ID: 1073550255

View in Genome Browser
Species Human (GRCh38)
Location 10:104393542-104393564
Sequence CACTGAAGGCAGCCAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 583}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073550244_1073550255 15 Left 1073550244 10:104393504-104393526 CCAACAGTTCATCAGCCCGCTCA 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 583
1073550247_1073550255 0 Left 1073550247 10:104393519-104393541 CCCGCTCAGGCGGCCTCCAGTCT 0: 1
1: 0
2: 5
3: 11
4: 179
Right 1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 583
1073550248_1073550255 -1 Left 1073550248 10:104393520-104393542 CCGCTCAGGCGGCCTCCAGTCTC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073550255 Original CRISPR CACTGAAGGCAGCCAGGGGC AGG Intronic
900122256 1:1053795-1053817 CACTGAGGCCACGCAGGGGCTGG + Exonic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
900299882 1:1971765-1971787 CACTGGAGTCAGGCAGGAGCAGG - Intronic
900330433 1:2131652-2131674 CCCGGCAGCCAGCCAGGGGCAGG + Intronic
900351869 1:2238851-2238873 CCCAGAAGGCAGCCTGGGGCAGG - Intronic
900588271 1:3444453-3444475 CAGTGAAGGGAGCCACGTGCTGG + Intergenic
900594793 1:3475856-3475878 CACTGTGGGCAGCCAGAGGCTGG + Intronic
900696685 1:4016573-4016595 CATTGGAGGCAGCCGGGTGCCGG + Intergenic
900745655 1:4359095-4359117 CACTGGAGGCTGCAAGAGGCAGG + Intergenic
901171227 1:7259105-7259127 CACAGAAGGAAACAAGGGGCCGG - Intronic
901686366 1:10945821-10945843 CACTGAAGCCTCCCCGGGGCTGG + Intergenic
901689111 1:10961032-10961054 CAGTGAAGGATGCCAGGGACTGG + Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
902276877 1:15346182-15346204 CACAGGAGGCAGCCAGGGCCAGG - Intronic
902410247 1:16207901-16207923 CCCTGAGGGCAGCCAGATGCCGG - Intronic
903007196 1:20306574-20306596 CACTGAAGGACACCAGGTGCTGG - Intronic
903180880 1:21604266-21604288 CAGAGAAGGAAGCCAGGGGAAGG + Intronic
904166759 1:28561586-28561608 CAGGGTAGGAAGCCAGGGGCAGG - Intronic
904265535 1:29316672-29316694 CACTGCTGGCGGCCAGGTGCAGG - Intronic
904385731 1:30140792-30140814 CCCTGCCAGCAGCCAGGGGCCGG + Intergenic
904494630 1:30879665-30879687 CAGTGAAGACAGCCCTGGGCAGG - Intronic
905106078 1:35564399-35564421 CACGGAGGGCTGCCAGGGGCTGG - Intronic
905306287 1:37020850-37020872 CACGGAGAGCAGCCAGGGCCGGG - Intronic
905333855 1:37229711-37229733 CACTGGTGGTTGCCAGGGGCTGG - Intergenic
906531341 1:46525680-46525702 GACTGAGGAAAGCCAGGGGCTGG + Intergenic
906649532 1:47502960-47502982 CTCTGAAGCCAGCGAAGGGCAGG - Intergenic
907617353 1:55938444-55938466 CACTGAAGCCTGACAGGGTCAGG + Intergenic
907755127 1:57303731-57303753 AACTGAAGGCACCCAATGGCAGG + Intronic
907798614 1:57742422-57742444 CACTGACACCAGCCAGGGTCAGG - Intronic
907900164 1:58733852-58733874 CACTGAAGGCAGACCCTGGCAGG - Intergenic
908011837 1:59786222-59786244 CCATGAAAGCAGCCAGGAGCAGG - Intergenic
908534988 1:65068089-65068111 GAGTGAAGGCAGCCAGAGGAGGG - Intergenic
910342344 1:86202478-86202500 CACTGAGGGAAGCCAGGAGAGGG - Intergenic
910660710 1:89669253-89669275 CACTGGTGGTTGCCAGGGGCTGG + Intronic
912655817 1:111485598-111485620 CAATGCAGCCAGCCATGGGCTGG - Intronic
912735304 1:112145038-112145060 GACTGCAGGCTGGCAGGGGCAGG + Intergenic
914797922 1:150937304-150937326 CAGTGGTGGCTGCCAGGGGCTGG + Intronic
914840999 1:151248648-151248670 AACAGGAGGCAGCCATGGGCTGG + Intronic
915338924 1:155165938-155165960 CTCTGCAGGGGGCCAGGGGCAGG - Intergenic
916411455 1:164550954-164550976 CAGTGAAAGCAGCCAGGAGCAGG - Intergenic
916666642 1:166973624-166973646 CACTGAAGTCAGCCAGGCATCGG - Intronic
917351309 1:174080950-174080972 CACAGCAGGCAGGGAGGGGCAGG + Intergenic
919124428 1:193378328-193378350 CAGTGAAAGCATCCAGGGGTGGG + Intergenic
919490272 1:198197926-198197948 CACAGGAGGCATCCAGGGGCAGG + Intronic
920669709 1:207993891-207993913 CACTGAGGTGAGCCTGGGGCTGG + Intergenic
920878960 1:209862797-209862819 CACTGCGGGCAGTGAGGGGCGGG - Intergenic
922064318 1:222122150-222122172 AACTGAAGAAAGGCAGGGGCTGG + Intergenic
922268435 1:224010525-224010547 CAGTGAAGGGAGACAGGGGTGGG - Intergenic
922598334 1:226831016-226831038 GAATGATGGCTGCCAGGGGCTGG + Intergenic
922699613 1:227751113-227751135 CACTAAAGGGGCCCAGGGGCTGG - Intronic
922816716 1:228454301-228454323 GACTGGTGGCTGCCAGGGGCTGG - Intergenic
922825326 1:228513594-228513616 CACGGAGGGCAGCGAAGGGCTGG - Intergenic
922904455 1:229163353-229163375 CACTGCTGGCAGGCAGAGGCAGG + Intergenic
923354984 1:233145646-233145668 TACCGGAGGCTGCCAGGGGCAGG + Intronic
923386794 1:233472911-233472933 CAGTGAAGGGAGACAGGGGTGGG + Intergenic
923443163 1:234040469-234040491 AACTCTAGGCAGACAGGGGCGGG - Intronic
924284378 1:242470811-242470833 CACAGAAAGAAGACAGGGGCAGG - Intronic
924384372 1:243488176-243488198 GACTGAGGGCAGCCAGAGGCCGG + Intronic
1063373367 10:5536604-5536626 AAATGTAGGCAGCCAGAGGCTGG - Intergenic
1063470370 10:6279885-6279907 CACAGCATGCAGCCAGGGTCAGG - Intergenic
1063479808 10:6365459-6365481 CACTGAAGGAAGGCATTGGCTGG - Intergenic
1064081465 10:12311333-12311355 CACTGCAGGCAGCTGGAGGCAGG - Intergenic
1064665293 10:17644435-17644457 TCCTGAATGCAGGCAGGGGCTGG - Intronic
1064668311 10:17680947-17680969 GACTGAAAGCAGGCAGGGTCTGG - Intronic
1064968406 10:21038367-21038389 CACCGAGGCCTGCCAGGGGCTGG - Intronic
1067008913 10:42691450-42691472 CACTGCCTGCAGCCAGGAGCGGG - Intergenic
1067031433 10:42880563-42880585 CAGTGAAGGCGCCCAGGAGCAGG + Intergenic
1067769186 10:49111194-49111216 CAGTTAGGGCACCCAGGGGCTGG + Intronic
1067964149 10:50889843-50889865 TACTGAATGCAGCCATTGGCTGG + Intergenic
1069422002 10:68254971-68254993 CACTCAAGACAGCCGGGAGCTGG - Intergenic
1069570146 10:69489837-69489859 CCCTGACCCCAGCCAGGGGCTGG + Intronic
1069616467 10:69809662-69809684 CAGTCAAACCAGCCAGGGGCTGG + Intronic
1069792229 10:71030072-71030094 CCCTGAAGGCAGGCAGGGCCAGG - Intergenic
1070815692 10:79321685-79321707 CACTCACGGCAGCCAGGGGAGGG - Intergenic
1071468360 10:85961265-85961287 CTGTGAAGGGAGGCAGGGGCAGG - Intronic
1072299384 10:94044559-94044581 CACTGAAGAGAGCCATGGCCAGG - Intronic
1072806033 10:98424526-98424548 CACTGAAGTCTGCAGGGGGCTGG - Intronic
1073498110 10:103912435-103912457 CAGTGCAGGCAGGCAGGGGCAGG - Intronic
1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG + Intronic
1073684087 10:105733660-105733682 CAGTGAAGGGAGCTAGGGGTGGG - Intergenic
1073923010 10:108480870-108480892 CCCTGAAAGCAGCCAGGAGGGGG + Intergenic
1074242188 10:111650398-111650420 CCCTGAAAGCAGCCAGGAGGGGG + Intergenic
1075409856 10:122219306-122219328 CACTGAAGGCGGGCAGAGCCAGG - Intronic
1075646543 10:124100563-124100585 CTCTGAAGGCAGGAGGGGGCCGG + Intergenic
1075756187 10:124813575-124813597 CTCTGGAAGCAGGCAGGGGCTGG - Intronic
1075854674 10:125619262-125619284 CACTGAAGGCAAGCAATGGCGGG + Intronic
1075894663 10:125984465-125984487 CACAGGAGGCACCCAGGGTCTGG + Intronic
1075930262 10:126289289-126289311 CTCAGCAGGCAGCCAGGTGCTGG - Intronic
1075930298 10:126289448-126289470 CACTGAACGTTGCAAGGGGCTGG - Intronic
1075994788 10:126868565-126868587 GAATGATGGCTGCCAGGGGCTGG + Intergenic
1076244510 10:128936023-128936045 CACTGAAGGCAGCCTGGGTCGGG - Intergenic
1076351844 10:129821176-129821198 GAATGAGGGCTGCCAGGGGCTGG - Intergenic
1076408637 10:130230621-130230643 CACTGAAGGGAGGGTGGGGCAGG + Intergenic
1076572244 10:131440583-131440605 CACAGGTGGCAGCCAGGGGCTGG + Intergenic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1077025522 11:438254-438276 AGCTAAGGGCAGCCAGGGGCTGG - Intronic
1077046690 11:549823-549845 CCCTGAAGACAGCCAAAGGCAGG + Intronic
1077484874 11:2834008-2834030 CAAGGAGTGCAGCCAGGGGCTGG + Intronic
1077595393 11:3527387-3527409 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1078011908 11:7578916-7578938 CAGTGATGGCAGACAGAGGCGGG + Intronic
1078334188 11:10450923-10450945 CACTGAGGCCAGCCGGGGCCAGG - Exonic
1078416917 11:11173518-11173540 GAGTGAAGGAAGCCAGGGGCGGG - Intergenic
1078543311 11:12228738-12228760 CAGGGAAGCCAGCCAGGGTCGGG + Intronic
1078959476 11:16248207-16248229 CACTGAAAGCAGCCAGGGGTTGG - Intronic
1079140677 11:17807476-17807498 CAGTGCAGACAGCCAGGGCCTGG - Intronic
1079799000 11:24845136-24845158 CGGTGAAGGCAGCCAGGAGGAGG + Intronic
1080051756 11:27865248-27865270 TAATCAAGGCAGCAAGGGGCAGG + Intergenic
1080088566 11:28316169-28316191 CTGTGAAAGCAGCCAGGAGCAGG + Intronic
1080727951 11:34916386-34916408 CGCTGAGGGCAGCCCGGGGGCGG + Exonic
1081656654 11:44861957-44861979 TACTCAAGGCAGCCAGGCGCTGG - Intronic
1083262593 11:61531294-61531316 CCCTGGGGGCAGCAAGGGGCAGG + Intronic
1084035188 11:66505297-66505319 AAGTGAAGGCAGTAAGGGGCTGG - Intronic
1084085354 11:66852637-66852659 CTCTGAAACCAGCCGGGGGCGGG + Exonic
1084113273 11:67027042-67027064 CACTGCAGCTAGCCAGGGGCAGG + Intronic
1084183666 11:67458951-67458973 CACTGAATGCTGCCAGTGCCAGG - Exonic
1084204566 11:67584188-67584210 CAGGGAAGGGAGGCAGGGGCTGG + Intronic
1084251294 11:67901363-67901385 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1084601448 11:70148132-70148154 AACTGAAGGCAGCGTGTGGCAGG - Intronic
1084821550 11:71694672-71694694 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
1084872954 11:72109986-72110008 CCCTGGATCCAGCCAGGGGCAGG - Exonic
1084913305 11:72408747-72408769 CACTGAGGGGAGGCAGGGGAGGG - Intronic
1084971375 11:72774081-72774103 CAAAGACGGCAGGCAGGGGCAGG + Intronic
1085053901 11:73393168-73393190 CACTGAAGTCTGGCGGGGGCAGG + Intronic
1085978641 11:81694020-81694042 CAGTGAAGGCAGCTGAGGGCGGG - Intergenic
1086086522 11:82960949-82960971 CACTCAAGGCAGGCAAGGGGTGG - Intronic
1086525088 11:87715337-87715359 CACTGAAGGCATCCTGGTGGAGG - Intergenic
1087271964 11:96121063-96121085 ATCTGAAGGCAGCCAGAGTCAGG + Intronic
1088000502 11:104874639-104874661 CTGTGAATGCAGCCAGGGGAAGG + Intergenic
1088175266 11:107046341-107046363 GACTGAAGGTTGCCAGGGGCTGG + Intergenic
1088737008 11:112736109-112736131 CCCTCAAGGCAGGCAGGAGCAGG + Intergenic
1089180452 11:116579912-116579934 CACTGAAGGCTGCCTAAGGCTGG - Intergenic
1089853116 11:121517247-121517269 GACTGACGGCTGCCAGGGGCTGG - Intronic
1090030599 11:123202960-123202982 GACTGATGGCAGCCATGGCCAGG + Intergenic
1090656929 11:128853476-128853498 GACTGGTGGCTGCCAGGGGCTGG + Intronic
1090899924 11:131020133-131020155 GAATGATGGCAACCAGGGGCTGG + Intergenic
1091022395 11:132112577-132112599 CACTGAATGCAGCCAAGAGGCGG + Intronic
1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG + Intergenic
1091368163 11:135038855-135038877 TCCTGAAGGCAGGCAGGGCCAGG + Intergenic
1091769668 12:3142677-3142699 CACCGCAGGCACCCGGGGGCAGG - Intronic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092421552 12:8336161-8336183 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1093123346 12:15299671-15299693 CAGTGAAAGCAGCCAGGAGTGGG - Intronic
1093755861 12:22851085-22851107 AACTCTAGGCAGACAGGGGCAGG - Intergenic
1094127143 12:27034995-27035017 CACTTAGGGAGGCCAGGGGCAGG - Intronic
1094526087 12:31232159-31232181 CACTGAAGGCAGCAGGAAGCTGG + Intergenic
1094631566 12:32180500-32180522 CAATGAAGACAGCCAAGGGACGG - Intronic
1095629293 12:44355795-44355817 CAGTGATGGCAGCAAGAGGCTGG + Intronic
1095836750 12:46647884-46647906 CTGTGAAAGCAGCCAGGGGTGGG - Intergenic
1097580738 12:61453784-61453806 CTGTGAAAGCAGCCAGGAGCAGG + Intergenic
1097599176 12:61670615-61670637 CCATGAAAGCAGCCAGGGGGAGG - Intergenic
1098726360 12:73972784-73972806 CACTGAAGCCAGTCAGGGGGTGG + Intergenic
1099215009 12:79842966-79842988 GAATGATGGCTGCCAGGGGCTGG - Intronic
1099845046 12:88018639-88018661 CAGTGAAAGCAGCCAGGAGCAGG + Intronic
1100053905 12:90485751-90485773 CATAGAAGGCAGCAAGGGACAGG + Intergenic
1101560777 12:105855685-105855707 CGATGAGGGCAGCCAGGAGCAGG + Intergenic
1102035551 12:109768820-109768842 CACTGTAGGCACGCAGTGGCTGG - Exonic
1102216062 12:111162221-111162243 CAGTGGAGGAAGGCAGGGGCTGG - Intronic
1103036121 12:117658156-117658178 CACAGGAGCCAGCCAGGGTCTGG + Intronic
1103465651 12:121140030-121140052 TTCTGAAGACAGTCAGGGGCAGG - Intronic
1104307495 12:127622625-127622647 AACTGATGGGAGCCAGGAGCTGG + Intergenic
1104402795 12:128490487-128490509 CACTGAATTCAGTGAGGGGCAGG + Intronic
1104642927 12:130478944-130478966 CACTGAGAACAGCCAGGGCCTGG + Exonic
1104734507 12:131128725-131128747 CACTGAAGGCCGCCATGGGGTGG - Intronic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1104958404 12:132476920-132476942 CACTGAGGGCAGCTCAGGGCTGG - Intergenic
1105702464 13:22943722-22943744 CACTGGAGTCATCCAGGGGATGG - Intergenic
1105811804 13:24001980-24002002 CATTGAAGTCACCCAGGGGGCGG + Intronic
1105855096 13:24365503-24365525 CACTGGAGCCATCCAGGGGACGG - Intergenic
1106200247 13:27530285-27530307 GAATGGTGGCAGCCAGGGGCTGG - Intergenic
1106658532 13:31773900-31773922 CTCTGAAGGCTCTCAGGGGCAGG - Intronic
1107560304 13:41551938-41551960 CCCTGCAGGCTCCCAGGGGCAGG + Intergenic
1110219672 13:73059554-73059576 CTCTGGAGGCAGCCGCGGGCCGG - Exonic
1110809108 13:79791843-79791865 CACTGAAGCCAGCCTGGCCCTGG + Intergenic
1110938261 13:81318964-81318986 AACTCTAGGCAGACAGGGGCAGG + Intergenic
1110970745 13:81758195-81758217 CAGTGAAAGCAGCCAGGAGGGGG - Intergenic
1111102964 13:83611486-83611508 CCATGAAAGCAGCCAGGGGGAGG - Intergenic
1111521137 13:89406175-89406197 CAGTGAAGGGAGACAGGGGTGGG + Intergenic
1111572401 13:90104959-90104981 CAGTGATGGCAGCCATGGGTGGG + Intergenic
1111726303 13:92013647-92013669 AATTTAAGGCAGACAGGGGCAGG - Intronic
1112250271 13:97772783-97772805 CACTGATGGCAGCATGGGTCAGG + Intergenic
1112253716 13:97808228-97808250 CACTCATGGCAGCCGGGGACAGG - Intergenic
1112575022 13:100627763-100627785 CACAGCAGGAAGCCAGGGGTGGG + Intronic
1113110300 13:106815647-106815669 CCATGTAGGCAGCCAGTGGCTGG - Intergenic
1113269336 13:108655660-108655682 CCATGAAAGCAGCCAGGAGCCGG + Intronic
1113408247 13:110061810-110061832 CACAGAATGCAGCCTGGTGCAGG - Intergenic
1113452806 13:110423733-110423755 GAATGAGGGCTGCCAGGGGCCGG - Intronic
1113539396 13:111094864-111094886 CACGGAAGCCAGGCAAGGGCTGG - Intergenic
1114516108 14:23301383-23301405 CACCAAAGGCACCCGGGGGCGGG - Exonic
1114665047 14:24372709-24372731 CCCTGCAGGCAGCCTGGGGGAGG + Intronic
1115515704 14:34182868-34182890 CTCTGAAGGCTGGAAGGGGCTGG - Intronic
1115643661 14:35352020-35352042 GACTGAAGGCAGCAAGGTCCTGG + Intergenic
1117465945 14:55994199-55994221 CACTGAGGCCAGTCAGGGGCTGG - Intergenic
1117956645 14:61128403-61128425 CACTGGGCGTAGCCAGGGGCTGG - Intergenic
1118753895 14:68824442-68824464 GACTGGAGTAAGCCAGGGGCAGG + Intergenic
1118835915 14:69477816-69477838 CAGTGAAGGCAGCCAGGAGGGGG - Intergenic
1119903417 14:78281189-78281211 CACTGACCTCAGCCAGGGCCGGG - Intronic
1120809212 14:88785812-88785834 GACTGAAGAGAGGCAGGGGCAGG - Intronic
1121128884 14:91427539-91427561 CAATGAAAGCAGCCAGGAGTGGG + Intergenic
1121303514 14:92890350-92890372 CATCGCAGGCAGCCAGGGCCAGG - Intergenic
1121315650 14:92959559-92959581 CTCTGGAGTCAGGCAGGGGCTGG + Intronic
1122169830 14:99863284-99863306 CACTGAAGGTAGTGGGGGGCAGG - Intronic
1122362896 14:101177884-101177906 CACTGAGGCCAGAGAGGGGCAGG + Intergenic
1122890500 14:104729996-104730018 CCTTGGAGGCAGCCAGGGGAGGG - Exonic
1123479687 15:20619727-20619749 CACAGAATCCAGCCATGGGCAGG - Intergenic
1123638319 15:22380637-22380659 CACAGAATCCAGCCATGGGCAGG + Intergenic
1124595100 15:31085814-31085836 CACAGACAGCAGCCAGGGTCAGG + Intronic
1124600518 15:31129465-31129487 CACTGGAGGCGGCCAGGTGGGGG - Intronic
1124675244 15:31678942-31678964 CTGTGAAAGCAGCCAGGAGCGGG + Intronic
1124913194 15:33943428-33943450 CAATGAAGGCTGTCAGGGGCTGG + Intronic
1126739082 15:51759880-51759902 GCCTGAGGCCAGCCAGGGGCAGG + Intronic
1127358853 15:58227062-58227084 AATGGAATGCAGCCAGGGGCTGG + Intronic
1128452481 15:67813750-67813772 GGCTGGAGGCAGGCAGGGGCAGG - Intergenic
1128664807 15:69530338-69530360 CCCTGAAGGAAGCCAGTGGAAGG + Intergenic
1128927735 15:71674167-71674189 CACTGGATGCAGCCTAGGGCTGG - Intronic
1128943064 15:71804379-71804401 CACTGGGGGCAGGCTGGGGCAGG - Intronic
1129167124 15:73784992-73785014 CACAGAAGGAAGCCAGTGGAAGG + Intergenic
1129667585 15:77588192-77588214 CCCTGAGGGAGGCCAGGGGCTGG - Intergenic
1129672114 15:77613241-77613263 CAGTGGAGAGAGCCAGGGGCTGG - Exonic
1130275852 15:82476051-82476073 CACTGAAGGGACCCTGGGGAAGG - Intergenic
1130317091 15:82805724-82805746 TGATGAAGGCAGACAGGGGCTGG - Intronic
1130468211 15:84203443-84203465 CACTGAAGGGACCCTGGGGAAGG - Intergenic
1130496053 15:84470099-84470121 CACTGAAGGGACCCTGGGGAAGG + Intergenic
1130590504 15:85208041-85208063 CACTGAAGGGACCCTGGGGAAGG - Intergenic
1130685356 15:86032353-86032375 CACCACACGCAGCCAGGGGCAGG - Intergenic
1131252886 15:90842152-90842174 CACTGAGGGAGCCCAGGGGCTGG - Intergenic
1131463774 15:92638445-92638467 CTCTGTAGGCTGCCAGGGCCTGG - Intronic
1131528118 15:93168280-93168302 AACAGATGGCTGCCAGGGGCTGG - Intergenic
1131577133 15:93603408-93603430 CAGTTAAGGCAGACAGTGGCGGG - Intergenic
1132306683 15:100819984-100820006 AAGTGGAGGCAGCCAGGGACAGG + Intergenic
1133056301 16:3147189-3147211 CACAGAGGGCAGCCAGTGGCTGG + Intronic
1133094723 16:3435369-3435391 CACTGCAGGCAGCCAGGGAAAGG - Exonic
1133754342 16:8751374-8751396 CACTGAACCCAGCCAGAGGTAGG + Intronic
1133977443 16:10609406-10609428 CACAGAAGGCAGGCAGGGTCCGG + Intergenic
1134114695 16:11539152-11539174 CACTGTCTGCTGCCAGGGGCGGG - Intergenic
1134218177 16:12332675-12332697 CCCTGGTGGCGGCCAGGGGCTGG - Intronic
1134658126 16:15963278-15963300 CTGTGAAAGCAGCCAGGAGCGGG - Intronic
1135265797 16:21024484-21024506 CCCTGGAGGCAACAAGGGGCAGG - Intronic
1135741588 16:24980059-24980081 CAGTGAAGGGAGTCAGGGGAAGG + Intronic
1135811579 16:25591800-25591822 CTCTGAATGAAGCCAGGGGCTGG + Intergenic
1137403857 16:48175181-48175203 CACTATAGGCAGCCCGGTGCTGG + Intronic
1137951983 16:52792221-52792243 CATGGAAGGCAGCCAGGAGTGGG + Intergenic
1138456225 16:57122275-57122297 TAAGGAAGGCAGCCTGGGGCAGG + Intronic
1139378559 16:66515962-66515984 CACTGGAGGGAGACAGAGGCTGG - Intronic
1139435128 16:66932502-66932524 CGCAGGAGGCAGCCAGGGGGAGG - Intronic
1139449103 16:67016138-67016160 CTCAGAAGGTAGCCATGGGCAGG + Intergenic
1139531161 16:67543295-67543317 CAGGGAGGGCAGCCAGGGGGCGG + Intronic
1140517740 16:75556328-75556350 CACCGAAAGGAGCCAGTGGCGGG + Intergenic
1141572584 16:84942896-84942918 GACTGGAGGCTGCCAGGAGCTGG - Intergenic
1141605213 16:85149170-85149192 CAATGAAGGAAGCCAGGCACGGG + Intergenic
1141668608 16:85479708-85479730 CACTGAGCGCAGCGAGGGGCTGG + Intergenic
1141698496 16:85631905-85631927 CACTGATGGCAGCCCGGTGCGGG + Intronic
1142424577 16:89994509-89994531 CACTGTGGGGAGCCAGGGGACGG - Intergenic
1143369567 17:6430104-6430126 CAATCACGGCAGCCATGGGCTGG + Intronic
1143647604 17:8241322-8241344 CACAAAAAGCAGGCAGGGGCTGG + Intronic
1144495205 17:15741463-15741485 GACAGAGGGCAGCCAGGGGGAGG - Intronic
1144705240 17:17363680-17363702 CTGTGCAAGCAGCCAGGGGCGGG + Intergenic
1146160898 17:30559136-30559158 CACAGAGGGCAGCCACGGGGAGG - Exonic
1146460482 17:33042254-33042276 TACTGAAGCCAGGCAGAGGCAGG - Intronic
1147304145 17:39551767-39551789 CACTGAAGGAAGCAAGGGGTTGG - Intronic
1147644276 17:42024482-42024504 CACTGAGCCCAGCCAGGGGTGGG - Exonic
1148053484 17:44780345-44780367 CACTGAGCACAGTCAGGGGCTGG + Exonic
1148151935 17:45402218-45402240 CACAGTAAGCAGCCAGGGACAGG + Intronic
1148586649 17:48785991-48786013 CCCTGAAGGCACACAGGAGCCGG - Intronic
1149112322 17:53048494-53048516 CTGTGAAGGCAGCCAGTAGCGGG - Intergenic
1149434601 17:56622441-56622463 CACCGAATGCACCAAGGGGCAGG + Intergenic
1149744789 17:59086006-59086028 CAATGGTGGCTGCCAGGGGCTGG + Intronic
1151553662 17:74835988-74836010 CCGAGAAGTCAGCCAGGGGCGGG - Exonic
1151668322 17:75558094-75558116 CACTCAAGGCAGGCAGGGGATGG + Intronic
1151906750 17:77053969-77053991 CACTCCAGGCAGCCAGCTGCTGG - Intergenic
1151907130 17:77056088-77056110 CCCTGAAGGCAGCCAGCGAGGGG - Intergenic
1152199952 17:78939528-78939550 AACAGAAGGCAGTCAGGGGCTGG + Intergenic
1152336401 17:79701833-79701855 CACTGGAGGCCACCAGGTGCAGG + Intergenic
1152449450 17:80367727-80367749 CACTGAAGAAAGGCAGGGACAGG - Exonic
1153468985 18:5421810-5421832 CTCAGAAGGCAGACAGTGGCGGG + Intronic
1154300255 18:13185859-13185881 CACTGAGGGCTGCCAAGGTCAGG + Intergenic
1155170062 18:23260540-23260562 CACGGGAGGCAGCCAGGGCTGGG - Intronic
1156135571 18:34032815-34032837 CAGTGATGGCAGCAATGGGCTGG - Intronic
1156255395 18:35391043-35391065 GAATGGAGGCTGCCAGGGGCTGG + Intergenic
1156285892 18:35695533-35695555 CACTGAAGGAAGCCAGATGGTGG + Intronic
1157285472 18:46374430-46374452 GAATAAAGGCTGCCAGGGGCTGG - Intronic
1159357822 18:67359142-67359164 CCTTGAAAGCAGCCAGGGGCGGG + Intergenic
1159398712 18:67901228-67901250 GAATGATGGCTGCCAGGGGCTGG + Intergenic
1160397008 18:78580043-78580065 CAATGCAGGCAGCCAGGAGGAGG - Intergenic
1161866661 19:6837334-6837356 CTCAGAAGGAAGCAAGGGGCAGG - Intronic
1162423791 19:10581715-10581737 CCCTGGAGGCAGCCATGGGCTGG - Intronic
1162569847 19:11465593-11465615 CCCTGGAGGAAGCCAGGGTCGGG - Intronic
1162910701 19:13846717-13846739 CACTGCCGCCAGCCGGGGGCTGG - Intergenic
1163007194 19:14404460-14404482 CACCGAGGGCTGCCAGGTGCTGG + Exonic
1163008495 19:14410689-14410711 CACTGAGGGCAGGCGGGGCCTGG + Intronic
1163103020 19:15109003-15109025 CTCTGCAGGCAGTGAGGGGCTGG + Intronic
1163131238 19:15274543-15274565 AAGTGATGGCAGGCAGGGGCAGG + Intronic
1163510546 19:17732719-17732741 CCCTGAAAGCAGCCAGTGCCTGG - Intronic
1163602982 19:18259811-18259833 CACTGAAGCCAGAGAGGGGCTGG + Intronic
1163638179 19:18447184-18447206 CAGTGGAGGCAGCAAGGGCCTGG - Intronic
1163686177 19:18713019-18713041 GACTGCTGGCTGCCAGGGGCTGG - Intronic
1164408635 19:27977413-27977435 CTCTGAACCCATCCAGGGGCCGG + Intergenic
1164466160 19:28489309-28489331 GACAGAAGGCAGCCAGCGGAGGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165766160 19:38352488-38352510 CACTGAAGGTGGCTGGGGGCTGG + Intronic
1166164898 19:40980550-40980572 CCGTGAGGGCAGCCAGGAGCGGG - Intergenic
1166402297 19:42492385-42492407 CAGTTAAGACAGCCAGGGCCAGG + Intergenic
1166811390 19:45516490-45516512 AACTGAGGTCAGGCAGGGGCTGG + Intronic
1166894833 19:46016766-46016788 CAGTCAAGGCAGCAGGGGGCTGG - Exonic
1166982353 19:46638843-46638865 CACGGCAGGGAGCCAGGGACCGG + Intergenic
1167037378 19:47002278-47002300 CACTGCAGGCGGGCACGGGCAGG - Exonic
1167090578 19:47341165-47341187 CACTGAGAGCTGCCAGGAGCAGG - Exonic
1167477958 19:49711861-49711883 TGCTGAAGGCAGCCATGAGCGGG + Exonic
1167490099 19:49787798-49787820 GATTGGTGGCAGCCAGGGGCTGG - Intronic
1167921556 19:52786788-52786810 GACTGAAGCCAGGCCGGGGCAGG + Intronic
1168350598 19:55673837-55673859 CACTGAAGGCAGGAAGGGACAGG - Intronic
1168358689 19:55719452-55719474 ATCTGAAGGTGGCCAGGGGCCGG - Intronic
1168518891 19:57032806-57032828 GAATGGAGGCTGCCAGGGGCTGG - Intergenic
925703188 2:6659356-6659378 GAGTGAAGGGAGCCTGGGGCAGG + Intergenic
926094111 2:10070003-10070025 CACTGAAGCCAGACAGAGGCTGG + Intronic
926140791 2:10366723-10366745 CAATGCAGGAAGCCCGGGGCTGG - Intronic
926286463 2:11492744-11492766 CACTGAAGGCCTCCTGGGGAGGG + Intergenic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927520965 2:23697787-23697809 CACTGAAGGCTGCCAGCACCGGG - Intronic
928288094 2:30010746-30010768 CACTGCATGCAGCCTGAGGCAGG - Intergenic
928453184 2:31397243-31397265 CACAGAAAGCAGCCAGGAGAGGG + Intronic
928605839 2:32944765-32944787 CACTGAAGACAGGTAGAGGCTGG + Intergenic
929118588 2:38465431-38465453 CCCTGCAGGCCACCAGGGGCAGG - Intergenic
929689129 2:44060026-44060048 CTGTGAAAGCAGCCAGGAGCGGG - Intergenic
932569638 2:72931784-72931806 CAGAGCAGCCAGCCAGGGGCTGG - Intronic
932620851 2:73264252-73264274 CACAGAAGGCAGGCAGGGGCAGG + Intronic
932912226 2:75818072-75818094 CTGTGAAAGCAGCCAGGAGCGGG - Intergenic
933798654 2:85942271-85942293 CTCTGAAAGCAGCCAGGAGAAGG - Intergenic
933895618 2:86807855-86807877 GGCTGAAGGCAGGCAGGAGCAGG + Intronic
934017130 2:87899682-87899704 CAATGAAAGCAGCCAGGAGGGGG + Intergenic
934696570 2:96404670-96404692 CACTGAGGGCAGCTTGGTGCTGG - Intergenic
934952131 2:98583920-98583942 CACTGCAGGCTCCCTGGGGCAGG + Intronic
935518798 2:104078477-104078499 CACTGAGGGCAGCTCGGTGCTGG - Intergenic
936241291 2:110790661-110790683 CCCTGAGGTCTGCCAGGGGCAGG + Intronic
936788606 2:116124336-116124358 CTGTGAAAGCAGCCAGGAGCAGG + Intergenic
937887344 2:126908968-126908990 CGCTGTGGGCAGGCAGGGGCAGG + Intergenic
937924066 2:127154178-127154200 CTCTTCAGGCAGCCAGGGTCAGG + Intergenic
938091492 2:128437489-128437511 CTGGAAAGGCAGCCAGGGGCTGG + Intergenic
938508613 2:131914566-131914588 CACTTTAGGAAGCCAAGGGCAGG - Intergenic
940494358 2:154406448-154406470 CACTGCAGTGAGCAAGGGGCAGG - Intronic
942013427 2:171787774-171787796 GACTGCAGGTAGGCAGGGGCTGG - Exonic
942644450 2:178095473-178095495 CTGTGAAAGCAGCCAGGAGCAGG - Intronic
944242407 2:197499487-197499509 CCCTGAAGTCGGCCAGGCGCAGG + Intronic
945241013 2:207676909-207676931 CCCTGAAGGTAGGCAGGGGCTGG + Intergenic
946108203 2:217390697-217390719 CTGTGAAAGCAGCCAGGAGCAGG - Intronic
946226007 2:218264461-218264483 CTCTGCTGGCAGACAGGGGCAGG + Exonic
946386397 2:219386936-219386958 CACTGAAGCCAGCCTGGAGAAGG + Exonic
946390820 2:219416112-219416134 CACTGCAGGAACCAAGGGGCTGG + Intergenic
946731024 2:222709582-222709604 CACTGCAGGCAGCCAGTGAAAGG + Intronic
947569926 2:231225602-231225624 AACTGAAAGAAGCCAGTGGCAGG + Intronic
947904566 2:233751072-233751094 CTCTGAAGGCAGCCAGGAGGAGG + Intronic
948023995 2:234762102-234762124 CACTGACAGCACCCAGGAGCTGG - Intergenic
948155774 2:235779659-235779681 ACCTGAAGGAAACCAGGGGCAGG - Intronic
948276873 2:236715670-236715692 CACTGAGGGCAACCCGAGGCAGG + Intergenic
948536341 2:238650352-238650374 AAGTCAAGGCACCCAGGGGCTGG + Intergenic
948605490 2:239132063-239132085 CACTGAGGACGGACAGGGGCTGG + Intronic
948814434 2:240502637-240502659 CACTCTGGGCAGCCAGGGCCAGG - Intronic
949020036 2:241735618-241735640 CTCTCAGCGCAGCCAGGGGCTGG - Intronic
1168782612 20:506522-506544 CATTGGAAGCAGGCAGGGGCAGG - Intronic
1169130927 20:3166093-3166115 CACTGAGGGGTGCCAGGTGCTGG + Exonic
1169541137 20:6600787-6600809 CACTCACTGCAGCCAGGGGATGG + Intergenic
1169940602 20:10933295-10933317 CACTGGGGCCTGCCAGGGGCGGG + Intergenic
1170324984 20:15147796-15147818 CAGTGAAGGGAGCTAGGGGTGGG + Intronic
1170325813 20:15153253-15153275 CAGTGAAGGGAGCTAGGGGTGGG + Intronic
1170567518 20:17615416-17615438 AGCTGAAGGCAGGCAGGGGCTGG - Exonic
1170609243 20:17898737-17898759 CACTGGAACCAGCCAGGGACTGG + Intergenic
1171248753 20:23633461-23633483 CAGGGAGAGCAGCCAGGGGCTGG - Intronic
1173077069 20:39829344-39829366 CTCTGAAGGGGTCCAGGGGCTGG - Intergenic
1174402613 20:50283998-50284020 CCCTGCAGGGAGCCAGGGGCCGG - Intergenic
1174451744 20:50624850-50624872 CTCTGGAGGCAGACAGGGCCGGG + Intronic
1175046977 20:56116214-56116236 CAATGAAGGGAGGCAGGGGAGGG + Intergenic
1175303078 20:57956790-57956812 CAGTGAGGGCAGAAAGGGGCTGG - Intergenic
1175364716 20:58444682-58444704 CACGGAAAGCAGCCTGGGCCGGG - Exonic
1175572504 20:60034638-60034660 ACCTGAAGGCAGCTGGGGGCTGG - Intergenic
1175764588 20:61583486-61583508 CATGGAAGGCATCCAGGGGCAGG + Intronic
1176063279 20:63181516-63181538 GCCAGGAGGCAGCCAGGGGCAGG - Intergenic
1176205875 20:63887864-63887886 CACTGCAGGCAGCCAGGGTCAGG - Intronic
1176784878 21:13243968-13243990 CACTTTAGGAAGCCAAGGGCAGG + Intergenic
1176917641 21:14645070-14645092 CACTGAAGGCCCCCAGGCCCTGG - Intronic
1177030657 21:15979711-15979733 CAGTGAAGGGAGACAGGGGTGGG + Intergenic
1177197565 21:17919077-17919099 CCATGAAGGCAGCCAGGAGCGGG - Intronic
1177259637 21:18712973-18712995 CTATGAAAGCAGCCAGGAGCTGG + Intergenic
1179366113 21:40759751-40759773 CAATGACTGCTGCCAGGGGCAGG - Intronic
1179422054 21:41244366-41244388 CAGTGAAGGGAGACAGGGGTGGG + Intronic
1179553798 21:42159962-42159984 CTCCAAAGGCAGGCAGGGGCAGG + Intergenic
1179558383 21:42195069-42195091 CACAGGAGCCAGCCAAGGGCAGG + Intergenic
1179576855 21:42313309-42313331 CACTTAGGGCAGCCATGGCCAGG - Intronic
1179642910 21:42758926-42758948 GAGGGAAGGAAGCCAGGGGCTGG + Intronic
1180045277 21:45302336-45302358 CACAGAAGCCAGGAAGGGGCGGG + Intergenic
1180055911 21:45359136-45359158 CACTGGAAGCAGCTAGGGGCAGG + Intergenic
1180733655 22:18000680-18000702 CTCGGAAGGCAGCCAGGGAAGGG + Intronic
1180742777 22:18065300-18065322 CCAGGAAGGCAGGCAGGGGCTGG + Intergenic
1180972875 22:19824738-19824760 CACTCAAGGGAGGCAGGGGCAGG + Intronic
1181010417 22:20037077-20037099 CACAGAAGGCAGCCACAGGTAGG + Exonic
1181029350 22:20142470-20142492 CACTCAGGGCAGCCAGAGGGAGG - Intronic
1181030531 22:20147183-20147205 GACTGGAGGCAGCCAAGTGCAGG - Exonic
1181286410 22:21755435-21755457 CAGTGAAGGCCGCCTGTGGCCGG - Exonic
1181512775 22:23396188-23396210 GACTGGAGGCAGCCAAGGGCAGG + Intergenic
1181560021 22:23694555-23694577 CACTGGAGGCAGGGATGGGCCGG + Intronic
1181594151 22:23903468-23903490 CTGCGAAGGCAGCAAGGGGCCGG + Intergenic
1184015484 22:41782855-41782877 CACTGGAGGTAGCTAGGAGCAGG - Intronic
1184898801 22:47430820-47430842 CACTGGAGGAAGTCGGGGGCAGG + Intergenic
1185251723 22:49805520-49805542 AACGGAAGGAAGCCAGAGGCTGG + Intronic
950161067 3:10761656-10761678 CACTGAGGGCAGCCTCGGGGGGG - Intergenic
950254540 3:11493548-11493570 AACTCTAGGCAGACAGGGGCAGG - Intronic
950463736 3:13140964-13140986 GCCTGAAGGCAACAAGGGGCAGG + Intergenic
950524203 3:13514047-13514069 CTCTGGAGGCAGCCATGGGTGGG - Intergenic
951289927 3:20863079-20863101 CAGTGAAAGCAGCCAGGAGGGGG - Intergenic
952416159 3:33093067-33093089 CTCTCTTGGCAGCCAGGGGCTGG + Exonic
953102442 3:39842759-39842781 CACTGAGGGCAGACAGAAGCAGG - Intronic
953278129 3:41524609-41524631 GCCTGAAGTCAGCCAGAGGCAGG + Intronic
953407272 3:42665657-42665679 CGCTGGAGCCAGCCAGGGACAGG - Exonic
953607431 3:44420882-44420904 CACTCAGGGCAGGGAGGGGCTGG - Intergenic
953678434 3:45021353-45021375 CACCGAATGCAGCCAGGGCAGGG - Intronic
953819735 3:46195476-46195498 CATTAAAGGCAGCCAGAGGGGGG + Intronic
953884503 3:46707735-46707757 CACTGACGGCAGCCAGAGCCGGG - Intronic
954691478 3:52397850-52397872 TTCTGCAGGCAGCCAGGGCCGGG + Exonic
954799915 3:53181150-53181172 CAGTGAGGGCAGCCTGGGCCAGG - Intronic
956160795 3:66350220-66350242 CACTGCAGGGAGTAAGGGGCTGG + Intronic
956246226 3:67186390-67186412 CCATGAAAGCAGCCAGGAGCAGG - Intergenic
956964521 3:74443458-74443480 CACTGAAGGAGGGGAGGGGCAGG - Intronic
957630466 3:82710949-82710971 CCATGAAAGCAGCCAGGGGGAGG - Intergenic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
958019699 3:87980696-87980718 GACTGAGGGCAGCTAGGTGCAGG - Intergenic
958878773 3:99645532-99645554 CAGTAGAGGGAGCCAGGGGCTGG + Intronic
958917352 3:100064456-100064478 CACTTAATGCAGTAAGGGGCTGG - Intronic
959117006 3:102190480-102190502 TCCTGCAGGCACCCAGGGGCTGG - Intronic
959785639 3:110294610-110294632 CAGTGAAAGCAGCCATGGGCAGG - Intergenic
959973468 3:112432306-112432328 CTGTGAAGGCAGCCAGAGGGAGG + Intergenic
960949083 3:122987332-122987354 CACAGAATCCAGCCAGTGGCGGG + Intronic
961287772 3:125820309-125820331 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
961459700 3:127042639-127042661 CACTCCAGGCAGCCAGTGGAGGG - Intergenic
961637499 3:128342525-128342547 CACCCTAGGTAGCCAGGGGCTGG - Intronic
961679216 3:128587666-128587688 CACTGAAAGAAACCAGGGGTTGG - Intergenic
961826160 3:129600212-129600234 GCCTGAAGGCAGGCAGGGGTGGG - Intronic
961899298 3:130195684-130195706 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
962301931 3:134250772-134250794 CACTGCTGGCTGCCACGGGCCGG - Intergenic
964588617 3:158336249-158336271 AAAGAAAGGCAGCCAGGGGCCGG - Intronic
964926457 3:161963933-161963955 CAATGAAAGCAGCCAGGAGCGGG + Intergenic
965264986 3:166531694-166531716 CTGTGAAGGCAGCCAGGAGGGGG - Intergenic
965441403 3:168719651-168719673 CACTGAAGGCAGCAAGCTACAGG + Intergenic
966074356 3:175919100-175919122 CCATGAAGGCAGCCAGGAGATGG - Intergenic
966815677 3:183887891-183887913 CCCTGAAGGCTGCCTGGGTCTGG - Intergenic
967244495 3:187471693-187471715 CAGTGAAGGGAGACAGGGGTGGG + Intergenic
967453400 3:189652202-189652224 CCATGAAGGCAGCCAGGAGGGGG + Intronic
967670298 3:192225925-192225947 AACTGATGGCTGCCAGGGGCTGG + Intronic
967913425 3:194560295-194560317 CCCGGAAGTCAGCCAGGGTCAGG + Intergenic
967922814 3:194625357-194625379 CACTGTGGGCAGCCAGAGGGAGG - Intronic
968079309 3:195835468-195835490 CCCTGACGGCATCCAGGGACAGG + Intergenic
968454146 4:688736-688758 CACTGAAGGCTGGGAAGGGCTGG + Intronic
968538287 4:1148891-1148913 TGCTGAATGCAGTCAGGGGCAGG + Intergenic
969010137 4:4055201-4055223 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
969264346 4:6055219-6055241 GACTGGAGGCTGCCAGGGGCCGG + Intronic
969327629 4:6452958-6452980 CACTGCAGGCAGCCTGTGGTTGG + Intronic
969716472 4:8870567-8870589 CGCTGCAGACAGCCTGGGGCAGG - Intronic
969744090 4:9056042-9056064 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
969803496 4:9588164-9588186 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
971499196 4:27300381-27300403 CCATGAAGGCAGGCAGGAGCAGG - Intergenic
971713639 4:30148898-30148920 CAGTGAAGGGAGACAGGGGTGGG + Intergenic
974569685 4:63628433-63628455 CTGTGAAAGCAGCCAGGTGCAGG + Intergenic
974574603 4:63701715-63701737 AACTGTAGGCAGACAGGGGTGGG - Intergenic
974754630 4:66187266-66187288 CACTGGTGGCAGCCTGGGACTGG + Intergenic
974772426 4:66433753-66433775 CAGTGAAAGCAGCCAGGAGGGGG - Intergenic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
975616577 4:76252797-76252819 CACTGTAAGCAGCTAGGGGAAGG - Intronic
976042675 4:80906331-80906353 CCATGAAAGCAGCCAGGAGCGGG - Intronic
976658038 4:87510290-87510312 AACTGTAGGCATACAGGGGCGGG + Intronic
976678175 4:87725945-87725967 CCGTGAAAGCAGCCAGGGGGAGG + Intergenic
977657173 4:99536007-99536029 AACTCAAGGCAACCAGGGTCTGG - Intronic
978904107 4:113985759-113985781 CTCTGAAAGCAGCCAGGAGTGGG + Intergenic
980223381 4:129948287-129948309 CACGGAGGGCAAGCAGGGGCAGG - Intergenic
981562466 4:146062844-146062866 CAATGAATGCTGCCAGGGGAGGG + Intergenic
982000401 4:151016202-151016224 AGCTGAAAGCAGCCAGGGGTGGG - Intergenic
982106813 4:152018385-152018407 GCCTGAAGGCACCCAGGAGCAGG - Intergenic
982398279 4:154937144-154937166 CACTGAGGGCAGGCTGGTGCTGG + Intergenic
982430381 4:155315520-155315542 CCATGAAAGCAGCCAGGAGCGGG + Intergenic
984818017 4:183856586-183856608 AGCTGCAGTCAGCCAGGGGCAGG - Intronic
985318567 4:188683933-188683955 CACTGCAGTCAGCCCAGGGCAGG + Intergenic
985805263 5:2038855-2038877 CACTCCTGGCAGACAGGGGCCGG + Intergenic
985963267 5:3319856-3319878 CACTGTGGGCCTCCAGGGGCTGG + Intergenic
987071735 5:14343379-14343401 CACTGAAGGAAGCCAGTGCAGGG - Intronic
987133811 5:14882690-14882712 GACAGCAGGCAGGCAGGGGCAGG + Intergenic
987179154 5:15348252-15348274 CACTGAAGGCGGGCAGAGGTGGG - Intergenic
987257451 5:16170862-16170884 CACTGCAGACAGCCTGGGGTGGG + Intronic
987455344 5:18138247-18138269 CTGTGAAGGCAGCCAGGAGGGGG - Intergenic
988603635 5:32662027-32662049 AACTCTAGGCAGACAGGGGCAGG - Intergenic
988993071 5:36690225-36690247 GACTGACGGCAGCCTGGGGTCGG - Intergenic
989425325 5:41290185-41290207 CACTGCACACAGCCAGGTGCTGG + Intergenic
990021177 5:51128916-51128938 CAGTGAAAGCAGCCAGGAGGGGG + Intergenic
990389766 5:55307350-55307372 CAGGGCAGACAGCCAGGGGCTGG + Intronic
993985709 5:94595010-94595032 CTCTGAAAGCAGCCAGGAGGGGG - Intronic
996631507 5:125638797-125638819 CACTGAAGTGAGCCAGGTGGGGG - Intergenic
997934094 5:138095752-138095774 CACTGAAGGCAAGCAGAGCCTGG + Intergenic
998405852 5:141874391-141874413 CCAGGAAGGCAGCCAGGGCCCGG - Intronic
998531046 5:142884961-142884983 GCCAGAAGGCAGCCAGGGGTTGG - Intronic
998722270 5:144966489-144966511 CACTGAAAGGAGCCAGGAGGAGG - Intergenic
999017990 5:148129335-148129357 CACTGCAGGGAGGCAAGGGCTGG + Intronic
999602506 5:153282695-153282717 CACTGAAGGCAAGCAGAAGCAGG + Intergenic
1000777819 5:165441901-165441923 CAGTGAAAGCAGCCAGGAGGGGG - Intergenic
1001482181 5:172096006-172096028 CACTGAGGGCAGCTAGAGGGGGG + Intronic
1001592791 5:172877912-172877934 CCCTGCAGCCAGCCTGGGGCTGG + Intronic
1001892835 5:175353428-175353450 CTATGAAGGCAGCAAGGGTCTGG + Intergenic
1002532009 5:179852883-179852905 AAGTGGAGGCAGGCAGGGGCAGG - Intronic
1002541061 5:179907138-179907160 CTCTGAGAGCAGCCAGGAGCAGG + Intronic
1002843085 6:922759-922781 CAGGGAAGGCTGCAAGGGGCAGG + Intergenic
1002875096 6:1203273-1203295 CACAGGTTGCAGCCAGGGGCAGG + Intergenic
1003074611 6:2971927-2971949 CAAAGAAGCCAGCCAGGGGCGGG + Intronic
1003313326 6:4987709-4987731 AAAGGCAGGCAGCCAGGGGCTGG - Intergenic
1004307045 6:14510416-14510438 CACTGAAGGCAGACAGTGGTTGG - Intergenic
1007353684 6:41294461-41294483 CACTGAAAGCAGGCATGGGCAGG - Intergenic
1007781906 6:44259202-44259224 GACTGAAGCCAGGCAGGGTCTGG - Exonic
1008247497 6:49195847-49195869 AGCTGAAGGCAACCAGGAGCAGG - Intergenic
1009726604 6:67543283-67543305 CAATGAAAGCAGCCAGGAGTGGG + Intergenic
1010882987 6:81202159-81202181 CTGTGAAGGCAGCCAGGAGAAGG + Intergenic
1010897590 6:81383525-81383547 TACTGAAAACAGCCAGGAGCAGG - Intergenic
1011164225 6:84427877-84427899 AAATGATGGCAGTCAGGGGCAGG - Intergenic
1011177225 6:84577142-84577164 CACTGATTGAAGCCAGGGCCTGG - Intergenic
1012438080 6:99236061-99236083 AGCTGAAGGCAGCCAGATGCGGG - Intergenic
1013672541 6:112421237-112421259 CACTGAAGGCAAGCAGAAGCAGG + Intergenic
1014116107 6:117670271-117670293 CCATGAAAGCAGCCAGGAGCAGG + Intergenic
1015223028 6:130826346-130826368 CACTAAAGGGCGCCAGGGACAGG + Intergenic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1015863322 6:137702875-137702897 TGCTGAAGGCAGCCAGAGGAGGG - Intergenic
1016540623 6:145159900-145159922 CAATGAAGGCAGCCAGGAGCAGG + Intergenic
1016632597 6:146249820-146249842 CCATGAAAGCAGCCAGGGGGTGG + Intronic
1016851599 6:148624816-148624838 CACAGAAGGGTGCCAGGGGCAGG + Intergenic
1017713435 6:157190395-157190417 CACTGAGGCCAGCCGGGGACAGG - Intronic
1017796658 6:157850809-157850831 CACTGCTGGCTGCCAGGGGCTGG + Intronic
1017883588 6:158579893-158579915 GAGTGGTGGCAGCCAGGGGCTGG + Intronic
1018713823 6:166516409-166516431 CTCTGCAGGAAGCCAGGGGTGGG + Intronic
1018822169 6:167382263-167382285 CAATGAAGGATGCCAGGGGAAGG - Intronic
1019199256 6:170300898-170300920 CCATGAAGGCAGCCAGGAGGGGG - Intronic
1019567683 7:1692662-1692684 CACTCCACCCAGCCAGGGGCAGG - Intronic
1019575124 7:1734044-1734066 GACTGAAGGCAGACAGGTGCTGG - Intronic
1019580681 7:1760560-1760582 TACTGCAGGCAACCAGGGGTGGG + Intergenic
1019641875 7:2107618-2107640 GCCTGAGGGCAGCCGGGGGCTGG - Intronic
1019651840 7:2163766-2163788 CCCTGGAGGCAGCCTGGGCCTGG + Intronic
1019651903 7:2164320-2164342 CTCTGGAGGCAGCCAGGTGAAGG + Intronic
1019673997 7:2299977-2299999 CCCTTAAGGCAGCCAGGAGAAGG - Intronic
1020116609 7:5479809-5479831 CACTGGGTGCAGCCTGGGGCTGG + Intronic
1020271875 7:6601582-6601604 CACTGCACCCAGCCAGGGGACGG + Intronic
1020808166 7:12816755-12816777 CACTGAAGCCTGTCAGGGGGTGG - Intergenic
1022207675 7:28180003-28180025 CGCTGAGGGCAGCGGGGGGCGGG - Intronic
1022729277 7:33007370-33007392 CACTAATGGGAGCCAGTGGCAGG - Intergenic
1024424707 7:49212355-49212377 CTCTGAAAGCAGCCAGGAGGAGG - Intergenic
1024727091 7:52210523-52210545 GACAGCAGGGAGCCAGGGGCAGG - Intergenic
1025044378 7:55680610-55680632 CACTAATGGGAGCCAGTGGCAGG + Intergenic
1026177942 7:68014193-68014215 CACTGAAGGCCTCCAAGGGGTGG + Intergenic
1026201229 7:68216203-68216225 AGTTGAAGGCAGCCAGTGGCAGG + Intergenic
1026460579 7:70611475-70611497 CACGGTAGGCAGCCTAGGGCTGG - Intronic
1027163096 7:75816418-75816440 AGGTGAAGGCAGACAGGGGCAGG - Intronic
1029069244 7:97881763-97881785 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1029686693 7:102153377-102153399 GGATGAAAGCAGCCAGGGGCGGG + Intronic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030645845 7:112060787-112060809 CAATGGAGGTTGCCAGGGGCTGG + Intronic
1031018530 7:116601460-116601482 GACTGAAGGCAGGCAGAGACTGG - Intergenic
1031801829 7:126256674-126256696 TAGTGAAGGGAGCCAGAGGCGGG + Intergenic
1032438567 7:131922763-131922785 CAGTGATGGTTGCCAGGGGCTGG - Intergenic
1033149182 7:138898354-138898376 TACTGACAGCAGCCAGGGCCAGG + Intronic
1033308018 7:140239077-140239099 GAGGGAAGCCAGCCAGGGGCGGG + Intergenic
1033436924 7:141341605-141341627 CACTGCAGACAGGCAGTGGCTGG + Intronic
1033468067 7:141615461-141615483 TACTGAAGGTAGCCTGGGGGGGG - Exonic
1033608935 7:142947154-142947176 CACTCAAGGAACCCAGGGACAGG + Intronic
1033623132 7:143080459-143080481 CACTGTGGCCAGCCAGGAGCAGG - Intergenic
1034204294 7:149302364-149302386 CAGTGCAGGGAGCCAGGGGAAGG - Intergenic
1034317600 7:150147980-150148002 CACTGAAGCCTGCCAGAGGGCGG + Intergenic
1034336098 7:150324504-150324526 CTGTAAAGGCAGCCAGCGGCTGG - Intronic
1034434889 7:151058682-151058704 CACTGGAGTCAGCCAGGGTGTGG + Exonic
1034775157 7:153819245-153819267 CACTGAAGCCTGCCAGAGGGCGG - Intergenic
1035312057 7:157975674-157975696 CACGGAGGGCAGGCAGGGGCTGG - Intronic
1035334672 7:158120171-158120193 GAGTGAAGGCTGCCAGGGGCTGG + Intronic
1035339422 7:158151037-158151059 CAGTGTGGGCAGGCAGGGGCAGG - Intronic
1036251496 8:7166534-7166556 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1036365993 8:8120926-8120948 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
1036884950 8:12545154-12545176 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1037290118 8:17341455-17341477 CACTGAAGCCGGACAGGGGCTGG + Exonic
1037860948 8:22405214-22405236 AACAAAAGGCAGCCTGGGGCTGG + Intronic
1037948805 8:23005631-23005653 CAGTGAAGGGAGCCTGGGTCCGG + Intronic
1038888340 8:31690546-31690568 TACTGAAGGGAGCCAAGGGTGGG + Intronic
1039914030 8:41846503-41846525 CTCTGAAGGCTCGCAGGGGCTGG + Intronic
1040550447 8:48433230-48433252 CACTCATGGGAGCCAGAGGCAGG + Intergenic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041188548 8:55328642-55328664 AACTGGAGGGAGCCAGGGGCTGG - Intronic
1042292305 8:67181841-67181863 CAATGTTGGCTGCCAGGGGCTGG - Intronic
1043262497 8:78219931-78219953 CAATGAAAGCAGCCAGGAGAGGG - Intergenic
1043940400 8:86189938-86189960 CTGTGAAAGCAGCCAGGAGCAGG - Intergenic
1045873333 8:106950201-106950223 GACTGAGGGCAGCCTGGTGCAGG + Intergenic
1047799884 8:128297781-128297803 GACTGGAGGCAGCCAGGTGGAGG - Intergenic
1048050770 8:130814053-130814075 CAATGAGGTGAGCCAGGGGCTGG - Exonic
1048833441 8:138497314-138497336 CCCTGATGGGAGCCCGGGGCGGG + Intergenic
1049197659 8:141324529-141324551 CACTCATGGCAGCGAGGGGAGGG - Intergenic
1049256906 8:141619005-141619027 CACTGAAGCAACCCAGAGGCAGG - Intergenic
1049279446 8:141736904-141736926 CGGTGAGGGCAGGCAGGGGCGGG - Intergenic
1049318944 8:141985694-141985716 CACTGGAGGCAGCCAGGGCTGGG - Intergenic
1049371227 8:142268427-142268449 CACTGCAGCCAGCGAGGGGCAGG - Intronic
1049386236 8:142344437-142344459 CCCTGAAGGCAGCCGGATGCCGG - Exonic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049611648 8:143558702-143558724 CCCAGAAGGCAGCTGGGGGCGGG - Intronic
1049664379 8:143836533-143836555 CTCTGCTGGCAGCCAGGAGCAGG + Intronic
1049818919 8:144622367-144622389 CACAGAAGGAAGCCTGTGGCGGG - Intergenic
1049936263 9:504417-504439 CACTGAGGGCCGCCCGCGGCCGG + Intronic
1050807434 9:9698619-9698641 CCCTGAAGACAGCCAGAGACTGG - Intronic
1051050073 9:12922106-12922128 CACTTAAGGAAGCCAGGGACCGG - Intergenic
1051220285 9:14841562-14841584 CTCTGAAGGAAGCCATGGACAGG + Exonic
1052219459 9:26001808-26001830 CACTGGAGCCAGTCAGGGGATGG - Intergenic
1053484096 9:38439186-38439208 CACAGGAGGCAGCCAGAGGTGGG + Intergenic
1054941156 9:70743642-70743664 CACTGAGGTCAGCCAGGGATGGG + Intronic
1055639324 9:78307210-78307232 GAATGGAGGCTGCCAGGGGCTGG - Intronic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056442496 9:86634736-86634758 CACTGGAGGCAGTGAGAGGCTGG + Intergenic
1056522940 9:87416583-87416605 CAGTGAAGGCAGATAGGGGTGGG - Intergenic
1056957948 9:91097435-91097457 CAGTGAAAGCAGCCAATGGCAGG - Intergenic
1057221728 9:93261137-93261159 CTCTGTTGGCAGCCAGTGGCAGG - Intronic
1057279301 9:93698613-93698635 CAGGGAAGGCAGCCCTGGGCAGG - Intergenic
1057949817 9:99360829-99360851 CAGAGAAGGCATCCAGGGGAAGG - Intergenic
1057954633 9:99397764-99397786 CACTGAAGCCTGTCAGGGGGTGG - Intergenic
1059392673 9:114008757-114008779 CAGTGAAGGCAGCCAGGCTGGGG + Intronic
1059405018 9:114094078-114094100 GACATAAGGGAGCCAGGGGCAGG + Intronic
1059524538 9:114978478-114978500 CTCTGGAGGAAGCCAGGTGCAGG + Intergenic
1059628363 9:116091930-116091952 CTGTGAAGGCAGCCAAGGGCAGG + Intergenic
1059960542 9:119560196-119560218 CTCAGCAGGAAGCCAGGGGCAGG + Intergenic
1060234625 9:121853613-121853635 GACTGCAGGCAGCTGGGGGCCGG + Intronic
1060590296 9:124812037-124812059 GAATGAAGGCAGCAAGGGCCAGG - Exonic
1060727019 9:126013082-126013104 CAGTGAACTCAGCGAGGGGCAGG - Intergenic
1060810922 9:126611197-126611219 CAGAGAAGGCAGCCAGGCTCTGG + Intergenic
1060995449 9:127872959-127872981 CACTGGAGGGAGCCCGGGCCTGG - Intronic
1061249328 9:129417243-129417265 CACTGGAGGCCTCCAGGTGCAGG + Intergenic
1061515686 9:131088745-131088767 GAATGATGGCTGCCAGGGGCTGG - Intronic
1061623615 9:131827498-131827520 CAATGGAGGCTGCCGGGGGCTGG + Intergenic
1062009459 9:134259238-134259260 CACTGGGAGAAGCCAGGGGCAGG - Intergenic
1062726520 9:138077171-138077193 CACTGATGACAGCCGGAGGCAGG - Intronic
1185643141 X:1599463-1599485 CACTGAGGGCAGCCCGGGCGCGG - Intronic
1185722764 X:2395327-2395349 CACTGGGGCCAGCCAGGGGGTGG + Intronic
1185776977 X:2811028-2811050 CACTGAAGACATCCAAGGCCAGG - Intronic
1185838037 X:3363256-3363278 CACTGATGTCTGCCAAGGGCTGG + Intergenic
1187894367 X:23966713-23966735 CCATGAAGGCAGCCAGGAGCGGG - Intergenic
1188749304 X:33885477-33885499 CCCTGAAGGCAGCTAGGAGAGGG + Intergenic
1189390140 X:40569672-40569694 CACTGCAGTCAGACAGTGGCTGG - Intergenic
1189483173 X:41408587-41408609 TACTGAAGCCAGCCAGAGGTGGG - Intergenic
1189504194 X:41594594-41594616 GACTGGAGGCCGCCTGGGGCAGG + Intronic
1189811874 X:44788510-44788532 CACTGAAAGGAGCCAGGGGCCGG + Intergenic
1191211411 X:57889115-57889137 CAGTGAATGCAGCCAGGAGTGGG - Intergenic
1192273674 X:69608777-69608799 CACTGTGGGCAGGCAGGGTCAGG + Intergenic
1193139905 X:78016833-78016855 CAGTGAAAGCAGCCAGTGGCAGG - Intronic
1193711386 X:84884303-84884325 CCATGAAGGCAGCCAGAGGGAGG + Intergenic
1193840650 X:86404597-86404619 CAGTGAAAGCAGCCAGAAGCAGG - Intronic
1194843663 X:98776370-98776392 CAATGAAAGCAGCCAGGAGGAGG + Intergenic
1195066501 X:101242670-101242692 CACTCAGGGTAGACAGGGGCAGG + Intronic
1195428541 X:104762426-104762448 CCATGAAGGCAGCCAGGAGAGGG - Intronic
1195586069 X:106566763-106566785 CACTGTAGGCAGACATGGCCAGG - Intergenic
1197088628 X:122510008-122510030 CCATGAAAGCAGCCAGGAGCGGG - Intergenic
1198612563 X:138418213-138418235 CTGTGAAAGCAGCCAGGAGCAGG + Intergenic
1199127353 X:144138863-144138885 CAATGAAAGCAGCCAGGAGGGGG - Intergenic
1199147105 X:144381119-144381141 CAGTGAAAGCAGCCAGGAGGAGG + Intergenic
1199231685 X:145443822-145443844 CTGTGAAAGCAGCCAGGAGCGGG + Intergenic
1199608288 X:149593711-149593733 CACTGAAGGGCGCCTGGCGCAGG - Intronic
1199630832 X:149775649-149775671 CACTGAAGGGCGCCTGGCGCAGG + Intronic
1199976913 X:152899522-152899544 CACAGCATCCAGCCAGGGGCTGG - Intergenic
1200295318 X:154913789-154913811 CCATGAAAGCAGCCAGGAGCAGG - Intronic
1201293030 Y:12440445-12440467 CACTGAAGACATCCAAGGCCAGG + Intergenic
1202061804 Y:20896792-20896814 CAGTGAAGGGAGACAGGGGTGGG - Intergenic