ID: 1073547628

View in Genome Browser
Species Human (GRCh38)
Location 10:104365127-104365149
Sequence TTGAGCCAGAATTGTAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073547628_1073547642 26 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547642 10:104365176-104365198 GGCCCAACATCTGGGGGTGGTGG No data
1073547628_1073547640 20 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547640 10:104365170-104365192 CCAGGGGGCCCAACATCTGGGGG No data
1073547628_1073547641 23 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547641 10:104365173-104365195 GGGGGCCCAACATCTGGGGGTGG No data
1073547628_1073547632 3 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547632 10:104365153-104365175 GATGATCTCCATGAAGGCCAGGG No data
1073547628_1073547633 4 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547633 10:104365154-104365176 ATGATCTCCATGAAGGCCAGGGG No data
1073547628_1073547631 2 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547631 10:104365152-104365174 AGATGATCTCCATGAAGGCCAGG No data
1073547628_1073547636 17 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547636 10:104365167-104365189 AGGCCAGGGGGCCCAACATCTGG No data
1073547628_1073547630 -3 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547630 10:104365147-104365169 CAAAAAGATGATCTCCATGAAGG No data
1073547628_1073547637 18 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547637 10:104365168-104365190 GGCCAGGGGGCCCAACATCTGGG No data
1073547628_1073547634 5 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547634 10:104365155-104365177 TGATCTCCATGAAGGCCAGGGGG No data
1073547628_1073547638 19 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547638 10:104365169-104365191 GCCAGGGGGCCCAACATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073547628 Original CRISPR TTGAGCCAGAATTGTAAGTA GGG (reversed) Intronic