACTGTCTACCTCTCAGG + Intergenic
1168991961 20:2102896-2102918 CCGGGCTTTGTGTACCTCTGCGG - Exonic
1170043765 20:12064866-12064888 CAGGGCTCTGACTCCCTCTTTGG - Intergenic
1170501116 20:16975704-16975726 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1171157430 20:22889320-22889342 CAGGGCAGTGGCTACTTCTGGGG + Intergenic
1171421996 20:25023826-25023848 CAGGCCTTTGTCCAGTTCTGAGG + Intronic
1173254092 20:41381083-41381105 TAGGACTTAGTCTCCCTCTGGGG - Intergenic
1174501024 20:50984421-50984443 CAGTGCTCTGTCTACCTGGGAGG + Intergenic
1174513122 20:51070944-51070966 AATGCCATTGTCTACCTCTGGGG + Intergenic
1175001271 20:55632898-55632920 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1176091538 20:63320593-63320615 CAGGGCCATGCCCACCTCTGTGG + Intronic
1178996739 21:37408885-37408907 CAGGGCTTTTTCCACTTCAGGGG + Intronic
1179172989 21:38987368-38987390 CTGGGCTTTCTCTGCTTCTGTGG + Intergenic
1179303713 21:40135966-40135988 CAGGCCTTTGGCTCCCACTGGGG - Intronic
1179992030 21:44953206-44953228 CAGGGCTATCCCTTCCTCTGTGG + Intronic
1180670567 22:17549367-17549389 CAGGGCTTACTCTTCCCCTGTGG + Exonic
1180754956 22:18155035-18155057 CAGGGCTGTGTCAGCCTCAGTGG - Intronic
1181406981 22:22692102-22692124 AAGGGCTTTGTCTTCCTCTGGGG + Intergenic
1182265369 22:29110615-29110637 CACAGCTTTTTCTTCCTCTGTGG - Intronic
1182471764 22:30553280-30553302 CAGGACTTTCTCTCCCACTGGGG + Intergenic
1182904196 22:33921617-33921639 CAAGGCTTCCTCTTCCTCTGAGG + Intronic
1183136729 22:35896152-35896174 CATGGCATTGACCACCTCTGTGG + Intronic
1184054179 22:42033323-42033345 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1184869345 22:47225413-47225435 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1184970568 22:48016991-48017013 CAGCGCTCTGCCTACCTGTGTGG + Intergenic
1184986789 22:48141334-48141356 CCGGGCTTTGCCAACATCTGTGG - Intergenic
1185095367 22:48803437-48803459 CAGGGCTTTCTTTCCTTCTGTGG + Intronic
950572841 3:13812520-13812542 CAGGACTTTGTCTGTCTTTGTGG - Intergenic
951182199 3:19671781-19671803 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
953432865 3:42854134-42854156 CAGGGTTTGGTCAAGCTCTGTGG + Intronic
953663204 3:44905971-44905993 CAGGGCTTCCTCTGCCTCTCAGG - Intronic
953766649 3:45747998-45748020 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
953839097 3:46374397-46374419 CAGGTCTTTGTCTTGCTATGGGG + Exonic
954737155 3:52715919-52715941 CAGGGCTGTGACTTCCTCTTTGG + Intronic
954937262 3:54337899-54337921 CATGGCTTGATCTACCCCTGTGG - Intronic
955764975 3:62333902-62333924 CAGAGCTTTGGCTATCTGTGAGG - Exonic
956349656 3:68320823-68320845 CACTGCTTTGGCTCCCTCTGGGG - Intronic
957275317 3:78083535-78083557 AAGTGCTTTCTCTACCTCAGAGG + Intergenic
958675470 3:97264505-97264527 CAGGGCTGTGGCTCCCTCTTTGG - Intronic
960333938 3:116393254-116393276 CAGGGCTGTGACTCCCTCTTTGG + Intronic
960874359 3:122282264-122282286 CAGGGCTTGGTCCACTTCGGAGG + Intronic
961521159 3:127468054-127468076 CAGGACTTGGTCTACATTTGTGG - Intergenic
961863056 3:129933562-129933584 CAGGGCTTTCTCTCCAGCTGTGG - Intergenic
962659659 3:137588621-137588643 CAAAGCTTTATCTTCCTCTGTGG - Intergenic
963454172 3:145522551-145522573 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
963805247 3:149715277-149715299 CAGGGCTGTGACTCCCTCTTTGG + Intronic
964075096 3:152683942-152683964 CAGGGCTATGACTCCCTCTTTGG - Intergenic
966314638 3:178632167-178632189 CAGGGCTTTGTCTGACTGTTGGG + Intronic
967187359 3:186956162-186956184 CAGGGATTTTTCTCACTCTGTGG - Intronic
967303931 3:188042682-188042704 CAGGGCTGTCTCTTCCACTGTGG - Intergenic
968273312 3:197421389-197421411 CCGGGCTTTGTCTGCATCTGTGG - Intergenic
968798024 4:2722091-2722113 TAGGGCTGTGACTACCTCTTGGG + Intronic
968919259 4:3514305-3514327 CAGGGTTTTCTGTGCCTCTGTGG + Intronic
971023178 4:22559368-22559390 CAATGCTTTTCCTACCTCTGTGG + Intergenic
971548670 4:27920731-27920753 GAAGGCTTTATCTACCTCTGAGG + Intergenic
972158739 4:36197884-36197906 CAGGGCTGTGACTCCCTCTTTGG - Intronic
972645916 4:40967429-40967451 CAGGGCTATGACTCCCTCTTTGG + Intronic
973808756 4:54550044-54550066 CAAGGCTCTGTCTACCTCGCAGG + Intergenic
975913761 4:79298427-79298449 CAGGGCTGTGACTCCCTCTTTGG + Intronic
976511029 4:85910218-85910240 CAGGGCTGTGACTCCCTCTTTGG - Intronic
977359179 4:95981717-95981739 CAGGGCTGTGACTGCCTCTTTGG + Intergenic
977471954 4:97453129-97453151 CAGGGCTGTGACTCCCTCTTTGG + Intronic
978466822 4:109017039-109017061 CAGGGCTGTGACTCCCTCTTCGG + Intronic
980007683 4:127559981-127560003 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
980852540 4:138400473-138400495 CAGTGTTTTGGCTACCACTGTGG + Intergenic
982434537 4:155368855-155368877 CATGGCTTTATCTATCTCTCTGG + Intronic
983938050 4:173516845-173516867 TAGGGCTTTGTCGAACTATGCGG - Intergenic
986353528 5:6902836-6902858 TAGGGCTTTTTATACCTCGGAGG + Intergenic
987764531 5:22208073-22208095 GAGGGCATTTTCTAGCTCTGTGG - Intronic
989604973 5:43235599-43235621 GACAGCTTTGTCCACCTCTGAGG + Intronic
989654791 5:43734696-43734718 CAGTTCTTTTTCTACCTCAGGGG - Intergenic
989821780 5:45801196-45801218 CAGGGCTTTGACACCCTCTTTGG + Intergenic
990187148 5:53221294-53221316 CAGGGCTTTGATTACCTCCTGGG + Intergenic
990889995 5:60637435-60637457 CATGGCAGTGTCTGCCTCTGGGG - Intronic
990923384 5:60993290-60993312 CAGGGCTGTGACTCCCTCTTTGG - Intronic
991253752 5:64592676-64592698 ATGGGCTTTGTCTAGCTTTGGGG - Intronic
991899272 5:71441223-71441245 GAGGGCATTTTCTAGCTCTGTGG - Intergenic
991925645 5:71702890-71702912 CAGGTTTGTGTCTCCCTCTGCGG + Intergenic
992350322 5:75921508-75921530 CAGGGCTGTGACAATCTCTGGGG + Intergenic
996717964 5:126602391-126602413 CTGCTTTTTGTCTACCTCTGTGG + Intronic
997830419 5:137144945-137144967 CAGGGCTTTGTCATCCTCTGGGG - Intronic
998577967 5:143337872-143337894 CAGGGCAGTGGTTACCTCTGGGG + Intronic
999383759 5:151140094-151140116 CTGGGCTGTGTCTACTTTTGGGG + Intronic
1000054633 5:157594291-157594313 CAGGGCATTGTCTAACTCCAGGG - Intergenic
1001855037 5:175003690-175003712 CAGGGCTCTCTCCTCCTCTGTGG - Intergenic
1003223901 6:4187846-4187868 CAGGGCTTTTCCAAACTCTGAGG - Intergenic
1004957536 6:20746304-20746326 AAGGGCTATTTCTACCTTTGGGG + Intronic
1005930586 6:30481303-30481325 TAGGGGTCTGTCTTCCTCTGCGG - Intergenic
1006090153 6:31623902-31623924 CAAGCCTCTGTCTACCTCTTGGG - Exonic
1008328590 6:50217846-50217868 AAGGGCTTTGTCCATCTTTGTGG + Intergenic
1010508743 6:76691474-76691496 CAGGGCAGTGTCTACTTCTAGGG - Intergenic
1010519781 6:76818484-76818506 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1012231096 6:96762141-96762163 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1012658214 6:101852928-101852950 CAGTACTTTGTGTACCCCTGGGG + Intronic
1013287176 6:108691476-108691498 CAGGGCTTGCTCCACCTCTGGGG + Intergenic
1014289390 6:119540472-119540494 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1014391785 6:120873168-120873190 CAGGGCTGTGACACCCTCTGTGG + Intergenic
1015663820 6:135604474-135604496 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1016417131 6:143844486-143844508 AAGGGCTTTTTCTTCCTGTGAGG - Exonic
1017737704 6:157380224-157380246 CGGGGCTATGCCCACCTCTGCGG + Intergenic
1018414951 6:163592731-163592753 CAGTCCTTTGTGTATCTCTGTGG - Intergenic
1018659890 6:166076356-166076378 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1018944961 6:168341194-168341216 CAGGGCCTCGTCTCCCTCTGTGG + Intergenic
1019509751 7:1412007-1412029 CAGTGCTTAGCCTACCCCTGAGG - Intergenic
1021500688 7:21329478-21329500 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1022063153 7:26821855-26821877 AAGGGCTTGGTATACTTCTGGGG - Intronic
1022320875 7:29286472-29286494 CAAGGCTGTGTTTACCTCTGAGG + Intronic
1023263210 7:38379185-38379207 CAGGGCTTGGACTACGCCTGGGG + Intergenic
1023789139 7:43737852-43737874 CAGGGCTTTATGGACCTCAGAGG - Intergenic
1024894465 7:54241822-54241844 CAGTGCTGTGTTTACCTATGTGG - Intergenic
1028816795 7:95156334-95156356 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1029281430 7:99438443-99438465 CAGGGTTTTTTCTCGCTCTGTGG - Intronic
1030340870 7:108378745-108378767 CACTGCTTTGTCTGGCTCTGAGG - Intronic
1032265201 7:130365780-130365802 GAAGGCTTTGTCTGCCTTTGCGG - Intronic
1038840302 8:31178185-31178207 CAGGGCTTTGTCTGAATCTATGG - Intergenic
1039814211 8:41078288-41078310 CAGGGCTGTGTTAGCCTCTGTGG + Intergenic
1040661938 8:49583876-49583898 CAGGGCTGTGATTACCTCTTTGG + Intergenic
1041205416 8:55494303-55494325 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1043087084 8:75848864-75848886 CAGGGCTGTGACTACCTCACTGG - Intergenic
1043758392 8:84032294-84032316 CAGGGCTGTGACAACCTCTCTGG + Intergenic
1045198312 8:99952505-99952527 CATGGCTGTATCTACCTGTGAGG + Intergenic
1045249971 8:100474997-100475019 CAAGGCCTTCTCTTCCTCTGTGG - Intergenic
1045437692 8:102180995-102181017 CAGGGCTTTCTCTTCTTCTTTGG - Intergenic
1045552702 8:103186707-103186729 CAGTGCTTTCTCTATTTCTGGGG - Intronic
1047166258 8:122441774-122441796 CACAGCTTTATCTACTTCTGGGG - Intergenic
1047875745 8:129135821-129135843 CATGGCTTTGAATCCCTCTGTGG - Intergenic
1049116888 8:140696546-140696568 CTGGGCATTGTTGACCTCTGGGG - Intronic
1049604182 8:143521417-143521439 CAGCACTATGTCTGCCTCTGGGG + Intronic
1050484044 9:6115123-6115145 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1051742144 9:20262517-20262539 CAGGGCTATGGTTAGCTCTGAGG - Intergenic
1051957225 9:22711107-22711129 CAGGGACTTGTCTTCCTGTGGGG - Intergenic
1052552465 9:29969204-29969226 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1053304841 9:36977095-36977117 CAGGGCTGTGTCTGCTTCTCAGG - Intronic
1055105190 9:72504832-72504854 CAGGGCTATATGTACCTGTGAGG + Intergenic
1055277516 9:74635687-74635709 CAGGGCATTGTCTATGTCTTAGG - Intronic
1055572674 9:77632597-77632619 CAGGGCTGTGACTCCCTTTGGGG + Intronic
1056250178 9:84739733-84739755 GAGGGCTTTTTCTAGTTCTGGGG - Intronic
1056997302 9:91474891-91474913 CAGGACTTTGTCTACATGAGGGG - Intergenic
1058175703 9:101734610-101734632 CAGGGGTTTGTCCATCTCAGTGG + Intronic
1059749334 9:117233120-117233142 CAGGGCTCTGTGTCCTTCTGAGG + Intronic
1060701391 9:125752301-125752323 CAGGCCTTTCTCTTCCCCTGCGG - Intronic
1061770715 9:132918659-132918681 TAGGGGTCTGACTACCTCTGGGG - Intronic
1186426756 X:9468547-9468569 CAGGGCTTGGGGCACCTCTGGGG - Intronic
1186640665 X:11451688-11451710 AAGGGCATTGTCTTACTCTGGGG - Intronic
1187204346 X:17168129-17168151 CAGGGCTTTCTCTAATGCTGTGG + Intergenic
1189856275 X:45228492-45228514 CAGGGCTGTGACTTCCTCTTTGG - Intergenic
1190189223 X:48262548-48262570 GAGGGCTTTGTCTGCACCTGGGG + Intronic
1190534867 X:51416444-51416466 CACGCCTTTGTTTACCTTTGGGG + Intergenic
1193108333 X:77703549-77703571 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1194231355 X:91328564-91328586 CGGGTCTTTTTCTACCTCTCAGG - Intergenic
1194413162 X:93579568-93579590 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1195178923 X:102338447-102338469 CAGGGCTATGACTCCCTCTTTGG - Intergenic
1196803329 X:119563059-119563081 CAGGCCTGTGGCTACCTCTCAGG - Intronic
1197501180 X:127244050-127244072 CAGGGCTATGACTCCCTCTTTGG - Intergenic
1199614880 X:149648393-149648415 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1200968373 Y:9122626-9122648 CAGGAATTTGTCTGCTTCTGTGG + Intergenic
1201915715 Y:19179514-19179536 CAGGGCTTTGACTACATCACTGG - Intergenic
1202142380 Y:21741450-21741472 CAGGAATTTGTCTGCTTCTGTGG - Intergenic
1202144478 Y:21764168-21764190 CAGGAATTTGTCTGCTTCTGTGG + Intergenic