ID: 1073544104

View in Genome Browser
Species Human (GRCh38)
Location 10:104334737-104334759
Sequence ACAGTGATGTCCAATAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073544104_1073544111 10 Left 1073544104 10:104334737-104334759 CCTGCACTATTGGACATCACTGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073544104 Original CRISPR ACAGTGATGTCCAATAGTGC AGG (reversed) Intronic
910763222 1:90755780-90755802 ACAGTGAAGTCAAAATGTGCTGG - Intergenic
911131084 1:94389208-94389230 ACAGTGATGCCTAAGAGGGCTGG + Intergenic
911149366 1:94582542-94582564 ACACTGATGGCCAACAGTGAAGG - Intergenic
911942731 1:104068629-104068651 AAAGTGCTTTCCAAGAGTGCAGG + Intergenic
920659943 1:207907195-207907217 ACAGTAATGTCTAATATTTCAGG - Intronic
923610481 1:235488020-235488042 ACCGTGGTGTCCCAAAGTGCTGG + Intronic
1065892462 10:30132811-30132833 ACAGTGATGTTCAATGGTCAGGG + Intergenic
1073462359 10:103673312-103673334 ACAGTGGTCTCCCAAAGTGCTGG - Intronic
1073544104 10:104334737-104334759 ACAGTGATGTCCAATAGTGCAGG - Intronic
1075416629 10:122268984-122269006 ACAGTCATGTACAAAAATGCAGG + Intergenic
1085374411 11:76045944-76045966 ACAGTGATGTACCTTAGTGTGGG - Intronic
1090476947 11:127031723-127031745 ACAGTGATTTCCAAACCTGCTGG + Intergenic
1095114384 12:38334439-38334461 ACAGTGATGTCCTTTAGTTGGGG + Intergenic
1097476629 12:60065153-60065175 ACCTTGTTGTCCAATAGTGAAGG - Intergenic
1098180371 12:67840493-67840515 ACAGTGGTGTGCAAGAGTGTTGG + Intergenic
1098597164 12:72287216-72287238 CCAGAGATGTACAATAGTGCAGG - Intronic
1100231042 12:92608278-92608300 ACAGTGCTGTCAAATAGTAAAGG - Intergenic
1103642677 12:122364690-122364712 AAAGTGAGGTCCAAGAGTGGTGG - Intronic
1103929492 12:124441914-124441936 CCAGTGATCTTCAAAAGTGCTGG + Intronic
1105660700 13:22491268-22491290 ATTGTGATGAGCAATAGTGCAGG - Intergenic
1110192674 13:72749323-72749345 TCAGTGATGTCCTTTAATGCGGG + Intronic
1112430658 13:99347495-99347517 ACAGTGATGTCCCAGAATGAGGG - Intronic
1113698528 13:112365692-112365714 ACATTGATTTCCTATAGTTCTGG - Intergenic
1113824708 13:113242538-113242560 ACTGTGATTTCCCAAAGTGCTGG - Intronic
1117581626 14:57157275-57157297 AAACTGATGTCCAATTGTGGAGG + Intergenic
1121946693 14:98129960-98129982 TCAGTGATGTGCAGTAGGGCAGG - Intergenic
1122038801 14:98967325-98967347 ACAGTGATGGCCACTGCTGCAGG + Intergenic
1122518400 14:102325053-102325075 AAAGTGATGTAGAATAGGGCTGG + Intronic
1202836128 14_GL000009v2_random:78659-78681 ACAGTGATGTGCAACAGGGTCGG - Intergenic
1125697903 15:41654480-41654502 TCTGTGATGTCCAATAGTTGGGG + Intronic
1138415275 16:56868029-56868051 ACAGTGAGGGCTAACAGTGCTGG + Intronic
1138470279 16:57229350-57229372 ACTTTGATCTCCAAAAGTGCTGG - Intronic
1142547201 17:713344-713366 ATAGTGATTTCTAATACTGCAGG - Intronic
1145945145 17:28768438-28768460 ACAGAGCTGTCCAAGAGTTCTGG + Intronic
1150361100 17:64534844-64534866 AAACTGAAGTCCTATAGTGCTGG + Intronic
1157098585 18:44709681-44709703 ACAGTGATCTGCAGTGGTGCTGG + Intronic
1166112967 19:40634387-40634409 ACAGGGCTGGCCAACAGTGCTGG + Intergenic
1167598255 19:50438614-50438636 ACACTGGTCTCCAAAAGTGCTGG - Intronic
928351451 2:30560119-30560141 ACAGTCATGTCCAATATTGGTGG + Intronic
928413981 2:31076070-31076092 ACAGTGGTTTCCAAGACTGCTGG - Intronic
933896607 2:86816047-86816069 ACAGTGATGCCCAAGAGGGAAGG - Intronic
936455763 2:112672815-112672837 ACATTGATCTCCCAAAGTGCTGG + Intergenic
941486518 2:166088820-166088842 ACAGTGATGTCCAAAGGGGCTGG + Intronic
941510778 2:166406475-166406497 AGAATGATGTTCAATAATGCTGG + Exonic
947080205 2:226387644-226387666 ACAGTGGTGGCAAATAGAGCAGG - Intergenic
1169425356 20:5492666-5492688 TCAGTGATGTCCATTATTGAAGG + Intergenic
1171144371 20:22768764-22768786 ACAGTGATGTCCTTCTGTGCAGG + Intergenic
1183286941 22:36972495-36972517 ACCGTGATCTCCCAAAGTGCTGG - Intergenic
950826799 3:15831586-15831608 ACAGTGATTTTCAATATTGAGGG - Intronic
951443451 3:22748934-22748956 ACAGTGATCACCACTAGGGCAGG + Intergenic
951714794 3:25629079-25629101 AAAGTGATGGCCAATTGTGATGG + Exonic
954699807 3:52445311-52445333 ACAGAGATGTCCACAAATGCAGG + Intergenic
954884114 3:53857055-53857077 ACAGTGTTGTCCAAACGTGCTGG + Intronic
957511115 3:81188731-81188753 AAAATGATGTGCAATAGTGAAGG - Intergenic
957767932 3:84649811-84649833 ATCGTGATGTCCCAAAGTGCTGG - Intergenic
958959434 3:100495054-100495076 AAACTGATGTGCAACAGTGCAGG - Intronic
960399010 3:117172961-117172983 ACAGTCATGTTCTATTGTGCTGG + Intergenic
960604783 3:119494149-119494171 ACAGTGATGTCATATAATACAGG - Exonic
961743524 3:129048001-129048023 CCAGTGATGTCCAGTGGGGCCGG + Intergenic
962357517 3:134707648-134707670 ACGGTGATGTTGAACAGTGCAGG + Intronic
968946240 4:3665922-3665944 AGAGTGATTTCCGATAGGGCAGG + Intergenic
971539996 4:27804054-27804076 ACAGTGATCCCGATTAGTGCTGG - Intergenic
972029431 4:34434718-34434740 ACAAAGAAGTCCAACAGTGCTGG - Intergenic
972721320 4:41701869-41701891 ACAGTGCTATCCAAAATTGCGGG + Intergenic
975613528 4:76223862-76223884 ATAGTGATCTTCAATAGTCCAGG - Intronic
978380005 4:108116990-108117012 ACAGTGATGTCTCACAGTGAGGG - Intronic
981231721 4:142364486-142364508 TCAGTGATTTCCATTTGTGCAGG + Intronic
984107380 4:175565277-175565299 ACAGGAATGTAAAATAGTGCAGG - Intergenic
984565200 4:181321443-181321465 ATAGTGATGTGGAAAAGTGCTGG - Intergenic
985313624 4:188631183-188631205 ACAGTGAGGTCAACTGGTGCGGG - Intergenic
989535334 5:42557143-42557165 ATAGTGAGTTCCAATTGTGCAGG - Intronic
994788196 5:104189639-104189661 ACAATGATATCCAACAGGGCAGG - Intergenic
995741780 5:115363562-115363584 GCATTGATGTCAATTAGTGCAGG + Intergenic
995885352 5:116888291-116888313 CCGGTGATGTCCCATGGTGCAGG - Intergenic
996529556 5:124513416-124513438 ACAGTGATTTCCAAATGTGAAGG - Intergenic
1008897764 6:56576867-56576889 ACATTTATTTCCAATAGTTCTGG - Intronic
1012073747 6:94657441-94657463 AAAATGCTGTCCAATAGTCCAGG + Intergenic
1013948543 6:115751864-115751886 ACCTTGATGTCCCAAAGTGCTGG + Intergenic
1017651315 6:156585609-156585631 AGAGTAATGACCAATAATGCAGG + Intergenic
1020923990 7:14300999-14301021 ACAGTGATGTTTAATAGTGTAGG - Intronic
1023212128 7:37817644-37817666 TCAGTGCTTTCAAATAGTGCTGG + Intronic
1024506371 7:50165606-50165628 ACAGTCATGTCAAATGCTGCTGG + Intergenic
1029003937 7:97187194-97187216 GGACAGATGTCCAATAGTGCCGG - Intergenic
1032654688 7:133915144-133915166 ACAGTGAAGTCAATTAGTGCAGG + Intronic
1033035822 7:137875309-137875331 ACAGTTTTGTCAAAGAGTGCTGG + Exonic
1039381032 8:37085840-37085862 GCAGTGGTGTCCAATACTTCTGG - Intergenic
1040881893 8:52214383-52214405 ACAGTTATGTACTATAGAGCCGG - Intronic
1041886322 8:62813059-62813081 ACAGTGATATCCAATTTTCCTGG + Intronic
1046217498 8:111167864-111167886 ACTCTAATGTGCAATAGTGCAGG - Intergenic
1054916147 9:70496975-70496997 ACAGGGATGGCCCAAAGTGCAGG + Intergenic
1058608496 9:106749685-106749707 ACAGTAAGGTGCAACAGTGCTGG + Intergenic
1062081281 9:134625021-134625043 CCAGTGATGAGCAATGGTGCTGG - Intergenic
1203544577 Un_KI270743v1:119446-119468 ACAGTGATGTGCAACAGGGTCGG + Intergenic
1185839121 X:3372143-3372165 ACATTGATTTCCCATAGTCCTGG - Intergenic
1190517916 X:51243783-51243805 ATACTGAGGTCCAATAGTGTTGG - Intergenic
1193960906 X:87924056-87924078 ACAGTGTTTCCCAATAGTGAGGG - Intergenic
1198614607 X:138442641-138442663 ACTGTGAAGTCCATGAGTGCAGG + Intergenic
1201236673 Y:11918701-11918723 ACATTGATTTCCCATAGTCCTGG + Intergenic