ID: 1073547634 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:104365155-104365177 |
Sequence | TGATCTCCATGAAGGCCAGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073547628_1073547634 | 5 | Left | 1073547628 | 10:104365127-104365149 | CCCTACTTACAATTCTGGCTCAA | No data | ||
Right | 1073547634 | 10:104365155-104365177 | TGATCTCCATGAAGGCCAGGGGG | No data | ||||
1073547629_1073547634 | 4 | Left | 1073547629 | 10:104365128-104365150 | CCTACTTACAATTCTGGCTCAAA | No data | ||
Right | 1073547634 | 10:104365155-104365177 | TGATCTCCATGAAGGCCAGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073547634 | Original CRISPR | TGATCTCCATGAAGGCCAGG GGG | Intronic | ||