ID: 1073547634

View in Genome Browser
Species Human (GRCh38)
Location 10:104365155-104365177
Sequence TGATCTCCATGAAGGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073547628_1073547634 5 Left 1073547628 10:104365127-104365149 CCCTACTTACAATTCTGGCTCAA No data
Right 1073547634 10:104365155-104365177 TGATCTCCATGAAGGCCAGGGGG No data
1073547629_1073547634 4 Left 1073547629 10:104365128-104365150 CCTACTTACAATTCTGGCTCAAA No data
Right 1073547634 10:104365155-104365177 TGATCTCCATGAAGGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073547634 Original CRISPR TGATCTCCATGAAGGCCAGG GGG Intronic