ID: 1073547196

View in Genome Browser
Species Human (GRCh38)
Location 10:104360624-104360646
Sequence GAGGGTGAAGAGTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6727
Summary {0: 1, 1: 35, 2: 451, 3: 1712, 4: 4528}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073547196 Original CRISPR GAGGGTGAAGAGTAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr