ID: 1073544111

View in Genome Browser
Species Human (GRCh38)
Location 10:104334770-104334792
Sequence CACCCCATGCTGCTCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073544101_1073544111 29 Left 1073544101 10:104334718-104334740 CCGCAGAGGTAGACAAAGCCCTG 0: 1
1: 0
2: 3
3: 23
4: 306
Right 1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG No data
1073544104_1073544111 10 Left 1073544104 10:104334737-104334759 CCTGCACTATTGGACATCACTGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG No data
1073544103_1073544111 11 Left 1073544103 10:104334736-104334758 CCCTGCACTATTGGACATCACTG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073544111 Original CRISPR CACCCCATGCTGCTCCTGCC TGG Intronic
No off target data available for this crispr