ID: 1073544103

View in Genome Browser
Species Human (GRCh38)
Location 10:104334736-104334758
Sequence CAGTGATGTCCAATAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073544103_1073544111 11 Left 1073544103 10:104334736-104334758 CCCTGCACTATTGGACATCACTG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073544103 Original CRISPR CAGTGATGTCCAATAGTGCA GGG (reversed) Intronic
900743381 1:4343864-4343886 CCTTGATGTCCACAAGTGCAGGG - Intergenic
900807095 1:4774621-4774643 CAGTGATCCCAAAGAGTGCAGGG - Intronic
904353112 1:29921828-29921850 TTGTGATGTCCTTTAGTGCAGGG - Intergenic
907725860 1:57019713-57019735 AATTAATGTCCAATAGTGGAGGG + Intronic
910626394 1:89312667-89312689 CAGTGGTTTCCAATAGTAAAAGG + Intergenic
913580103 1:120218031-120218053 AAGTCATGTCCAAAATTGCATGG + Intergenic
913628071 1:120680363-120680385 AAGTCATGTCCAAAATTGCATGG - Intergenic
914562029 1:148829471-148829493 AAGTCATGTCCAAAATTGCATGG + Intronic
914610801 1:149300750-149300772 AAGTCATGTCCAAAATTGCATGG - Intergenic
916116583 1:161490005-161490027 CAGTGATTTCCACTATTACAAGG - Intergenic
918911545 1:190578602-190578624 CAGTGATTTTAAATAGTACATGG - Intergenic
920659942 1:207907194-207907216 CAGTAATGTCTAATATTTCAGGG - Intronic
921872441 1:220155417-220155439 CAGTGATGTCCAAAATGTCATGG - Intronic
924946994 1:248853228-248853250 CAGAGATGTGCAAGAGGGCAAGG - Intronic
1063954357 10:11252605-11252627 CAGTGACATCCCAAAGTGCAGGG - Intronic
1069115091 10:64494784-64494806 CAGTTGTGTCCAAGAGTTCACGG - Intergenic
1072440593 10:95451067-95451089 CAGTCATGTCCATTAGAACATGG + Intronic
1073544103 10:104334736-104334758 CAGTGATGTCCAATAGTGCAGGG - Intronic
1077184053 11:1228611-1228633 CAGTGCTGTCCACCAGTGCGTGG - Exonic
1086421530 11:86642337-86642359 CAGTGATGCCAACTACTGCATGG + Intronic
1094281653 12:28746753-28746775 CAGTGATGTCCAGGAATGTATGG + Intergenic
1103929493 12:124441915-124441937 CAGTGATCTTCAAAAGTGCTGGG + Intronic
1104055485 12:125227046-125227068 CAGTGATGAACAAAAGTGCCAGG + Intronic
1104212353 12:126701261-126701283 CAGTGATGAGCAAAAATGCATGG - Intergenic
1109256579 13:60090456-60090478 TACTGATGTCTAACAGTGCATGG - Intronic
1112124865 13:96453964-96453986 CAATGATGACCAACAGGGCAAGG - Intronic
1113183432 13:107658564-107658586 CTGTGATTTCTAATAGTCCAGGG + Intronic
1118903105 14:70002836-70002858 CAGTGATGTCCCATAAATCATGG + Intronic
1121946692 14:98129959-98129981 CAGTGATGTGCAGTAGGGCAGGG - Intergenic
1127726066 15:61751185-61751207 GTGTGATGTCCATTAATGCAAGG - Intergenic
1127878117 15:63129629-63129651 CAGTGATTTACAATAGAGCAAGG + Exonic
1128942489 15:71800060-71800082 GAGTGATGATCAAGAGTGCATGG - Intronic
1132376370 15:101330699-101330721 CAGTGAGGTTCCATTGTGCAAGG + Intronic
1133738348 16:8632584-8632606 CAGTGATCTCCACCTGTGCAAGG + Intronic
1137902342 16:52282310-52282332 CAGTGATGTCCTAGAGTAAATGG + Intergenic
1142547200 17:713343-713365 TAGTGATTTCTAATACTGCAGGG - Intronic
1148523698 17:48308487-48308509 CAGTGATCTCCAATACTGCAAGG + Intronic
1152580527 17:81163746-81163768 CAGAGACGCCCGATAGTGCAGGG - Intronic
1153139465 18:1954875-1954897 CAGAGATCTCCAAGAATGCAGGG + Intergenic
1157627140 18:49060508-49060530 CATTTATGTCCAGTAGTGAATGG - Intronic
1158438490 18:57452067-57452089 CAAGGATGTCCAATAGTATAGGG + Intronic
1159625177 18:70685106-70685128 TAGTGATTTGCAATAGTGAAAGG + Intergenic
1162048475 19:8017465-8017487 CAGTGATGTCCTCTAGAACAGGG - Intronic
1163255875 19:16155515-16155537 CAGGAAGGGCCAATAGTGCAGGG + Intronic
1167728958 19:51239065-51239087 CTGTGATTTCCAGTACTGCAGGG - Intronic
927303425 2:21542121-21542143 CCTTGATATCCAATAGGGCAAGG + Intergenic
932231980 2:70090293-70090315 GAGTGATCTCCCATAGTGCCTGG - Intergenic
937280757 2:120715855-120715877 CAGGCAAGTCAAATAGTGCATGG + Intergenic
940877826 2:158915840-158915862 GAGTTATGTCTAATAGTGAACGG + Intergenic
1169425357 20:5492667-5492689 CAGTGATGTCCATTATTGAAGGG + Intergenic
1170159290 20:13296026-13296048 CAGGGGTGTCCAAAAATGCAAGG - Intronic
1170384703 20:15803604-15803626 TAGTGATTTCCCACAGTGCAAGG + Intronic
1172013389 20:31859434-31859456 CAGTGCTGTGCAAAGGTGCAGGG - Intronic
1172303798 20:33867384-33867406 CAGAGATGTCCAAGACTGCCTGG - Intergenic
1172757876 20:37299968-37299990 CAGTGGTGGCCAGTGGTGCAAGG - Intronic
1173768175 20:45632584-45632606 CTGTGAAGTGCAATAGAGCAAGG - Intergenic
1176359147 21:5979259-5979281 CAGTGAAGTCCAAGACTGGATGG - Intergenic
1178674707 21:34621257-34621279 TAGTGATGTTGAATAGTGCCTGG + Intergenic
1179764371 21:43559291-43559313 CAGTGAAGTCCAAGACTGGATGG + Intronic
1182302706 22:29346652-29346674 CAAGGATGTCCTGTAGTGCAGGG - Intronic
954884115 3:53857056-53857078 CAGTGTTGTCCAAACGTGCTGGG + Intronic
957511114 3:81188730-81188752 AAATGATGTGCAATAGTGAAGGG - Intergenic
962422166 3:135238382-135238404 CAGTGAGGCCCAACAGTGCAAGG + Intronic
963454837 3:145532389-145532411 CAATGATGCCCTATATTGCAAGG + Intergenic
967287191 3:187884015-187884037 CAGTGATTTCCAGGAGTGAAAGG - Intergenic
968946241 4:3665923-3665945 GAGTGATTTCCGATAGGGCAGGG + Intergenic
970752375 4:19379436-19379458 CTGTGATGTCCTTTAGTGCAAGG + Intergenic
973177519 4:47226010-47226032 CAGGGATGTACAACAATGCAAGG + Intronic
973840224 4:54853573-54853595 CAGAGATTTCCAACAGTACAAGG - Intergenic
974826709 4:67140451-67140473 CAGTGATTTGCAAAACTGCAAGG + Intergenic
975613527 4:76223861-76223883 TAGTGATCTTCAATAGTCCAGGG - Intronic
977170935 4:93761750-93761772 CAGTAATATCAAATAGTGTAAGG - Intronic
978333670 4:107643388-107643410 CAGAGATGTCCAAAGTTGCATGG - Intronic
981231722 4:142364487-142364509 CAGTGATTTCCATTTGTGCAGGG + Intronic
984107379 4:175565276-175565298 CAGGAATGTAAAATAGTGCAGGG - Intergenic
995741781 5:115363563-115363585 CATTGATGTCAATTAGTGCAGGG + Intergenic
996529555 5:124513415-124513437 CAGTGATTTCCAAATGTGAAGGG - Intergenic
999271324 5:150297879-150297901 CAGTGATGTGCATCAGTGCCCGG + Exonic
1000325388 5:160168218-160168240 CAGTAATTTCCAATAGGGAAAGG - Intergenic
1003233436 6:4275203-4275225 CAGTGATGTTCAATAGGCCCTGG - Intergenic
1007590285 6:43016912-43016934 CAGTGTTCTCCAACAGTGAAGGG - Intronic
1012019492 6:93899861-93899883 AAGTGATGTGCTATATTGCAGGG + Intergenic
1012242474 6:96889242-96889264 CAGTGATGTCAGAAAGTGCATGG - Intergenic
1018925436 6:168202556-168202578 CAGTGGTGTTCAAGAGTGTATGG + Intergenic
1020949933 7:14662644-14662666 CAGTGATGTCCCATAGTATATGG + Intronic
1028437935 7:90826548-90826570 CAGAGATGGCCAACAGTGCCAGG - Intronic
1028631508 7:92939616-92939638 CAGTGATGTCCCCTGGGGCAGGG + Intergenic
1040884751 8:52249406-52249428 CAGTGATGTAGAATAAAGCAGGG + Intronic
1041745722 8:61207299-61207321 CAGTGATGTGCAGAGGTGCATGG + Intronic
1041745739 8:61207380-61207402 CAGGGATGTGCAAAGGTGCATGG + Intronic
1043155120 8:76769166-76769188 CAGCAATGTCAAATATTGCAGGG + Intronic
1044125062 8:88450098-88450120 CTGTGGTTTCCAAGAGTGCAGGG + Intergenic
1047165683 8:122435887-122435909 CAGTTATGTACAGGAGTGCAAGG + Intergenic
1048248922 8:132841341-132841363 CACTGCAGTCCAATAGTCCAAGG - Intronic
1051789571 9:20785369-20785391 GAGTGATGACTAAGAGTGCAGGG - Intronic
1054916148 9:70496976-70496998 CAGGGATGGCCCAAAGTGCAGGG + Intergenic
1060569513 9:124625555-124625577 AAATGATGACCAATATTGCAAGG + Intronic
1186055808 X:5648743-5648765 CAGTCATGTCAAATATTGCTAGG + Intergenic
1188057789 X:25562159-25562181 CAGTGATGTCCACCACTTCATGG + Intergenic
1188388187 X:29587707-29587729 CAGATAAGACCAATAGTGCAAGG - Intronic
1188472313 X:30554516-30554538 CACTGATGACCAATAGTCTATGG - Intergenic
1189728129 X:43989418-43989440 AAGTTATTTCCAACAGTGCAAGG - Intergenic
1189728468 X:43993506-43993528 AAGTTATTTCCAACAGTGCAAGG + Intergenic
1194126294 X:90021243-90021265 AAGTGCTGTCCAATTGGGCAGGG + Intergenic
1198614608 X:138442642-138442664 CTGTGAAGTCCATGAGTGCAGGG + Intergenic
1198939794 X:141941065-141941087 CAGTGATTCTCAAAAGTGCATGG - Intergenic
1201533366 Y:15017153-15017175 CATTGCTGTTCAGTAGTGCATGG + Intergenic